Specific primer for identifying gender of trionychidae and detection method of specific primer
By designing specific primers based on the Z/W chromosome intron region and combining PCR amplification and electrophoresis detection, the problems of narrow applicability, insufficient accuracy and poor stability of existing turtle sex identification methods have been solved, and efficient and accurate sex determination has been achieved in multiple species.
Patent Information
- Application Number
- CN202511251688.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-03
- Publication Date
- 2025-11-18
AI Technical Summary
Existing methods for sex determination in turtles suffer from narrow applicability, insufficient accuracy, and poor stability, making it difficult to meet the needs of cross-species applications.
We designed specific primers based on the Z/W chromosome intron regions, and through PCR amplification and electrophoresis detection, we can accurately distinguish between male (ZZ) and female (ZW) individuals in multiple species, simplifying the operation process and improving detection efficiency.
It achieves broad applicability and high accuracy in sex determination across species, simplifies the operation process, improves the efficiency and accuracy of sex determination, and is suitable for rapid batch testing.
Smart Images

Figure CN120966975A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of gender identification of Trionychidae, in particular to a specific primer for gender identification of Trionychidae and a detection method thereof. BACKGROUND
[0002] Trionychidae is an important aquatic farming object, and its gender identification is of great significance for farming production and scientific research. Since Trionychidae lacks obvious external gender characteristics in the juvenile stage, the traditional morphological identification method is difficult to accurately determine its gender, and therefore it has become a research hotspot to develop a rapid and accurate molecular biology gender identification method.
[0003] At present, there are many molecular markers and methods for gender identification of Trionychidae. Chinese patent application CN108048579A discloses a PCR primer and method for rapid identification of the genetic sex of Trionyx sinensis. The method is determined by electrophoretic band type: when only 973 bp band appears, it is determined as male; when 1533 bp and 973 bp bands appear at the same time, it is determined as female. It should be noted that the patent text misstates the sex chromosome type: Trionyx sinensis has ZW sex determination system, in which ZZ is male and ZW is female. This method provides certain technical support for the genetic sex identification of Trionyx sinensis. Chinese invention patent CN115232882B proposes a method for gender identification of Trionyx sinensis based on SNP markers. The invention uses three SNP sites (311th, 329th and 332nd bases) for gender determination. In males, the genotypes are AA, CC and CC. In females, the genotypes are AG, AC and CT. This method identifies the genetic sex of Trionyx sinensis through allele-specific PCR technology, which is not affected by tissue specificity and environment. Chinese patent application CN116769891A discloses another method for gender identification of Trionyx sinensis based on SNP markers. This method only needs to identify one SNP site (P9655) to confirm the gender. AG genotype is female and AA genotype is male. This method simplifies the identification process and improves the identification efficiency. For Trionyx sinensis, Chinese invention patent CN113755566B proposes a method for rapid gender identification of PCR primer set. Through PCR amplification and electrophoresis detection, when 834 bp and 1589 bp bands appear, it is determined as female; when only 834 bp band appears, it is determined as male. This method can identify the gender of Trionyx sinensis at different developmental stages and has certain practicality. In addition, Chinese patent application CN119979691A discloses a specific primer pair for gender identification of Trionyx sinensis, as well as an identification method and kit. The method uses PCR amplification reaction to determine gender according to the band type of amplification product: 1000 bp amplification product is determined as male, and 1000 bp and 2000 bp bands are determined as female. This method uses standard PCR amplification conditions and reaction system, which helps to improve the efficiency and accuracy of gender identification of Trionyx sinensis.
[0004] However, the existing gender identification methods for Trionychidae in the prior art still have some limitations. Most of the existing methods have a narrow application range, are mainly designed for a single species (such as Chinese soft-shelled turtle or Trionyx spiniferus), lack a universal identification method for the entire Trionychidae, and cannot meet the cross-species application requirements. Due to the lack of primer specificity, the accuracy of some methods needs to be improved, especially among different geographical populations. The stability of the existing methods is poor, which is difficult to meet the needs of large-scale breeding and scientific research. The genetic diversity among Trionychidae species leads to the fact that traditional primers cannot completely cover all individuals, affecting the accuracy and reliability of gender determination. At present, the commonly used gender identification method for Chinese soft-shelled turtle mainly relies on detecting sex-determining genes or chromosomal differences. Polymerase chain reaction (PCR) is widely used because it can target specific DNA fragments for amplification. In practice, it has achieved certain results, but it is still limited by primer specificity and applicability when applied across species. The existing methods generally have a narrow application range, insufficient accuracy, and poor stability. Therefore, it is urgent to develop a new Trionychidae gender identification technology with high stability, accuracy, and wide applicability to meet the dual goals of large-scale, standardized breeding and scientific research.
[0005] Therefore, it is of great significance to develop a Trionychidae gender identification method with a wide application range, high accuracy, and good stability to promote the breeding and scientific research of Trionychidae. SUMMARY
[0006] One of the technical problems to be solved by the present application is to provide a specific primer for Trionychidae gender identification to solve the problems of poor inter-species primer specificity, insufficient gender identification accuracy, complex operation, and limited application range in the prior art.
[0007] To overcome the defects of the above prior art, the present application provides a specific primer for Trionychidae gender identification, which comprises a forward primer and a reverse primer as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The sequences of the forward primer and the reverse primer are as follows: Forward primer: 5'GGTGATGGTGGTACTGGTAAAAC 3'; Reverse primer: 5'GCAGACCACCAAATTTCTCCTG 3'.
[0008] Compared with the prior art, the primer of the present application is designed based on the sequence difference of the intron region of Z / W chromosome. Through PCR amplification, accurate differentiation of male (ZZ) and female (ZW) individuals in multiple species can be achieved. The primer provided by the present application has the following advantages: High universality: since the exon region is highly conserved in multiple Trionychidae species, the primer is designed based on the intron difference on the exons at both ends, which can effectively amplify the Z / W chromosome region in multiple Trionychidae species, solves the problem of poor specificity of the primer in the prior art, and has cross-species applicability; improve accuracy: through the accurate Z / W chromosome intron difference, the present application can realize higher accuracy of gender determination, compared with the traditional method relying on a single gender-specific gene, the technical problem of insufficient accuracy of gender identification is solved; simplify the operation process: the primer identification of the present application is compatible with the existing standard DNA extraction process, simple operation, suitable for rapid batch detection, which can greatly improve the efficiency of gender determination, and solves the problems of complex operation and special conditions in the prior art.
[0009] One of the technical problems to be solved by the present application is to provide a method for identifying the gender of Trionychidae using primers, to solve the problems of poor cross-species applicability, low accuracy, complex operation and low gender determination efficiency in the prior art, and to provide an efficient, accurate and widely applicable method for identifying the gender of Trionychidae.
[0010] To overcome the defects of the above prior art, the present application provides a method for identifying the gender of Trionychidae using the primer, comprising the following steps: S1: extracting the genomic DNA of the Trionychidae individual to be tested; S2: using the specific primer for PCR amplification to obtain an amplification product; S3: electrophoresis detection of the amplification product, when only a 250bp band appears, it is determined to be male, and when 250bp and 600bp bands appear at the same time, it is determined to be female.
[0011] Compared with the prior art, the method for identifying the gender of the Trionychidae by using the primer has the following advantages: the identification method of the present application uses the specific primer designed based on the difference in the intron sequence of Z / W chromosome, and uses the PCR amplification technology to produce gender-specific bands in the amplification product. Through electrophoresis detection, when only a 250bp band appears in the amplification product, it is determined to be male (ZZ type); when 250bp and 600bp bands appear, it is determined to be female (ZW type). The stable difference in Z / W chromosome makes the method of the present application have wide applicability across species, and can effectively solve the problem of accuracy of gender determination of different Trionychidae species. The simplicity of electrophoresis detection makes the gender determination process faster and more intuitive, avoiding the cumbersome analysis steps in the traditional method. Unlike the primer in the prior art which relies on a single gender determination gene, the primer of the present application is designed based on the difference in the intron of Z / W chromosome, and can stably and effectively amplify the difference region in multiple Trionychidae species. The primer of the present application can be used universally in multiple species, solving the problem of poor cross-species applicability in the prior art. Moreover, the primer in the prior art often has poor inter-species specificity, resulting in inaccurate gender determination. The primer designed in the present application is accurately positioned in the intron region of Z / W chromosome, and the product obtained by PCR amplification can significantly improve the accuracy of gender determination.
[0012] In one possible implementation, in the step S1, the Trionychidae to be detected is one of Pelodiscus sinensis, Pelochelys cantor, and Trionyx spinifer.
[0013] Compared with the prior art, the above technical solution can effectively solve the problem of species-specific primer limitation in the prior art. Traditional gender identification methods are often limited to specific species or only a few species. However, the present application uses specific primers designed based on the difference in the intron region of Z / W chromosome, which can be used universally in multiple species such as Pelodiscus sinensis, Pelochelys cantor, and Trionyx spinifer. The method of the present application has high cross-species applicability, and meets the practical application needs of different Trionychidae species in breeding and scientific research.
[0014] In one possible implementation, in the step S2, the total volume of the PCR amplification system is 20μL, including Taq enzyme 10μL, forward primer 0.8μL, reverse primer 0.8μL, template DNA 0.5μL, and ddH2O 7.9μL.
[0015] Compared with the prior art, the above technical scheme can simplify the reaction system, make the experimental operation more convenient, and be compatible with the existing kit in the standardized DNA extraction process, reducing the need for additional reagents and equipment.
[0016] In a possible implementation, in the step S2, the amplification procedure of the PCR amplification is: 95 DEG C pre-denaturation for 3 minutes, then 36 cycles, each cycle including 95 DEG C denaturation for 30 seconds, 58 DEG C annealing for 30 seconds, and 72 DEG C extension for 30 seconds, and finally 72 DEG C extension for 5 minutes.
[0017] Compared with the prior art, the PCR procedure in the prior art may have problems such as unstable annealing temperature or inappropriate cycle number, resulting in low amplification efficiency or non-specific amplification, while the above technical scheme of the present application can realize efficient DNA amplification, improve amplification specificity and stability, and further set precise annealing temperature and cycle number by optimizing the amplification procedure, thereby ensuring high specificity and stability of the amplification product.
[0018] In a possible implementation, in the step S3, the amplification product is detected by agarose gel electrophoresis, and the concentration of the agarose gel is 1.5%.
[0019] Compared with the prior art, the above technical scheme can improve the separation effect of the amplification product and ensure the accuracy of gender determination, and the electrophoresis detection in the prior art often uses agarose gels with different concentrations, which leads to insufficient resolution and difficulty in clearly distinguishing bands of different sizes, thereby affecting the accuracy of gender identification, while the present embodiment can optimize the electrophoresis conditions by using 1.5% agarose gel, improve the resolution, clearly separate the 250bp and 600bp bands, and ensure the reliability and stability of the results.
[0020] Another technical problem to be solved by the present application is to provide a kit for gender identification of Trionychidae, to solve the problems of the need for multiple reagents for gender determination, complex operation and difficulty in standardization in the prior art.
[0021] To overcome the defects of the above prior art, the present application provides a kit for gender identification of Trionychidae, comprising the primer pair.
[0022] In a possible implementation, the kit further comprises one or more components of Taq enzyme, dNTPs, PCR buffer and ddH2O.
[0023] Compared with the prior art, the kit for gender identification of Trionychidae in the application has the following advantages: the kit can simplify the experimental process, reduce the types of required reagents, and thus reduce the operation difficulty and improve the detection efficiency. The existing kit usually contains multiple different reagents, and needs to be adjusted according to different experimental steps during use, which is cumbersome and prone to human error. The kit of the application integrates the required reagents, and provides a more standardized and convenient gender identification tool, which can significantly improve the work efficiency of laboratories and production sites. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 A technical flow chart of the detection method for gender identification of Trionychidae in the application; Figure 2 A technical schematic diagram of the detection method for gender identification of Trionychidae in the application; Figure 3 An electropherogram for detecting primer specificity using known gender-specific DNA, wherein the agarose gel concentration is 1.5%. DETAILED DESCRIPTION
[0025] First of all, those skilled in the art should understand that these embodiments are only used to explain the technical principles of the embodiments of the application, and are not intended to limit the protection scope of the embodiments of the application. Those skilled in the art can adjust them as needed to adapt to specific application occasions.
[0026] The application provides a specific primer for gender identification of Trionychidae, which comprises a forward primer and a reverse primer as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the sequences of the forward primer and the reverse primer are as follows: Forward primer: 5'GGTGATGGTGGTACTGGTAAAAC 3'; Reverse primer: 5'GCAGACCACCAAATTTCTCCTG 3'.
[0027] The application further provides a method for gender identification of Trionychidae using the primer, which comprises the following steps as shown in Figure 1 、 Figure 2 S1: extracting genomic DNA of a Trionychidae individual to be tested; S2: performing PCR amplification using the specific primer to obtain an amplification product; S3: performing electrophoresis detection on the amplification product, and determining male when only a 250bp band appears, and determining female when 250bp and 600bp bands appear at the same time.
[0028] As a preferred scheme, in the step S1, the to-be-tested Trionychidae is one of Chinese soft-shelled turtle, Indian soft-shelled turtle and Pearl soft-shelled turtle.
[0029] As a preferred scheme, in the step S2, the total volume of the PCR amplification system is 20 μL, including 10 μL of Taq enzyme, 0.8 μL of forward primer, 0.8 μL of reverse primer, 0.5 μL of template DNA and 7.9 μL of ddH2O.
[0030] As a preferred scheme, in the step S2, the amplification procedure of the PCR amplification is as follows: 95℃ pre-denaturation for 3 minutes; then 36 cycles, each cycle including 95℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds and 72℃ extension for 30 seconds; finally, 72℃ extension for 5 minutes.
[0031] As a preferred scheme, in the step S3, the amplification product is detected by agarose gel electrophoresis, and the concentration of the agarose gel is 1.5%.
[0032] The application further provides a kit for gender identification of Trionychidae, which comprises the primer pair.
[0033] As a preferred scheme, the kit further comprises one or more components of Taq enzyme, dNTPs, PCR buffer and ddH2O.
[0034] The application is based on the intron difference sequence of the Z / W chromosome Tascsp gene of Chinese soft-shelled turtle, and provides a stable and applicable molecular determination method between species, which breaks through the poor applicability of traditional methods between species, and is different from the existing determination method which depends on gender-specific genes or exon differences. The application is based on the intron sequence difference for primer design, and the intron region has higher sequence diversity and evolutionary stability and is not affected by selection pressure, so that a stable and significant sequence difference marker can be provided between different genders, thereby avoiding the limitation of relying on gene expression. The traditional method has low accuracy in species with unobvious or variable gender-specific gene expression. The application uses the sequence characteristics of intron difference, and can be independent of gene expression mode and remain effective in determination of different species and different individuals. The application locks the region of conserved exons and differential introns between species, realizes stable determination of multiple species and different gender individuals, and is especially suitable for members of Trionychidae which lack obvious gender-specific molecular markers. In order to overcome the problem of insufficient universality of the existing technology in Trionychidae, aiming at the pain point that the genetic difference between Trionychidae species is large and the existing gender determination primers are not universal, the application develops a primer system with species specificity and universality based on the sequence of Chinese soft-shelled turtle. The application selects a gene region with highly conserved exons and significantly different introns as a target, so as to ensure that the gender can be accurately amplified and determined in multiple species of Trionychidae, and the spectrum and accuracy of detection are greatly improved.
[0035] In combination with the above technical content, specific embodiments are provided to further explain and describe the technical solutions of the application: In the following embodiments of the application, the general experimental conditions are as follows: (1) PCR reaction system (total 20 μL): 2x PCR Premix (or Taq Master Mix) 10 μL; forward primer 0.8 μL (0.2-0.5 μM), reverse primer 0.8 μL (0.2-0.5 μM), template DNA 0.5 μL (10-100 ng), ddH2O to 20 μL.
[0036] Table 1: PCR reaction system (2) PCR program: 95 ℃ pre-denaturation for 3 min; cycle 36 times: 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 30 s; 72 ℃ final extension for 5 min.
[0037] (3) Electrophoresis: 1.5% agarose gel, conventional condition detection of amplification product.
[0038] In the present application, the PCR reaction system can be configured in two ways, both keeping the total system volume at 20 μL, and the amplification procedure and electrophoresis detection conditions are the same: Kit method: 2×Premix 10 μL is used, and the forward primer, reverse primer, template DNA and ddH2O are added to complete the system configuration; Classic method (self-prepared system): If Premix is not used, Taq enzyme, dNTPs, PCR buffer and MgCl2 can be added in sequence, and mixed with primers, template DNA and ddH2O. The resulting reaction system is equivalent to the system using 2×Premix, and the final total volume is also 20 μL.
[0039] Example 1 The present application provides a specific primer for gender identification of Trionychidae, comprising the following nucleotide sequence: Forward primer: 5'GGTGATGGTGGTACTGGTAAAAC 3'; Reverse primer: 5'GCAGACCACCAAATTTCTCCTG 3'.
[0040] The above specific primer of the present application is designed for the need of gender identification of Trionychidae animals. By analyzing and comparing the sequence regions related to gender determination in the genome of Trionychidae animals, a highly specific and conserved region is selected to design the primer. The forward primer is 23 nucleotides long, and the reverse primer is 22 nucleotides long. Both have appropriate GC content and annealing temperature, ensuring specificity and efficiency in the PCR amplification process.
[0041] In practical application, when the above primer of the present application is used for PCR amplification of DNA samples of Trionychidae animals, gender-specific amplification products can be obtained. For male individuals, a specific size of DNA fragment is produced, while for female individuals, a different size of fragment is produced, thereby achieving accurate identification of the gender of Trionychidae animals. The specific primer for gender identification of Trionychidae animals of the present application takes into account the sequence characteristics of different species of Trionychidae animals, has good universality, and can be applied to the gender identification of various Trionychidae animals. The primer sequence avoids possible SNP (single nucleotide polymorphism) sites, reducing identification errors caused by individual differences. At the same time, the design of the above primer also considers the possibility of avoiding the formation of secondary structure and primer dimer, improving the specificity and sensitivity of the PCR reaction.
[0042] The conditions for performing the PCR reaction using the above-mentioned primer of the present application are the general experimental conditions described above, and the PCR product can be observed by agarose gel electrophoresis, and the gender of the sample is determined according to the size and appearance mode of the DNA fragment. The primer can be stored stably under laboratory conditions, and can be stored for a long time at -20°C, avoiding repeated freezing and thawing to maintain its activity.
[0043] The design and application of the specific primer of the present application provide a rapid, accurate and economical molecular biology method for gender identification of Trionychidae, which has important value for the breeding management and scientific research of Trionychidae.
[0044] Embodiment 2 The present embodiment provides a method for gender identification of Trionychidae using specific primers for gender identification of Trionychidae, wherein the specific primers used include the forward primer 5'GGTGATGGTGGTACTGGTAAAAC 3' and the reverse primer 5'GCAGACCACCAAATTTCTCCTG 3', which are the same as the primers in Embodiment 1.
[0045] The method comprises the following steps: S1: extracting the genomic DNA of the Trionychidae individual to be tested; In this step, genomic DNA is extracted from the tissue (including blood, muscle or fin) of the Trionychidae to be tested. The Trionychidae to be tested can be any one of Chinese soft-shelled turtle, Indian soft-shelled turtle or Pearl soft-shelled turtle. The DNA extraction in the present application can be performed using a conventional tissue DNA extraction kit to ensure that a high-purity and high-integrity genomic DNA sample is obtained, and specifically comprises:
[0046] The DNA of the Chinese soft-shelled turtle, Indian soft-shelled turtle and Pearl soft-shelled turtle sample is extracted, and then the extracted DNA is dissolved in 20 μL sterilized ultrapure water, and then 0.5 μL of the DNA sample is taken for PCR amplification; The process of designing the primer in the present application is as follows: According to the chromosome-specific intron sequence of Chinese soft-shelled turtle, the second intron of Tascsp gene is selected, and the PCR amplification primer is designed by BLAST comparison and using Primer3 software. The above-mentioned primer is synthesized by Shanghai Shengong Bioengineering Technology Service Co., Ltd. for PCR amplification, and the primer is the same as that in Embodiment 1.
[0047] S2: performing PCR amplification using the specific primer to obtain an amplification product; In this step, the PCR amplification reaction system is as shown in the general conditions.
[0048] S3: performing electrophoresis detection on the amplification product, and determining that it is male when only a 250 bp band appears, and determining that it is female when 250 bp and 600 bp bands appear simultaneously.
[0049] The samples of Chinese soft-shelled turtle, Pelodiscus sinensis, Pelochelys cantor and Palea steindachneri were verified respectively in this embodiment, 5 male individuals and 5 female individuals were selected for each species for detection, and the results were completely consistent with the actual gender, as shown in Table 1. Figure 3 Through the above verification design, it is further proved that the primers designed in the present application can be universally applied in Chinese soft-shelled turtle, Pelochelys cantor and Palea steindachneri, and have reliable gender identification effect.
[0050] Embodiment 3 The present embodiment provides a kit for gender identification of Trionychidae, the PCR system of the present embodiment is configured by using the kit method, which is equivalent to the classical method, and the kit comprises a specific primer pair, the primer pair comprises the following nucleotide sequences: Forward primer: 5'GGTGATGGTGGTACTGGTAAAAC 3'; Reverse primer: 5'GCAGACCACCAAATTTCTCCTG 3'.
[0051] The design features of these specific primers and the application principle thereof in gender identification of Trionychidae are the same as those described in Embodiment 1, and will not be repeated here.
[0052] In the present embodiment, the kit further comprises other components required for PCR reaction, specifically comprising: Taq DNA polymerase: the concentration is 5 U / μL, 1 μL is used for each reaction; dNTPs mixture: the concentration is 10 mM, 0.5 μL is used for each reaction; PCR buffer: 10x concentration, containing 15 mM MgCl2, 2.5 μL is used for each reaction; Double distilled water (ddH2O): used to adjust the reaction system to a final volume of 20 μL.
[0053] The components of the kit are packaged in separate centrifuge tubes and stored at -20°C, and when used, the PCR reaction system is prepared according to the above proportions, 10-100 ng of Trionychidae DNA sample is added, and PCR amplification reaction is carried out.
[0054] The components in the kit in the present embodiment are optimized and matched to ensure that high-efficiency and specific amplification effect can be obtained in PCR reaction, wherein Taq enzyme has good thermal stability and is suitable for conventional PCR reaction; dNTPs provide nucleotide raw materials required for DNA synthesis; PCR buffer maintains a suitable pH environment and provides magnesium ions, ensuring the activity of Taq enzyme; and ddH2O is used to adjust the volume and concentration of the reaction system.
[0055] And the kit of the present application can also contain internal reference gene primers, so as to verify the effectiveness of the PCR reaction and the quality of the sample DNA, the internal reference gene primers target a highly conserved gene region in Trionychidae, which can produce stable amplification products regardless of the sample gender.
[0056] The kit provided by the present application is simple to use, only the components are mixed in the proportion indicated in the instructions, the sample DNA is added, and the PCR instrument is put into the program for amplification. After amplification, the PCR product is detected by agarose gel electrophoresis, the sample gender is judged according to the band pattern, and the components in the kit provided in the above examples of the present application are strictly quality controlled, have good stability and consistency, ensure the accuracy and repeatability of the identification results, and the design of the kit considers the routine operation conditions of the laboratory, so that the user can complete the gender identification of Trionychidae without special equipment.
[0057] Through the above examples, it is further proved that, compared with the traditional molecular detection method relying on a single gender determination gene, the specific primers designed based on the intron region difference in the chromosome of the present application have a significant cross-species application advantage. The primers of the present application can realize stable W chromosome specific amplification in a variety of Trionychidae species, which can meet the gender determination needs of different individuals, and can be extended to the identification of closely related species and non-model species, and has both research exploration and industrial application potential. The method of the present application uses the intron difference region of the homologous gene in the chromosome to design specific primers, and generates gender-specific bands through PCR amplification. Since the target segment has high conservation among multiple species, it not only meets the detection needs of a single species, but also has cross-species universality and batch detection advantages. Based on the gender determination system of Trionychidae, the present application designs specific molecular markers for the intron difference of the homologous gene in the chromosome, which can accurately determine male and female individuals at the genomic DNA level through PCR amplification. This technology does not depend on external characteristics, and can play an important role in early breeding selection, directional fattening and gender ratio regulation, and provides reliable technical support for large-scale and precise Trionychidae breeding.
[0058] In the description of the application, the description of the terms "one embodiment", "some embodiments", "in this embodiment", "specific example", or "some examples" and the like means that the specific features, mechanisms, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the application. In the description, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, mechanisms, materials or characteristics described can be combined in any suitable manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.
[0059] The above description is merely a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art can easily think of changes or replacements within the technical scope disclosed in the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.
Claims
1. A specific primer for sex identification in turtles (Trionyx sinensis), characterized in that, Includes the forward and reverse primers shown in SEQ ID NO.1 and SEQ ID NO.2, the sequences of which are as follows: Forward primer: 5'GGTGATGGTGGTACTGGTAAAAC3'; Reverse primer: 5'GCAGACCACCAAATTTCTCCTG3'.
2. A method for sex identification of turtles using the primers described in claim 1, characterized in that, Includes the following steps: S1: Extract genomic DNA from the individual turtle species to be tested; S2: PCR amplification was performed using specific primers to obtain the amplification products; S3: Perform electrophoretic detection on the amplification product. If only a 250bp band appears, it is determined to be male. If both 250bp and 600bp bands appear, it is determined to be female.
3. The detection method for sex identification of turtles using the primers described in claim 2, characterized in that, In step S1, the turtle species to be tested is one of the following: Chinese soft-shelled turtle, horned soft-shelled turtle, or pearl soft-shelled turtle.
4. The method for sex identification of turtles using the primers according to claim 2, characterized in that, In step S2, the total volume of the PCR amplification system is 20 μL, including 10 μL of Taq enzyme, 0.8 μL of forward primer, 0.8 μL of reverse primer, 0.5 μL of template DNA, and 7.9 μL of ddH2O.
5. The detection method for sex identification of turtles using the primers described in claim 2, characterized in that, In step S2, the PCR amplification program is as follows: pre-denaturation at 95°C for 3 minutes; followed by 36 cycles, each cycle including denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds; and finally extension at 72°C for 5 minutes.
6. The detection method for sex identification of turtles using the primers described in claim 2, characterized in that, In step S3, the amplification product is detected by agarose gel electrophoresis, and the concentration of the agarose gel is 1.5%.
7. A kit for sex determination in turtles, characterized in that, It includes the primer pair as described in claim 1.
8. The reagent kit according to claim 7, characterized in that, The kit also contains one or more components selected from Taq enzyme, dNTPs, PCR buffer, and ddH2O.
Citation Information
Patent Citations
PCR amplification primer, method and kit for rapidly identifying genetic sex of Chinese softshell turtle
CN108048579A
Rapid sex determination of soft-shelled turtle using PCR primers, sites, methods, and kits
CN113755566B
A genetic sex-linked SNP marker of Chinese soft-shell turtle, its primers and application
CN115232882B
SNP (Single Nucleotide Polymorphism) marker for rapidly identifying genetic sex of Chinese softshell turtle as well as primer and application of SNP marker
CN116769891A
Specific primer pair for sex identification of Chinese softshell turtles, identification method and kit
CN119979691A