Constant-temperature detection method for rice fragrance gene mutation based on recombinase polymerase amplification reaction
By using RPA technology and primer design, the problems of low efficiency and instrument dependence in rice aroma gene mutation detection have been solved, enabling rapid and sensitive detection of rice aroma gene mutations under isothermal conditions, which is suitable for agricultural breeding and market identification.
Patent Information
- Application Number
- CN202511295274.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-18
AI Technical Summary
Existing technologies are inefficient and have insufficient throughput when detecting mutations in rice aroma genes, and require complex instruments, making it difficult to conduct rapid and efficient detection in the field and laboratory.
Using recombinase polymerase amplification reaction (RPA) technology, a specific primer pair for the rice aroma gene Badh2-E2 was designed, and an isothermal detection method was established, including primer design, plasmid preparation, and reaction system optimization, to achieve rapid amplification and detection at 37-42℃.
It enables rapid detection of rice aroma gene mutations at room temperature without the need for complex instruments, and is suitable for both field and laboratory use, improving detection efficiency and sensitivity.
Smart Images
Figure CN120967046A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for detecting mutations in rice aroma genes, specifically, to a isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction. Background Technology
[0002] Aroma is one of the most important characteristics of rice quality, and its intensity influences consumers' willingness to buy and their decisions to repurchase. Fragrant rice, with its unique aroma when cooked, is widely favored by consumers, and its price is often several times higher than that of ordinary rice. As a key indicator of high-end branded rice, aroma has received significant attention from breeders, rice merchants, and consumers. The screening of fragrant rice resources and the identification and utilization of aroma genes have great practical significance for rice genetics and breeding, as well as the development of the rice industry.
[0003] The aroma of rice is mainly caused by a mutation in the Badh2 gene, which leads to the accumulation of 2-acetyl-1-pyrroline (2-AP), giving the rice its distinctive aroma. Compared to normal non-fragrant rice, fragrant rice has a 7-base deletion at exon 2 of the Badh2 gene, which encodes betaine aldehyde dehydrogenase (BADH2) on chromosome 8 (Badh2-E2 allele mutation). This results in the loss of function of Badh2, and the accumulation of 2-AP, which makes the rice fragrant.
[0004] Currently, the detection of Badh2 requires DNA extraction, PCR amplification, and detection of the amplification products. Detection of these products largely relies on agarose gel electrophoresis, polyacrylamide gel electrophoresis, and device-based fluorescence detection, which have limitations in efficiency and throughput. Therefore, there is a need to develop a highly efficient, specific, and sensitive method that can perform the detection without complex instruments.
[0005] Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technique developed to provide a rapid, simple, and sensitive method for nucleic acid amplification, overcoming the limitations of PCR in terms of complex equipment and time consumption. The core of RPA technology lies in utilizing multiple recombinases, single-stranded binding proteins, and strand displacement DNA polymerases to specifically amplify target sequences under isothermal conditions, initiated by two primers. Applying RPA to the rapid identification of rice varieties with aroma characteristics can overcome the shortcomings of existing technologies. Summary of the Invention
[0006] The purpose of this invention is to provide a detection method for rapidly identifying rice varieties with aroma characteristics. To address the shortcomings of existing technologies, this invention establishes an efficient, specific, and sensitive RPA detection system to serve fields such as fragrant rice variety breeding, variety purification, quality monitoring, and market identification.
[0007] To achieve the above objectives, this invention provides a isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction. The method comprises: Step 1, designing primers for the recombinase polymerase amplification reaction, including: Step 1.1, screening molecular targets by comparing the Badh2-E2 gene with wild-type sequences to identify wild-type Badh2-W and mutant Badh2-E2 target sequences; Step 1.2, designing and optimizing primers based on the sequence information of the Badh2-E2 target gene, designing primers for the recombinase polymerase amplification reaction, and then performing preliminary screening to obtain primers for the wild-type Badh2-W gene and primers for the mutant Badh2-E2 gene; Step 2, preparing plasmid standards, including: Step 2.1, performing molecular cloning by constructing recombinant plasmids containing the wild-type Badh2-W gene and the mutant Badh2-E2 gene. The plasmid was constructed in step 2.1, and the target sequence was confirmed to be accurate and without mutations by sequencing. Step 2.2 involved introducing the recombinant plasmid constructed in step 2.1 into competent cells for transformation. After proliferation in culture medium, plasmid was extracted to obtain plasmid standards. Step 2.3 involved determining the concentration of the plasmid standards obtained in step 2.2 to obtain the gene copy number concentration, which served as a standard control and positive template for subsequent recombinase polymerase amplification reactions. Step 3 involved establishing a standard detection method, including: Step 3.1, establishing a recombinase polymerase amplification reaction system; Step 3.2, optimizing the recombinase polymerase amplification reaction conditions; Step 3.3, screening primers, selecting the primer combination obtained in step 1.2, and performing specific reaction tests on mutant and wild-type DNA templates to finally determine the recombinase polymerase amplification reaction primer pairs used for detection; Step 4 involved using the standard detection method established in step 3 to perform isothermal amplification detection of the rice aroma gene Badh2-E2.
[0008] The above-mentioned isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction, wherein in step 1.1, the selected target sequences are: the nucleotide sequence of wild-type Badh2-W as shown in SEQ ID NO.1, and the nucleotide sequence of mutant Badh2-E2 as shown in SEQ ID NO.2.
[0009] The above-mentioned isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction, wherein step 1.2 involves designing primer sets for amplification reaction based on the sequence information of the Badh2-E2 target gene and the isothermal gene design principle of recombinase polymerase amplification reaction; each primer set includes a forward primer and a reverse primer, covering the Badh2-E2 specific mutation site; and then performing preliminary screening to obtain one set of primer pairs with the best specificity and inclusiveness.
[0010] The above-described isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction, wherein step 1.2, obtaining the nucleotide sequence of the primer combination for the recombinase polymerase amplification reaction, is as follows: Forward primer Badh2-W-F1 for the wild-type Badh2-W gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; Forward primer Badh2-E-F1 for the mutant Badh2-E2 gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGT- 3'; The reverse primer Badh2-R1 for the Badh2-E2 gene, which is universal for both wild-type and mutant types: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.
[0011] The above-mentioned isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction, wherein step 2.1 involves synthesizing the sequences of the wild-type Badh2-W gene and the mutant Badh2-E2 gene, respectively, and then inserting them into plasmids to obtain recombinant plasmids pBadh2-W and pBadh2-E2.
[0012] The above-described isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction, wherein in step 2.3, the concentration of the obtained plasmid standard is determined, and the copy number per μL sample is calculated according to the following formula, based on an average relative molecular mass of 660 Daltons / bp per base: Sample copy number (copies / μL) = (6.02 × 10⁻⁶) 23 ) × plasmid concentration (ng / μL) × 10 -9 / (660×base number); the gene copy number concentration is obtained and used as a standard control and positive template for subsequent recombinase polymerase amplification reactions.
[0013] The above-mentioned isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction, wherein in step 3.1, rehydration agent, forward primer, reverse primer, DNA template, ddH2O, and magnesium acetate are added sequentially to the reaction tube, with a total volume of 50 μL, and thoroughly mixed to obtain the reaction system.
[0014] The above-mentioned isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction, wherein in step 3.2, the reaction temperature range is selected as 37-42℃ and the amplification time range is 20-30 minutes, and then optimized respectively, and finally the reaction conditions are determined to be 39℃ and 20 minutes of amplification.
[0015] The above-described isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction, wherein in step 3.3, the primer combination obtained in step 1.2 is selected to perform specific reaction tests on mutant and wild-type DNA templates, respectively, with a negative control using ddH2O as a template. The primer pair finally determined to be: the forward primer Badh2-W-F1 for the wild-type Badh2-W gene and the reverse primer Badh2-R1 for the Badh2-E2 gene.
[0016] This invention also provides a primer for isothermal amplification and detection of rice aroma genes used in the above-described method, wherein the nucleotide sequence of the primer is as follows: Upstream primer Badh2-W-F1: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; Downstream primer Badh2-R1: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.
[0017] The isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction provided by this invention has the following advantages: This invention develops an RPA primer pair targeting the rice aroma gene Badh2-E2. The developed primer pair for isothermal amplification detection of the Badh2-E2 rice aroma gene includes an upstream primer of Badh2-W-F1 and a downstream primer of Badh2-R. An RPA amplification reaction system was established, enabling amplification of the rice Badh2-E2 gene at 39℃ within 20 minutes using these primers, exhibiting high sensitivity and specificity. Furthermore, an isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification (RPA) was developed. This method requires no complex instruments, can rapidly complete amplification and detection at room temperature, and is suitable for various scenarios such as field and laboratory settings, providing efficient technical support for rice quality breeding and aroma identification. Attached Figure Description
[0018] Figure 1 This is a schematic diagram of primers used for RPA amplification of wild-type and mutant target genes.
[0019] Figure 2 This is an electrophoresis diagram of the amplification products of the RPA primer combination. Detailed Implementation
[0020] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings.
[0021] To achieve the above objectives, this invention provides a isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification (RPA). This method includes: Step 1, design primers for RPA, including: Step 1.1: Screening for molecular targets.
[0022] By comparing the Badh2-E2 gene with the wild-type sequence, the target sequences wild-type Badh2-W and mutant Badh2-E2 were screened out.
[0023] Step 1.2: Design and optimize primers.
[0024] Based on the sequence information of the Badh2-E2 target gene, primers for RPA were designed and then preliminarily screened to obtain primers for the wild-type Badh2-E2 (i.e., Badh2-W) gene and primers for the mutant Badh2-E2 gene.
[0025] Step 2, preparing plasmid standards, includes: Step 2.1, perform molecular cloning.
[0026] Using molecular cloning technology, a recombinant plasmid containing the wild-type Badh2-W gene and the mutant Badh2-E2 gene was constructed, and sequencing confirmed that the target sequence was accurate and free of mutations.
[0027] Step 2.2, transformation of recombinant plasmid.
[0028] The recombinant plasmid constructed in step 2.1 was introduced into competent cells for transformation. After proliferation in the culture medium, the plasmid was extracted to obtain plasmid standards.
[0029] Step 2.3, plasmid quantification.
[0030] The plasmid standard obtained in step 2.2 was used to determine the gene copy number concentration, which was then used as a standard control and positive template for subsequent RPA.
[0031] Step 3, establish a standard method for Badh2-E2-RPA detection, including: Step 3.1, establish the RPA system.
[0032] Step 3.2, optimize RPA conditions.
[0033] Step 3.3: Screening RPA primers.
[0034] The primer combinations obtained in step 1.2 were selected to perform specific reaction tests on mutant and wild-type DNA templates, respectively, and the RPA primer pairs used for detection were finally determined.
[0035] Step 4: Using the detection standard method established in Step 3, the rice aroma gene Badh2-E2 is amplified and detected at an isothermal temperature.
[0036] Preferably, in step 1.1, the selected target sequences are: the nucleotide sequence of wild-type Badh2-W as shown in SEQ ID NO.1, and the nucleotide sequence of mutant Badh2-E2 as shown in SEQ ID NO.2.
[0037] In step 1.2, based on the sequence information of the Badh2-E2 target gene and combined with the RPA isothermal gene design principle, primer combinations for amplification reaction are designed using professional design software. Each primer combination includes a forward primer and a reverse primer to ensure coverage of Badh2-E2 specific mutation sites. The designed primers are then preliminarily screened using Primer Blast and Geneious to obtain one set of primer pairs with the best specificity and inclusiveness.
[0038] Primer-BLAST is a primer design tool provided by NCBI (National Center for Biotechnology Information). It combines BLAST with a global alignment algorithm to ensure that primers are aligned with templates and has high sensitivity, capable of detecting target fragments that have multiple base mismatches with the primers.
[0039] Geneious Prime is a cross-platform bioinformatics software that supports multiple functions such as sequence alignment, genome assembly, clone design, and comprehensive data analysis.
[0040] More preferably, in step 1.2, the nucleotide sequence of the obtained RPA primer combination is as follows: SEQ ID NO.4, the forward primer Badh2-W-F1 for the wild-type Badh2-E2 (i.e., Badh2-W) gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; SEQ ID NO.6, forward primer Badh2-E-F1 for the mutant Badh2-E2 gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGT- 3'; SEQ ID NO.5, the reverse primer Badh2-R1 for the Badh2-E2 gene, which is universal for both wild-type and mutant types: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.
[0041] In step 2.1, the sequences of the wild-type Badh2-W gene and the mutant Badh2-E2 gene are synthesized respectively, and then inserted into plasmids respectively to obtain recombinant plasmids pBadh2-W and pBadh2-E2.
[0042] Most preferably, the plasmid used for inoculation is pUC19 plasmid, whose nucleotide sequence is shown in SEQ ID NO.3.
[0043] In step 2.2, the recombinant plasmid was introduced into Escherichia coli TOP10 competent cells and proliferated in LB medium containing ampicillin. Then, it was extracted using a plasmid mini-prep kit.
[0044] LB (Luria-Bertani) medium is a microbial culture medium with tryptone, yeast extract, sodium chloride and agar as the main components. It is commonly used for bacterial culture and molecular biology experiments.
[0045] In step 2.3, the concentrations of the two plasmid standards were determined using a nanodrop spectrophotometer, and the copy number per μL of sample was calculated according to the following formula, based on an average relative molecular mass of 660 Daltons / bp per base: Sample copy number (copies / μL) = (6.02 × 10⁻⁶) 23 ) × plasmid concentration (ng / μL) × 10 -9 / (660 × number of bases); The gene copy number concentration was calculated and used as a standard control and positive template for subsequent RPA.
[0046] In step 3.1, 29.4 μL of rehydration agent (buffer A), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2 μL of DNA template, 12.1 μL of ddH2O (double-distilled water), and 2.5 μL of magnesium acetate (buffer B) were added sequentially to a single lyophilized powder reaction tube, with a total volume of 50 μL. The mixture was thoroughly mixed to obtain the reaction system.
[0047] In step 3.2, the reaction temperature range was selected as 37-42℃ and the amplification time range as 20-30 minutes. These were then optimized, and the final reaction conditions were determined to be 39℃ and 20 minutes.
[0048] In step 3.3, the primer combination obtained in step 1.2 is selected to perform specific reaction tests on mutant and wild-type DNA templates, respectively. At the same time, a negative control with ddH2O as the template is used. Finally, the primer pair used for detection is determined to be: the forward primer Badh2-W-F1 of the wild-type Badh2-E2 (i.e., Badh2-W) gene and the reverse primer Badh2-R1 of the Badh2-E2 gene.
[0049] This invention also provides a primer pair for isothermal amplification and detection of rice aroma genes used in this method, the nucleotide sequence of which is as follows: Upstream primer Badh2-W-F1: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; Downstream primer Badh2-R1: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.
[0050] The upstream primer, also known as the forward primer, is usually aligned with the 5' end of the DNA template strand. The downstream primer, also known as the reverse primer, is usually aligned with the 3' end of the DNA template strand.
[0051] The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction provided by the present invention will be further described below with reference to the embodiments.
[0052] Example 1: RPA primer design.
[0053] (1) Screening of molecular targets.
[0054] Compared to normal non-fragrant rice, the Badh2-E2 allele mutation in fragrant rice leads to the loss of Badh2 function, and the accumulation of 2-AP makes the rice fragrant.
[0055] In this embodiment, the Badh2-E2 gene was compared with the wild-type sequence for analysis, and the target sequences wild-type Badh2-W and mutant Badh2-E2 were screened out, with the following nucleotide sequences: SEQ ID NO.1, wild-type Badh2-W sequence: MZ748940.1 (132-701, 570 bp) GTCGCGATCGGCGAGATGGCCACGGCGATCCCGCAGCGGCAGCTCTTCGTCGCCGGCGAGTGGCGCGCCCCCGCGCTCGGCCGCCGCCTCCCCGTCGTCAACCCCGCCACCGAGTCCCCCATCGGTACCCTCCTCTTCACCCTCTCCACCCTCTGCTTCTGCCTCTGATTAGCCTTTTTGTTGTTGTTGTTGTTGCTGCTGTTTTTTGCGTGTCGGTGCGCAGGCGAGATCCCGGCGGGCACGGCGGAGGACGTGGACGCGGCGGTGGCGGCGGCGCGGGAGGCGCTGAAGAGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGGGCGCCGTCCGGGCCAAGTACCTCCGCGCAATCGCGGCCAAGGTAGGGTGGTGACTACCCCCACCCCCCCCCCCCCCCCCAACGCGACCCGCGTGCGTGTGTTCCGTACAGGGGGAGGAGCTCCGCGTGGCTCTCCAGTAGGTTTTTGAGCCCCAAATCGATCGATATGCTCTAGTTTTAAGTTTGCTGCTTAAATTCCTCAAGGGTTTAGTTTGCAACCAAATCCTTATTTTAGCTTCGGTATAA SEQ ID NO.2, Mutant Badh2-E2 sequence: EU770321.1 (1080-1642, 563 bp) GTCGCGATCGGCGAGATGGCCACGGCGATCCCGCAGCGGCAGCTCTTCGTCGCCGGCGAGTGGCGCGCCCCCGCGCTCGGCCGCCGCCTCCCGTCGTCAACCCCGCCACCGAGTCCCCCATCGGTACCCTCCTCTTCAC CCTCTCCACCCTCTGCTTCTGCCTCTGATTAGCCTTTTTGTTGTTGTTGTTGTTGCTGCTGTTTTTTGCGTGTCGGTGCGCAGGCGAGATCCCGGCGGGCACGGCGGAGGACGTGGACGCGGCGGTGGCGGCGGCGCGGGA GGCGCTGAAGAGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGTCCGGGGCCAAGTACCTCCGCGCAATCGCGGCCAAGGTAGGGTGGTGACTACCCCCACCCCCCCCCCCCCCCAACGCGACCCGCGTGCGTGTGTTCC GTACAGGGGGAGGAGCTCCGCGTGGCTCTCCAGTAGGTTTTTGAGCCCCAAATCGATCGATATGCTCTAGTTTTAAGTTTGCTGCTTAAATTCCTCAAGGGTTTAGTTTGCAACCAAATCCTTATTTTAGCTTCGGTATAA (2) Primer design and optimization.
[0056] Based on the sequence information of the Badh2-E2 target gene and combined with the RPA isothermal gene design principle, RPA primers were designed using professional design software.
[0057] A schematic diagram of primers for RPA amplification of wild-type and mutant target genes (RPA detection primer design schematic diagram) is available. Figure 1 As shown.
[0058] Figure 1 In the diagram, Badh2-WF is the forward primer for the wild-type Badh2-E2 (i.e., Badh2-W) gene, Badh2-EF is the forward primer for the mutant Badh2-E2 gene, and Badh2-R1 is the reverse primer for the Badh2-E2 gene (usable for both wild-type and mutant). The orange markers represent the 7 missing bases (GGCGCCG) in the mutant gene.
[0059] Each primer set includes a forward primer and a reverse primer to ensure coverage of the Badh2-E2 specific mutation site. The designed primers were initially screened using Primer BLAST and Geneious, and one primer pair each with the best specificity and coverage was selected, as shown in Table 1 below.
[0060] Table 1. Primer combinations for RPA amplification.
[0061] Primer name Primer sequence (5'-3') Primer length / nt Serial Number Badh2-W-F1 (forward primer for wild-type Badh2-W gene) AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG 34 SEQ ID NO.4 Badh2-R1 (reverse primer for the Badh2-E2 gene) TGTACGGAACACACGCACGCGGGTCGCGTTGGG 33 SEQ ID NO.5 Badh2-E-F1 (forward primer for the mutant Badh2-E2 gene) AGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGT 34 SEQ ID NO.6 Badh2-R1 (reverse primer for the Badh2-E2 gene) TGTACGGAACACACGCACGCGGGTCGCGTTGGG 33 SEQ ID NO.5 Badh2-F1 (forward primer for the universal Badh2-E2 gene) ACCGAGTCCCCCATCGGTACCCTCCTCTTCA 31 SEQ ID NO.7 Badh2-R1 (reverse primer for the Badh2-E2 gene) TGTACGGAACACACGCACGCGGGTCGCGTTGGG 33 SEQ ID NO.5 Example 2: Preparation of plasmid standards.
[0062] (1) Molecular cloning.
[0063] Using molecular cloning technology, plasmids containing Badh2-W (wild-type) and Badh2-E2 (mutant) genes were constructed to obtain recombinant plasmid standards (pBadh2-W, pBadh2-E2), and the target sequences were confirmed to be accurate (without mutations) by sequencing.
[0064] The preparation process of plasmid standards (pBadh2-W, pBadh2-E2) is as follows: two sequences of Badh2-W (wild type) gene and Badh2-E2 (mutant type) gene are synthesized by Sangon Biotech (Sangon, China) and inserted into pUC19 plasmid.
[0065] The plasmid nucleotide sequence used is as follows: SEQ ID NO.3, pUC19 plasmid sequence (2) Transformation of recombinant plasmids.
[0066] The obtained recombinant plasmid was introduced into Escherichia coli TOP10 competent cells (Tiangen, China) and proliferated in LB medium containing ampicillin (concentration of 50 μg / mL). Then, it was extracted using a plasmid mini-extraction kit (Tiangen, China) to obtain two plasmid standards.
[0067] (3) Plasmid quantification.
[0068] The concentrations of the two plasmid standards were determined using a nanodrop spectrophotometer. The copy number per μL of sample was calculated using the following formula, based on an average relative molecular mass of 660 Daltons / bp per base: Sample copy number (copies / μL) = (6.02 × 10⁻⁶) / μL. 23 ) × plasmid concentration (ng / μL) × 10 -9 / (660 × base number) is converted into gene copy number concentration and used as a standard control and positive template for subsequent RPA reactions.
[0069] Example 3. Establishment of the Badh2-E2-RPA standard method.
[0070] (1) Establish the RPA reaction system.
[0071] Add 29.4 μL of rehydration agent (buffer A), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2 μL of DNA template, 12.1 μL of ddH2O, and 2.5 μL of magnesium acetate (buffer B) sequentially to a single lyophilized powder reaction tube, for a total volume of 50 μL, and mix thoroughly. See Table 2 below.
[0072] Table 2. Composition of the RPA reaction system (total volume 50 μL).
[0073] Composition volume Rehydrating agent (A buffer) 29.4μL Forward primer (10 μM) 2μL Reverse primer (10 μM) 2μL DNA template 2μL <![CDATA[ddH2O (double distilled water)]]> 12.1μL Magnesium acetate (B buffer) 2.5μL (2) Optimization of RPA reaction conditions.
[0074] The reaction temperature (range 37-42℃) and amplification time (range 20-30 minutes) were optimized, and the most efficient and stable RPA reaction was finally determined to be amplified at 39℃ for 20 minutes.
[0075] (3) Screening of RPA primers.
[0076] The RPA primer combinations in Table 1 were selected to perform specific reaction tests on mutant and wild-type DNA templates, respectively, with a negative control using ddH2O as the template.
[0077] The results showed that the wild-type system could specifically amplify wild-type DNA, and no bands appeared at either the wild-type DNA or the blank control, indicating sufficient specificity. The mutant system, however, could specifically amplify mutant DNA, but a weak band appeared at the wild-type DNA site, suggesting potentially insufficient specificity and requiring primer pair optimization. See also Figure 2 (The electrophoresis diagram of the amplification products of the first set of RPA primers is shown.)
[0078] Figure 2 DNA template: E represents mutant plasmid, W represents wild-type plasmid, N represents blank control; reaction system: mutant system (Badh2-E-F1 and Badh2-R1 primers), wild-type system (Badh2-W-F1 and Badh2-R1 primers), universal system (Badh2-F1 and Badh2-R1 primers).
[0079] Through the above embodiments, an RPA primer pair targeting the rice aroma gene Badh2-E2 was obtained. This primer pair is a primer developed using a rice aroma gene Badh2-E2 isothermal amplification detection marker, including the upstream primer 5'-AGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGG-3' of the sequence shown in Badh2-W-F1 (SEQ ID NO.4) in Table 1, and the downstream primer 5'-TGTACGGAACACACGCACGCGGTCGCGTTGGG-3' of the sequence shown in Badh2-R1 (SEQ ID NO.5).
[0080] Through the above embodiments, an RPA amplification reaction system was also established, which can amplify the rice Badh2-E2 gene using the primers at 39℃ for 20 minutes with high sensitivity and strong specificity.
[0081] This invention provides a thermostatic detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction (RPA). Developed specifically for the isothermal amplification detection marker of the rice aroma gene Badh2-E2, it establishes a highly efficient, specific, and sensitive RPA detection system for rapid identification of rice varieties with aroma characteristics, serving fields such as agricultural breeding, quality monitoring, and market identification. This method requires no complex instruments, can rapidly complete amplification and detection at room temperature, and is suitable for various scenarios including field and laboratory settings, providing efficient technical support for rice quality breeding and aroma identification.
[0082] The recombinase polymerase amplification (RPA) technique used in this invention is an isothermal amplification technology that has been developed in recent years. It has the advantages of high reaction sensitivity, strong specificity, low dependence on instruments and short detection time, and is particularly suitable for grassroots and on-site real-time detection.
[0083] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A isothermal detection method for rice aroma gene mutations based on recombinase polymerase amplification reaction, characterized in that, The method includes: Step 1, primer design for recombinase polymerase amplification reaction, including: Step 1.1: Screening of molecular targets. By comparing the Badh2-E2 gene with the wild-type sequence, target sequences wild-type Badh2-W and mutant Badh2-E2 were screened out respectively. Step 1.2: Design and optimize primers. Based on the sequence information of the Badh2-E2 target gene, design primers for recombinase polymerase amplification reaction, and then perform preliminary screening to obtain primers for wild-type Badh2-W gene and primers for mutant Badh2-E2 gene. Step 2, preparing plasmid standards, includes: Step 2.1: Molecular cloning was performed. A recombinant plasmid containing the wild-type Badh2-W gene and the mutant Badh2-E2 gene was constructed by molecular cloning, and the target sequence was confirmed to be accurate and without mutation by sequencing. Step 2.2: The recombinant plasmid constructed in step 2.1 is introduced into competent cells for transformation. After proliferation in the culture medium, the plasmid is extracted to obtain plasmid standard. Step 2.3: The plasmid standard obtained in Step 2.2 is subjected to concentration determination to obtain gene copy number concentration, which serves as the standard control and positive template for subsequent recombinase polymerase amplification reaction; Step 3, establish standard testing methods, including: Step 3.1: Establish the recombinase polymerase amplification reaction system; Step 3.2: Optimize the recombinase polymerase amplification reaction conditions; Step 3.3: Screen the primers and select the primer combinations obtained in Step 1.2 to perform specific reaction tests on mutant and wild-type DNA templates respectively, and finally determine the recombinase polymerase amplification reaction primer pairs to be used for detection. Step 4: Using the detection standard method established in Step 3, the rice aroma gene Badh2-E2 is amplified and detected at an isothermal temperature.
2. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 1.1, the target sequences screened are as follows: the nucleotide sequence of wild-type Badh2-W is shown in SEQ ID NO.1, and the nucleotide sequence of mutant Badh2-E2 is shown in SEQ ID NO.
2.
3. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, Step 1.2 involves designing primer sets for amplification reactions based on the sequence information of the Badh2-E2 target gene and the isothermal gene design principle of recombinase polymerase amplification reaction. Each primer set includes a forward primer and a reverse primer, covering Badh2-E2 specific mutation sites. Further preliminary screening was conducted to obtain one set of primer pairs with the best specificity and inclusiveness.
4. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 3, characterized in that, Step 1.2 yields the following nucleotide sequence for the primer combination used in the recombinase polymerase amplification reaction: Forward primer Badh2-W-F1 for the wild-type Badh2-W gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; Forward primer Badh2-E-F1 for the mutant Badh2-E2 gene: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCGCGCCGT- 3'; The reverse primer Badh2-R1 for the Badh2-E2 gene, which is universal for both wild-type and mutant types: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.
5. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 2.1, the sequences of the wild-type Badh2-W gene and the mutant Badh2-E2 gene are synthesized respectively, and then inserted into plasmids respectively to obtain recombinant plasmids pBadh2-W and pBadh2-E2.
6. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 2.3, the concentration of the obtained plasmid standard is determined, and the copy number per μL of sample is calculated according to the following formula, based on an average relative molecular mass of 660 Daltons / bp per base: Sample copy number (copies / μL) = (6.02 × 10⁻⁶) 23 ) × plasmid concentration (ng / μL) × 10 -9 / (660 × number of bases); The gene copy number concentration was obtained and used as a standard control and positive template for subsequent recombinase polymerase amplification reactions.
7. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 3.1, the rehydration agent, forward primer, reverse primer, DNA template, ddH2O, and magnesium acetate are added sequentially to the reaction tube, with a total volume of 50 μL. The mixture is thoroughly mixed to obtain the reaction system.
8. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 3.2, the reaction temperature range was selected as 37-42℃ and the amplification time range as 20-30 minutes. These were then optimized, and the final reaction conditions were determined to be 39℃ and 20 minutes.
9. The isothermal detection method for rice aroma gene mutation based on recombinase polymerase amplification reaction as described in claim 1, characterized in that, In step 3.3, the primer combination obtained in step 1.2 is selected to perform specific reaction tests on mutant and wild-type DNA templates, respectively, with a negative control using ddH2O as the template. The primer pair used for detection is finally determined to be: the forward primer Badh2-W-F1 for the wild-type Badh2-W gene and the reverse primer Badh2-R1 for the Badh2-E2 gene.
10. A rice aroma gene isothermal amplification detection marker primer used in the method according to any one of claims 1 to 9, characterized in that, The nucleotide sequence of the primer is as follows: Upstream primer Badh2-W-F1: 5'-AGGAACCGGGGCCGCGACTGGGCGCGCCGCCGG-3'; Downstream primer Badh2-R1: 5'-TGTACGGAACACACGCACGCGGGTCGCGTTGGG- 3'.