Functional molecular marker of wheat powdery mildew resistance related gene pm61 and application thereof
By developing InDel molecular markers and designing specific primer pairs for PCR amplification of wheat genomic DNA, the problem of time-consuming and labor-intensive Pm61 genotype identification in existing technologies has been solved, enabling rapid and accurate identification of powdery mildew resistance and improving breeding efficiency.
Patent Information
- Application Number
- CN202511508049.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-22
- Publication Date
- 2025-12-26
- Estimated Expiration
- 2045-10-22
AI Technical Summary
The existing molecular markers are genetically distant from the wheat powdery mildew resistance gene Pm61, making molecular marker-assisted selection breeding time-consuming, labor-intensive, and inefficient, which is difficult to meet the needs of breeding practice for precision and high-throughput operations.
We developed InDel molecular markers and designed specific primer pairs to amplify wheat genomic DNA by PCR. We then used the presence or absence of PCR products to identify the Pm61 genotype and distinguish between disease-resistant and disease-susceptible wheat varieties.
It enables rapid and accurate identification of wheat powdery mildew resistance, improves breeding efficiency, reduces gene marker amplification costs, and meets the high-throughput operation requirements in breeding practice.
Smart Images

Figure CN120967059B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid detection and assay, specifically involving the functional molecular marker of wheat powdery mildew-related gene Pm61 and its application. Background Technology
[0002] wheat( Triticum aestivum Powdery mildew is one of the world's three major staple foods, providing basic nutrition for more than 35% of the population. Powdery mildew is caused by the specialized fungal pathogen *Erysiphe flavescens* (a member of the Poaceae family). Blumeria graminis f. sp. tritici abbreviation Bgt Powdery mildew is one of the major diseases threatening global wheat production. It causes significant yield losses by inhibiting the photosynthetic efficiency of the host wheat, reducing tillering and ear formation rates, and decreasing thousand-grain weight. Current strategies for controlling powdery mildew rely heavily on chemical agents, but these pose risks of environmental pollution and pathogen resistance. Therefore, developing wheat varieties with durable, broad-spectrum resistance has become a core solution that combines economic viability with ecological sustainability.
[0003] Through thousands of years of domestication and natural selection, my country's local wheat varieties have accumulated rich genetic diversity, serving as an important resource for the discovery of disease-resistant genes. Of the wheat resources currently existing in the National Crop Germplasm Bank, one-third (13,000 accessions) are local varieties. Historically, local wheat varieties have played a significant role in both production and breeding. Local wheat varieties contain abundant powdery mildew resistance genes; currently identified powdery mildew resistance genes include... Pm2c , Pm3b , Pm5d , Pm5e , Pm24a , Pm24b , Pm45 , Pm47 , Pm59 , Pm61 and Pm63 Furthermore, local varieties have high hybridization compatibility with conventional wheat varieties, outstanding resistance to adverse conditions (such as drought and salt tolerance), and great potential for improving agronomic traits, making them strategic genetic resources for disease-resistant breeding.
[0004] Pm61 Derived from the local wheat variety Xuxu Sanyuehuang, it exhibits stable and high resistance to powdery mildew in both the seedling and mature stages. Sun et al. (2018) used SSR (EST-SSR) marker technology to... Pm61 Located on the long arm of chromosome 4A (4AL) Xicsx79 and Xgwm1600.46 cM genetic interval between markers. Hu et al. (2019) further mapped it into the 31 Mb physical interval at the end of 4AL by BSR-Seq combined with SNP / KASP markers, and developed Xicsk8 Xicsx497 0.71 cM high-density markers between Xicsk13 Xicsx538 However, the genetic distance between the existing molecular markers and the Pm61 gene is still large, resulting in time-consuming and labor-intensive molecular marker-assisted selection breeding (MAS), low efficiency, high cost of gene marker amplification, and difficulty in meeting the needs of precision and high-throughput operation in breeding practice. Therefore, the development of co-dominant molecular markers based on Pm61 functional sites has become a key technical bottleneck to improve disease resistance breeding efficiency. SUMMARY
[0005] The problem to be solved by the present application is how to identify or assist in identifying wheat powdery mildew resistance.
[0006] To solve the above technical problems, the present application provides the application of an InDel molecular marker or a substance for detecting the InDel molecular marker, and the practicability of the marker is verified, providing a reliable molecular marker for identifying or assisting in breeding wheat varieties.
[0007] The present application first provides the application of an InDel molecular marker or a substance for detecting the InDel molecular marker, wherein the InDel molecular marker is a double-stranded DNA molecule with a nucleotide sequence of SEQ ID No: 1 at 19-123 of one strand; and the application is any one of the following:
[0008] 1) application in identifying or assisting in identifying wheat powdery mildew resistance;
[0009] 2) application in wheat breeding.
[0010] The nucleotide sequence of the other strand of the InDel molecular marker is the reverse complement of SEQ ID No: 1 at 19-123.
[0011] The above SEQ ID No: 1 consists of 1210 nucleotides.
[0012] In the above application, the substance for detecting the InDel molecular marker can contain PCR primers for amplifying a wheat genomic DNA fragment containing the wheat InDel molecular marker.
[0013] In the above application, the PCR primer is a primer pair, the primer pair consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the wheat genomic DNA.
[0014] Further, the sequence of the forward primer is shown in SEQ ID No: 2, and the sequence of the reverse primer is shown in SEQ ID No: 3.
[0015] Herein, the wheat is a wheat inbred line or a wheat variety (line).
[0016] The present application also provides a method for identifying or assisting in identifying the resistance of wheat powdery mildew, comprising the following steps: detecting whether the genomic DNA of the wheat to be identified contains the InDel molecular marker described above, and the resistance of the wheat to be identified containing the InDel molecular marker in the genomic DNA is greater than or candidate greater than the wheat to be identified not containing the InDel molecular marker in the genomic DNA.
[0017] The method for identifying or assisting in identifying the resistance of wheat powdery mildew can specifically comprise the following steps:
[0018] (1) Using the genomic DNA of the wheat material to be identified as a template, PCR amplification is performed using the primer pair to obtain a PCR product;
[0019] (2) Identifying the resistance of wheat powdery mildew according to whether the PCR product contains the InDel molecular marker.
[0020] The resistance of the wheat to be identified containing the InDel molecular marker in the PCR product described above is greater than or candidate greater than the wheat to be identified not containing the InDel molecular marker in the PCR product.
[0021] If the size of the DNA fragment of about 1000 bp in the PCR product in the wheat material to be identified is 1210 bp, the nucleotide sequence of the DNA fragment is SEQ ID No: 5 in the sequence listing, and the nucleotide sequence is the 19-123th DNA fragment of SEQ ID No: 1 in the sequence listing; the genotype of the wheat variety (line) containing the nucleotide sequence of the 19-123th DNA fragment of SEQ ID No: 1 in the sequence listing in the PCR product is defined as the insertion type (abbreviation for allelic variation Pm61DM -AA genotype or AA genotype).
[0022] If no PCR amplification product or no band of about 1200 bp is identified in the wheat material, the DNA fragment of SEQ ID No: 1 at 19-123 is not contained in the strain, and the genotype of the wheat variety (strain) whose PCR product does not contain the DNA fragment of SEQ ID No: 1 at 19-123 in the nucleotide sequence in the sequence listing is defined as a deletion type (referred to as allelic variation Pm61DM -BB genotype or BB genotype).
[0023] Further, the PCR system is: genomic DNA (25 ng / μL) of the wheat leaf to be tested 2 μL, 2× PCR Mix 5 μL, water solution of primer F (concentration of 10 μmol / L) 1 μL, water solution of primer R (concentration of 10 μmol / L) 1 μL and ddH2O 1 μL.
[0024] PCR amplification procedure: 94℃ 5 min; 94℃ 30 s, 57℃ 30 s, 72℃ 30 s, 35 cycles; 72℃ 7 min.
[0025] The InDel molecular marker described in the foregoing also belongs to the protection scope of the present application.
[0026] The InDel molecular marker is a double-stranded DNA molecule with the nucleotide sequence of SEQ ID No: 1 at 19-123.
[0027] The InDel molecular marker is named Pm61DM .
[0028] The present application also provides a method for wheat breeding.
[0029] The method for wheat breeding provided by the present application comprises selecting a wheat containing the InDel molecular marker described in the foregoing as a parent for breeding.
[0030] The InDel molecular marker is a double-stranded DNA molecule with the nucleotide sequence of SEQ ID No: 1 at 19-123.
[0031] In the present application, the breeding purpose includes cultivating a wheat variety with wheat powdery mildew resistance. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 Different RIL families are resistant to powdery mildew E09.
[0033] Figure 2 Molecular marker Pm61DM Polymorphism detection in RIL population.
[0034] Figure 3 Sequence comparison of the Pm61 gene among four varieties (A) and molecular markers Pm61DM Detection diagram of known 10+ genome wheat (B).
[0035] Figure 4 molecular markers Pm61DM Partial test results of 262 Chinese micro-core wheat germplasm samples. Detailed Implementation
[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0038] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0039] The method for identifying wheat seedling powdery mildew resistance in the following examples is specifically referenced in the following literature: Liu ZY, Sun QX, Ni ZF, Yang TM. Development of SCAR markers linked to the Pm21 Geneconferring resistance to powdery mildew in common wheat. Plant Breeding, 1999, 118: 215-219. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0040] The materials Jagger, CDC Stanley, CDC Landmark, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robius, and Weebill_1 in the following examples are described in: Walkowiak, S., Gao, L., Monat, C. et al. Multiple wheat genomes reveal global variation in modern breeding. Nature 588, 2020, 277–283; Jimai 22 is described in: Jiao C, Xie X, Hao C, et al. Pan-genomebridges wheat structural variations with habitat and breeding[J]. Nature, 2025, 637(8045): 384-393; 262 hexaploid Chinese wheat microcore germplasm accessions were provided by Researcher Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and are described in: Dong YC, Cao YS, Zhang XY, Liu SC, Wang LF, You GX, Pang BS, Li LH, Jia JZ. Establishment of candidate core collections in Chinese common wheat germplasm. Journal of Plant Genetic Resources, 2003, 4(1):1-8. and Li Hongjie, Wang Xiaoming, Song Fengjing, Wu Cuiping, Wu Xiaofei, Zhang Ning, Zhou Yang, Zhang Xueyong. Resistance response of Chinese wheat varieties to powdery mildew and detection of resistance genes. Acta Agronomica Sinica, 2011, 37(6):943-954. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and may not be used for any other purpose.
[0041] The specific steps for identifying the phenotypic characteristics of wheat powdery mildew are as follows:
[0042] Wheat seeds were sown in 5×5 cm seedling trays, with 10-15 seeds per tray, and cultured in an artificial climate chamber under 20ºC light for 16 hours and 18ºC darkness for 8 hours, with relative humidity controlled at 60%-80%. When the seedlings grew to one leaf and one bud, they were inoculated with powdery mildew using the sweeping method.
[0043] The wheat powdery mildew disease grading standards are as follows:
[0044] 0 level: immunity, no disease spot on the whole plant, no mycelium attachment.
[0045] 0 level: necrotic reaction, leaf with necrotic spot.
[0046] 1 level: high resistance, small disease spot, thin mycelium layer, green leaf surface, occasional large disease spot but still green, and very few spores produced.
[0047] 2 level: medium resistance, small leaf spot, thick mycelium layer but weak three-dimensionality, not green, and can produce a certain amount of spores.
[0048] 3 level: medium susceptible, many leaf spots, thick mycelium layer, strong three-dimensionality, leaf discoloration, and large amount of spores produced, but the disease spots are not connected.
[0049] 4 level: high susceptible, many leaf spots, thick mycelium layer, and many spores produced, and the disease spots are connected.
[0050] Disease levels 0-2 are resistant, and levels 3-4 are susceptible.
[0051] The resistant parent Xuxusanyuehuang and the susceptible parent Zhongzu 9504 and the powdery mildew physiological race E09 in the following examples have been described in Sun HG, et al. Pm61 : a recessive gene for resistance to powdery mildew in wheat landrace Xuxusanyuehuang identified by comparative genomics analysis. Theoretical and Applied Genetics, 2018, 131: 2085-2097. The biological material is available from the applicant for the purpose of repeating the experiments of the present application only, and cannot be used for other purposes.
[0052] Example 1, wheat Pm61 Development of genetic molecular markers and polymorphism detection
[0053] I. Pm61 Genes and Pm61CS Nucleotide sequence alignment of genes
[0054] Amplified from wheat Xuxusanyuehuang Pm61 Gene, Pm61CS gene (nucleotide sequence is Genbank: 123088537, updated date 2025-7-2) amplified from wheat Zhonghuang. Pm61 Gene and Pm61CSThe genes are aligned to find, Pm61 The genes are aligned to find, Pm61CS There is a 105 bp base difference in the coding region of the gene, and the difference sequence is as follows: 5'-GGTTACTTGATGGTTCATATTTTGAGAATTTGGGATCTTTAAGCTTTAATAATTGCAGCGCATTACAAAGCCTACCGTCCAATAGTAAGCTATTTGAGAATTGCT- 3' (SEQ ID No: 4), which is the 19-123th nucleotide sequence of SEQ ID No: 1. Among them, the genome of Xuxusanyue (a wheat variety resistant to powdery mildew) contains the sequence of 19-123th of SEQ ID No: 1 (referred to as InDel insertion type), and the 744,383,058-744,383,059th of the 4A chromosome genome of Zhongchun (a wheat variety susceptible to powdery mildew) does not contain the sequence of 19-123th of SEQ ID No: 1 (referred to as InDel deletion type). This InDel molecular marker is named Pm61DM .
[0055] II. Development of specific identification primers for molecular marker Pm61DM
[0056] According to the upstream and downstream sequences of InDel molecular marker Pm61DM (referred to as molecular marker Pm61DM ), a specific primer set is designed, and the primer set information is as follows:
[0057] Pm61DM-F: 5'-AGCTATTTGAGAATTGCTGGTT-3' (SEQ ID No: 2);
[0058] Pm61DM-R: 5'-CTGCCTTCAAGAGTCAAAGATT-3' (SEQ ID No: 3).
[0059] III. Polymorphism detection
[0060] Wheat to be tested: Xuxusanyue, Zhongzu 9504, and a recombinant inbred line (RIL) population formed by crossing the two.
[0061] Construction of hybrid population: the powdery mildew susceptible variety Zhongzu 9504 was used as the male parent and the local variety Xuxusanyue was used as the female parent to form a hybrid F1 generation. The hybrid F1 generation seeds were sown in the field, and through 6 generations of selfing, 352 F6 recombinant inbred lines (RILs) were obtained. The RIL population was planted, and the resistance of the population to powdery mildew was detected.
[0062] The specific steps of polymorphism detection are as follows:
[0063] 1. Using the plant DNA rapid extraction kit to extract the genomic DNA of the wheat leaves to be tested.
[0064] 2. Using the genomic DNA of the wheat leaves as the template, and using the primer pair composed of the primer F and the primer R in step two to perform PCR amplification, so as to obtain the PCR amplification product. Pm61DM
[0065] The PCR reaction system (10 μL) is composed of the genomic DNA (25 ng / μL) of the wheat leaves to be tested 2 μL, 2× PCR Mix (Nanjing Novi Biological Technology Co., Ltd.) 5 μL, the water solution of the primer F (the concentration is 10 μmol / L) 1 μL, the water solution of the primer R (the concentration is 10 μmol / L) 1 μL and ddH2O 1 μL.
[0066] The PCR reaction conditions are as follows: 94℃ 5 min; 94℃ 30 s, 58℃ 15 s, 72℃ 45 s, 35 cycles; and 72℃ 7 min.
[0067] 3. Taking the PCR amplification product obtained in step two to perform 1.0% agarose gel electrophoresis, and sequencing the PCR amplification product.
[0068] According to the PCR product results, the following judgments are made:
[0069] 1) If the sizes of the amplification products at about 1200 bp DNA fragments are all 1210 bp, the nucleotide sequence of the DNA fragment is SEQ ID No: 1 in the sequence listing; the genotype of the wheat variety (line) containing the DNA fragment with the nucleotide sequence of 19-123 of SEQ ID No: 1 in the PCR product is defined as the disease-resistant type AA (abbreviated as the allelic variation Pm61DM -AA genotype or AA genotype, which is the same as the amplification result of the disease-resistant parent Xuxusanyuehuang).
[0070] 2) If the amplification products do not show bands or other size bands, that is, the PCR product does not contain the DNA fragment with the nucleotide sequence of 19-123 of SEQ ID No: 1 in the sequence listing, then the genotype of the wheat to be tested is defined as the disease-susceptible type BB (abbreviated as the allelic variation Pm61DM -BB genotype or BB genotype, which is the same as the amplification result of the disease-susceptible parent Zhongzuo 9504).
[0071] Some experimental results are shown in Table 1 and Figure 1 , Figure 2 The Pm61DM Genotype of Xuxusanyue is AA, and genotype of Zhongzu 9504 is BB. There are two genotypes in RIL population, one is genotype AA (same as Xuxusanyue in genotype and resistance to powdery mildew, i.e. Figure 1 resistant single plants in Zhong and Figure 2 striped family); and the other is genotype BB (same as Zhongzu 9504 in genotype and resistance to powdery mildew, i.e. Figure 1 susceptible single plants in Zhong and Figure 2 non-stripped family).
[0072] Table 1, disease resistance phenotype and Pm61DM genotype detection results of Xuxusanyue, Zhongzu 9504 and partial recombinant inbred lines thereof
[0073]
[0074]
[0075] Note: In Table 1, disease severity classification refers to Shaanxi Provincial Standard DB61 / T 1014-2016 "Technical Specification for Wheat Variety Resistance to Powdery Mildew", wherein 1+0; belongs to high resistance reaction type, i.e. when recording the disease severity level of the leaf inoculated with powdery mildew, the leaf belongs to 1-level reaction type with partial hypersensitive necrosis reaction.
[0076] Table 2, Pm61DM genotype of and resistance to powdery mildew
[0077]
[0078] The above results show that the specific primers of the molecular marker Pm61DM developed in the present research can identify the genotype of wheat. The molecular marker Pm61DM can effectively distinguish the resistance to powdery mildew of wheat (Table 2).
[0079] Example 2, application of molecular marker Pm61DM
[0080] 1. Using the published wheat genome material to detect Pm61 gene, only Chinese Spring, Jagger, CDCStanley, CDC Landmark materials contain Pm61CS haplotype (see Figure 3 A in Table 1), and the rest of the wheat varieties Fielder, Jimai 22, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robigus, Weebill_1 do not contain Pm61 gene and Pm61CS gene.
[0081] Pm61DM detection results as gel Figure 3 B, RP is Xuxu March yellow, SP is medium 9504, 1-19 is the order of Chinese spring, Jagger, CDC Stanley, CDC Landmark, Fielder, Jimai 22, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robigus, Weebill_1, blank control. This marker indicates Pm61DM Pm61, Pm61CS and other haplotypes can be efficiently identified.
[0082] 2, using functional markers Pm61DM 262 Chinese wheat micro core germplasm were detected.
[0083] According to the detection method in example 1, 262 hexaploid Chinese wheat micro core germplasm were genotyped. The experimental results are shown in Figure 4 and the second and fifth columns in table 2.
[0084] The 262 wheat powdery mildew resistance data come from Qiu Y C, Li J J, Rong Z X, et al. Identification and analysis of Chinese wheat micro core germplasm resistance to rust and powdery mildew [J]. Chinese Journal of Wheat and Maize, 2015, 35(02): 268-273. Among the 262, 15 were resistant at seedling stage, and the remaining 147 were fully susceptible.
[0085] Table 2 shows that the genotypes of 262 hexaploid Chinese wheat micro core germplasm are Pm61DM-BB. Pm61 resistance gene type has not been detected in Chinese micro core germplasm, and it is speculated that the powdery mildew resistance gene Pm61 is a rare disease type. Figure 4 Pm61DM detection of the first 46 materials in table 2 is shown in the gel map.
[0086] Table 3, Pm61DM gene type detection of 262 Chinese wheat micro core germplasm
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093] The application has been described in detail. Those skilled in the art can implement the application in a wide range of equivalent parameters, concentrations and conditions without departing from the spirit and scope of the application, and without unnecessary experiments. Although the application gives a specific example, it should be understood that further improvements can be made to the application. In general, according to the principle of the application, this application intends to include any changes, uses or improvements of the application, including changes made outside the scope disclosed in this application, using conventional techniques known in the art.
Claims
1. Use of a Pm61 gene InDel molecular marker or a substance for detecting the molecular marker, characterized in that, The InDel molecular marker is located at 19-123 of SEQ ID No:1; the nucleotide sequence is SEQ ID No:4, and the application is any one of the following: 1) application in identifying or assisting in identifying wheat powdery mildew resistance; 2) application in wheat breeding; The breeding purpose includes breeding wheat varieties with wheat powdery mildew resistance. The wheat to be identified containing the InDel molecular marker in the genomic DNA has greater or candidate greater powdery mildew resistance than the wheat to be identified not containing the InDel molecular marker in the genomic DNA.
2. Use according to claim 1, characterized in that, The substance contains PCR primers for amplifying the wheat genomic DNA fragment containing the InDel molecular marker.
3. Use according to claim 2, characterized in that, The PCR primers are a primer pair, which consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA specifically binding to the upstream of the InDel molecular marker in the wheat genomic DNA, and the reverse primer is a single-stranded DNA specifically binding to the downstream of the InDel molecular marker in the wheat genomic DNA.
4. Use according to claim 3, characterized in that, The sequence of the forward primer is shown in SEQ ID No:2, and the sequence of the reverse primer is shown in SEQ ID No:
3.
5. A method of identifying or assisting in the identification of resistance to powdery mildew in wheat, characterised in that, The method comprises the following steps: Detecting whether the InDel molecular marker in claim 1 is contained in the genomic DNA of the wheat to be identified, and the wheat to be identified containing the InDel molecular marker in the genomic DNA has greater or candidate greater powdery mildew resistance than the wheat to be identified not containing the InDel molecular marker in the genomic DNA.
6. A method for wheat breeding, which comprises selecting wheat containing the InDel molecular marker in claim 1 in the genomic DNA as a parent for breeding; and the breeding purpose includes breeding wheat varieties with wheat powdery mildew resistance.
Citation Information
Patent Citations
Functional molecular marker of triticum aestivum L. anti-blumeria graminis relevant gene Pm41, and application of functional molecular marker
CN112176083A
Wheat broad-spectrum powdery-mildew-resistant gene WTK7-tm cloning, functional marker, and use thereof
WO2024174954A1