Genome insertion in cells

Abstract

The present disclosure provides compositions and methods for inserting a heterologous payload sequence into a target site in the genome of a host cell. The compositions and methods use a non-LTR reverse transcriptase reverse transcriptase protein that binds to a template RNA comprising a payload sequence that encodes the protein or regulates the RNA. The template RNA may comprise a modified uridine that cannot be cleaved by a ribozyme. The incorporation of the modified uridine increases the integration and expression efficiency of the payload sequence and reduces cytotoxicity.

Description

[0001] Cross Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 390,863, filed July 20, 2022, which is incorporated by reference herein in its entirety for all purposes. BACKGROUND

[0003] The insertion of DNA transgenes into the genomic DNA of an organism is associated with a variety of undesirable side effects. For example, the introduction of DNA into the cytoplasm of a cell can trigger an immune response that is harmful to the cell or organism. Furthermore, current methods of integrating DNA into a target site in the host cell genome via homologous recombination require the introduction of a potentially mutagenic double-strand break in the genomic DNA. Moreover, because homologous recombination occurs more efficiently in dividing cells, DNA integration in post-mitotic cells, such as neurons, can occur at non-specific locations.

[0004] The present disclosure provides compositions and methods that improve gene editing at a target site in a host cell genome. The methods can be used for gene therapy applications and provide advantages over current DNA-based and viral vector-based gene therapy methods. SUMMARY

[0005] The present disclosure provides compositions and methods that improve gene therapy technologies for introducing a heterologous polynucleotide into a target cell.

[0006] In one aspect, the present disclosure provides a method of inserting a heterologous polynucleotide at a target site in a eukaryotic genome, the method comprising transfecting a eukaryotic cell with: (a) an RNA encoding a non-LTR retrotransposon reverse transcriptase protein (nrRT) comprising a reverse transcriptase domain and an endonuclease domain; and (b) a template RNA. In some embodiments, the template RNA comprises a promoter, a payload sequence, a polyA sequence, and a nrRT binding sequence. In some embodiments, the template RNA comprises one or more modified uridine (U) nucleosides selected from the group consisting of N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the template RNA comprises a mixture comprising unmodified uridine and one or more modified uridines selected from the group consisting of N1mΨU, ΨU, 5meU, and 5moU. In some embodiments, the template RNA comprising modified uridines is not cleavable by a ribozyme.

[0007] In some embodiments, the nrRT is expressed in the cell and catalyzes the insertion of a double-stranded heterologous polynucleotide comprising a payload sequence into a target site in a eukaryotic genome.

[0008] In some implementations, template RNA containing modified U increases the insertion efficiency of the payload sequence into the eukaryotic genome compared to template RNA containing unmodified U.

[0009] In some embodiments, the template RNA further comprises a 5' ribozyme sequence selected from active ribozymes, partially active ribozymes, ribozymes with reduced catalytic activity, or ribozymes without catalytic activity. In some embodiments, the 5' ribozyme is selected from HDV ribozymes, TriCasA ribozymes, or their native homologs, semi-homologs, or variants. In some embodiments, the 5' ribozyme sequence comprises a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence), or a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with any one of SEQ ID NO:3 or 13-22 (without pp7 binding sequence).

[0010] In some implementations, the template RNA does not contain a functional 5' ribozyme sequence or does not contain a 5' ribozyme sequence.

[0011] In some implementations, cytotoxicity is reduced when the template RNA contains modified U.

[0012] In some implementations, the template RNA further includes a 5' sequence that protects the 5' end from degradation.

[0013] In some implementations, the template RNA further includes a 5' sequence that facilitates the specific insertion of heteropolynucleotides into target sites in the eukaryotic genome.

[0014] In some embodiments, the nrRT binding sequence comprises a 3' UTR sequence. In some embodiments, the 3' UTR sequence is isolated from organisms selected from: *Gastropoda aculeatus*, *Drosophila melanogaster*, *L. polyphemus*, *P. pungitis*, *N. vitripennis*, *Gastropoda fortis*, *O. latipes*, *Z. albicollis*, *T. guttata*, *T. castaneum*, and *T. gracilis*. (T. guttatus), Drosophila simulans, B. mori, and A. vaga. In some embodiments, the 3'UTR contains a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with any sequence selected from SEQ ID NO:26-39.

[0015] In some implementations, the template RNA further includes a 3' sequence that promotes site-specific insertion of heteropolynucleotides into the eukaryotic genome and / or enhances the efficiency and fidelity of target-induced reverse transcription.

[0016] In some embodiments, the template RNA further comprises one or more of the following: i) an RNA polymerase terminator, ii) a sequence that can be used for purification, iii) a sequence encoding a protein that can be used for enrichment, iv) a Kozak sequence at the 5' of the payload sequence, and / or v) a polyA sequence located at the 3' of the nrRT binding sequence.

[0017] In some embodiments, the template RNA further comprises (a) a 5' sequence homologous to a DNA sequence at the target insertion site 5' in a eukaryotic genome; (b) a 3' sequence homologous to a DNA sequence at the target insertion site 3' in a eukaryotic genome; or both (a) and (b).

[0018] In some implementations, the template RNA lacks 5' phosphate.

[0019] In some embodiments, the payload sequence encodes a therapeutic protein that replaces or supplements a defective gene or protein. In some embodiments, the therapeutic protein is selected from factor VIII, factor IX, and phenylalanine hydroxylase (PAH).

[0020] In some implementations, the payload sequence encodes an inhibitor of another protein. In some implementations, the inhibitor is a single-chain antibody.

[0021] In some implementations, the payload sequence encodes regulatory RNA.

[0022] In some implementations, the payload sequence encodes a protein selected from the genes in Table 7.

[0023] In some implementations, adjusting i) the molar ratio of nrRT mRNA to template RNA and / or ii) the amount of total RNA delivered to the target cell increases insertion efficiency.

[0024] In some embodiments, the RNA encoding nrRT comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the RNA encoding nrRT comprises unmodified uridine and a mixture of modified U selected from N1mΨU, ΨU, 5meU, and 5moU.

[0025] In some embodiments, eukaryotic cells are transfected in vitro. In some embodiments, eukaryotic cells are transfected in vivo. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the eukaryotic cells are human cells. In some embodiments, human cells are removed from a human subject, transfected (e.g., in vitro) with RNA of (a) and (b) to insert heterologous polynucleotides into the human cell genome, and administered to the human subject.

[0026] In some implementations, cells are transfected using LNP formulations, lipid transfection reagents, or by electroporation.

[0027] In another aspect, this disclosure provides a composition comprising: (a) RNA encoding a non-LTR reverse transcriptase transposon reverse transcriptase protein (nrRT) comprising a reverse transcriptase domain and a nuclease domain; and (b) template RNA. In some embodiments, the template RNA comprises a promoter, a payload sequence, a polyA sequence, and an nrRT binding sequence. In some embodiments, the template RNA comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the template RNA comprises a mixture containing unmodified uridine and one or more modified uridines selected from N1mΨU, ΨU, 5meU, and 5moU. In some embodiments, the template RNA containing the modified uridine is not cleavable by ribozymes.

[0028] In some embodiments, the template RNA further comprises a 5' ribozyme sequence selected from active ribozymes, partially active ribozymes, ribozymes with reduced catalytic activity, or ribozymes without catalytic activity. In some embodiments, the 5' ribozyme is selected from HDV ribozymes, TriCasA ribozymes, or their native homologs, semi-homologs, or variants. In some embodiments, the 5' ribozyme sequence comprises a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence), or a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:3 or 13-22 (without pp7 binding sequence).

[0029] In some implementations, the template RNA does not contain a functional 5' ribozyme sequence or does not contain a 5' ribozyme sequence.

[0030] In some implementations, the template RNA further includes a 5' sequence that protects the 5' end from degradation.

[0031] In some implementations, the template RNA further includes a 5' sequence that facilitates the specific insertion of heteropolynucleotides into target sites in the eukaryotic genome.

[0032] In some embodiments, the nrRT binding sequence includes a 3'UTR sequence. In some embodiments, the 3'UTR sequence is isolated from organisms selected from: three-spined stickleback, fruit fly, horseshoe crab, nine-spined stickleback, golden fly larvae, medaka, white-throated bunting, zebra finch, red flour beetle, and white-throated... Fruit flies, silkworms, and A. vaga. In some embodiments, the 3'UTR contains a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:26-39.

[0033] In some implementations, the template RNA further includes a 3' sequence that promotes site-specific insertion of heteropolynucleotides into the eukaryotic genome and / or enhances the efficiency and fidelity of target-induced reverse transcription.

[0034] In some embodiments, the template RNA further comprises one or more of the following: i) an RNA polymerase terminator, ii) a sequence that can be used for purification, iii) a sequence encoding a protein that can be used for enrichment, iv) a Kozak sequence at the 5' of the payload sequence, and / or v) a polyA sequence located at the 3' of the nrRT binding sequence.

[0035] In some embodiments, the template RNA further comprises (a) a 5' sequence homologous to a DNA sequence at the target insertion site 5' in a eukaryotic genome; (b) a 3' sequence homologous to a DNA sequence at the target insertion site 3' in a eukaryotic genome; or both (a) and (b).

[0036] In some implementations, the template RNA lacks 5' phosphate.

[0037] In some embodiments, the payload sequence encodes a therapeutic protein that replaces or supplements a defective gene or protein. In some embodiments, the therapeutic protein is selected from factor VIII, factor IX, and phenylalanine hydroxylase (PAH).

[0038] In some implementations, the payload sequence encodes an inhibitor of another protein. In some implementations, the inhibitor is a single-chain antibody.

[0039] In some implementations, the payload sequence encodes regulatory RNA.

[0040] In some implementations, the payload sequence encodes a protein selected from the genes in Table 7.

[0041] In some embodiments, the RNA encoding nrRT comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the RNA encoding nrRT comprises unmodified uridine and a mixture of modified U selected from N1mΨU, ΨU, 5meU, and 5moU.

[0042] In another aspect, this disclosure provides a pharmaceutical composition. The pharmaceutical composition may comprise the composition described herein. In some embodiments, the pharmaceutical composition is formulated as a lipid nanoparticle selected from liposomes or lipid nanoparticles (LNPs). In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient or salt.

[0043] In another aspect, this disclosure provides a method for treating a disease or condition in a subject. In some embodiments, the method comprises administering an effective amount of the pharmaceutical composition of this disclosure to the subject.

[0044] In some embodiments, the disease or condition is selected from sickle cell anemia, severe combined immunodeficiency (ADA-SCID / X-SCID), cystic fibrosis, hemophilia, Duchenne muscular dystrophy, Huntington's disease, Parkinson's disease, hypercholesterolemia, α-1 antitrypsin, chronic granulomatous disease, Fanconi anemia, and Gaucher disease. In some embodiments, the disease or condition is selected from Table 7. Attached Figure Description

[0045] Figure 1 This is a diagram illustrating the proposed mechanism of action for delivering the dual RNA composition of this disclosure into the cytoplasm of target cells (left) and inserting heterologous polynucleotides into the genomic DNA of target cells (right).

[0046] Figure 2 A diagram illustrating an exemplary mRNA encoding nrRT, an exemplary template RNA, and an exemplary formulation delivery of the present disclosure is shown.

[0047] Figure 3 The structures of uridine incorporated into the RNA of this disclosure and modified uridine are shown.

[0048] Figure 4 As shown, incorporating modified uridine into template RNA resulted in successful integration of the payload sequence into the host cell genome. The template RNA contained 5 meU of modified uridine, and the payload sequence encoding GFP was cleaved by the 5' ribozyme HDV-gu6 (left panel). Transfected cells expressed GFP (right panel).

[0049] Figure 5 As shown, the modified uridine N1-methyl-pseudouridine (N1mΨU) incorporated into the template RNA was not cleaved by the HDV_gu6 ribozyme (left figure), but the payload sequence encoding GFP was still successfully integrated into the host cell genome (right figure).

[0050] Figure 6 The expression of the payload sequence encoding GFP in cells transfected with different template RNAs incorporating different modified uridines is shown. The results indicate that the modified uridines N1-methyl-pseudouridine (N1mΨU) and pseudouridine (ΨU) produced the highest number of GFP-positive cells and the lowest toxicity, even though these template RNAs were not cleaved by 5' ribozymes (see [link to original text]). Figure 4 (Left image).

[0051] Figure 7The expression of the payload sequence encoding GFP in cells transfected with template RNA incorporating N1-methyl-pseudouridine (N1mΨU) and containing different 5' modules is shown. The results indicate that template RNA containing a non-catalytically inactive ribozyme (HDV_gu5b_CatDead) and template RNA with deleted ribozyme sequences (SL28, 28noRZ) can still successfully integrate the payload sequence into the host cell genome. "+" and "-" indicate the presence or absence (RZ Seq.; RZ fold) or activity (RZ Act.) of the indicated structure for each ribozyme sequence. For activity (RZ Act.), "-" indicates that the ribozyme sequence has not cleaved the indicated nucleotide substitution.

[0052] definition

[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While substantially any methods and materials similar to those described herein may be used in the practice or testing of this invention, only exemplary methods and materials are described. For the purposes of this invention, the following terms are defined.

[0054] Unless the context clearly indicates otherwise, the terms “a,” “an,” and “the / said” include plural references.

[0055] As used herein, the term "homologous" refers to an nrRT protein and a template RNA, wherein the nrRT protein preferentially binds to a specific template RNA. The nrRT protein and its homologous template RNA may be naturally present (referred to as native protein and template), or one or both of the nrRT protein and template RNA may be modified to preferentially bind to another nrRT protein and / or template RNA.

[0056] The term "natural" refers to nucleic acids or proteins that are found in nature or that are present in their native configuration when they are in another organism or cell.

[0057] The term "ribozyme" refers to an RNA molecule that has enzymatic activity. This term includes self-cleaving ribozymes, which catalyze sequence-specific intramolecular cleavage of RNA, including cis-cleavage (on the same strand).

[0058] The term “natural ribozyme” refers to ribozymes found in nature (e.g., wild-type ribozymes) and includes different ribozymes found in different organisms.

[0059] The term "homogeneous ribozyme" refers to a ribozyme sequence that preferentially associates with natural or naturally occurring nrRT proteins.

[0060] The term "semi-homologous" ribozyme refers to a ribozyme from a closely related species that associates with the nrRT protein.

[0061] The term "HDV RZ fold" refers to an RNA sequence that contains the folded hepatitis D virus (HDV) ribozyme and retains the ribozyme function.

[0062] The term "non-LTR retrotransposon reverse transcriptase protein" or "nrRT protein" refers to a reverse transcriptase protein that can replicate template RNA into cDNA at a target site in the host cell genome, where cDNA synthesis is initiated by a nick introduced by the nrRT protein at the target site, resulting in stable double-stranded transgene insertion. The term also includes modified variants of the nrRT protein that possess enhanced efficiency, modified nick-forming activity, or modified properties (affinity) for binding to template RNA.

[0063] The term "template RNA" refers to a single-stranded RNA that binds to the nrRT protein and serves as a template for the synthesis of first-stranded cDNA at target sites in the host cell genome.

[0064] The term "payload" refers to a compound, protein, inhibitor, or nucleic acid inserted into the host cell genome using the compositions and methods of this disclosure.

[0065] The term "coding" refers to the transcription and / or translation of an RNA sequence to produce a product. The product can be a polypeptide, protein, or functional RNA.

[0066] The term "operably linked" refers to a sequence being linked to another sequence in a functional relationship. For example, if a promoter or enhancer regulates transcription of a payload sequence, then the promoter or enhancer is operably linked to that sequence. This term includes covalently linked nucleic acid sequences in plasmids or vectors, regardless of the number of nucleotides between the sequences. For example, even if a payload sequence exists between a promoter and a polyA sequence, the promoter is operably linked to the polyA sequence.

[0067] The term "linkage site" refers to the location in the host cell genome where genomic DNA is joined to the inserted double-stranded cDNA.

[0068] The term "lipid nanoparticle" or "LNP" refers to a delivery carrier containing one or more lipids (e.g., cationic lipids, non-cationic lipids, PEG-modified lipids).

[0069] The term "liposome" generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayers or bilayers.

[0070] As used in this paper, the "percentage of sequence identity" is determined by comparing two best-aligned sequences in a comparison window, where the sequence portion in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in both sequences where the same nucleic acid base or amino acid residue appears, obtaining the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the percentage of sequence identity.

[0071] In the context of two or more nucleic acid or polypeptide sequences, the terms "identical" or "identical" refer to two or more identical sequences or subsequences. When comparing and aligning sequences on a comparison window or designated region using one of the following sequence comparison algorithms or through manual alignment and visual inspection to obtain maximum correspondence, sequences are considered "substantially identical" if they have a specific percentage of identical nucleotide or amino acid residues (e.g., at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity within a specific region). These definitions also refer to the complement of the test sequence.

[0072] For sequence comparisons, a reference sequence is typically used, and the test sequence is compared to this reference sequence. When using a sequence alignment algorithm, the test and reference sequences are input into the computer, the coordinates of the subsequences are specified, and the sequence algorithm program parameters are specified if necessary. Default program parameters are usually used, but alternative parameters can also be specified. The sequence alignment algorithm then calculates the percentage of sequence identity or similarity between the test sequence and the reference sequence based on the program parameters.

[0073] As used herein, a “comparison window” comprises a segment of reference selected from any one of a number of consecutive positions ranging from 20 to 600, typically from about 50 to about 200, and more typically from about 100 to about 150, in which a sequence can be compared with a reference sequence having the same number of consecutive positions after optimal alignment of the two sequences. The sequence alignment methods used for comparison are well known in the art. The best alignment of sequences for comparison can be performed by, for example, Smith and Waterman’s local homology algorithm (Adv. Appl. Math. 2: 482, 1970), Needleman and Wunsch’s homology alignment algorithm (J. Mol. Biol. 48: 443, 1970), Pearson and Lipman’s similarity search method (Proc. Natl. Acad. Sci. USA 85: 2444, 1988), computer implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or manual alignment and visual inspection (see, for example, Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).

[0074] Algorithms suitable for determining sequence identity and sequence similarity percentages are BLAST and BLAST 2.0, described by Altschul et al. (Nuc. Acids Res. 25: 3389-402, 1977) and Altschul et al. (J. Mol. Biol. 215: 403-10, 1990), respectively. The software sequence used to perform BLAST analysis is publicly available from the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The algorithm involves first identifying high-scoring sequence pairs (HSPs) in the query sequence by recognizing short words of length W that match or satisfy a positive threshold score T when compared to words of the same length in the database sequence. T is called the neighborhood word score threshold (Altschul et al., ibid.). These initial neighborhood word hits serve as seeds to initiate a search for longer HSPs containing them. Word hits extend in both directions along each sequence until the cumulative alignment score can increase. For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for matching residues; always >0) and N (penalty score for non-matching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Word hit extension in each direction stops when: the cumulative alignment score decreases by an amount X from its maximum value; the cumulative score becomes zero or below zero due to the accumulation of one or more negatively scored residues; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a default word length (W) of 11, an expected value (E) of 10, M = 5, N = -4, and double-stranded comparisons. For the amino acid sequence, the BLASTP program used a default word length of 3 and an expected value (E) of 10, and the BLOSUM62 score matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989) alignment (B) was 50, with an expected value (E) of 10, M = 5, and N = -4.

[0075] The BLAST algorithm also performs statistical analysis on the similarity between two sequences (see, for example, Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-87, 1993). One similarity metric provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the probability of a chance match between two nucleotide or amino acid sequences. For example, if the minimum sum probability in a comparison of the test nucleic acid with a reference nucleic acid is less than about 0.2, typically less than about 0.01, and more typically less than about 0.001, the nucleic acid is considered similar to the reference sequence.

[0076] The term "heterologous" refers to any polynucleotide or polypeptide sequence that is not naturally present in a host cell or organism or that is inserted at a location that is not naturally present in a host cell or organism.

[0077] The term "vector" refers to DNA, typically double-stranded DNA, containing foreign or heterologous DNA. This term includes plasmids and viral vectors. Vectors may contain polynucleotide sequences that facilitate autonomous replication of the vector within host cells. Vectors can be used to replicate foreign or heterologous DNA in suitable host cells. Furthermore, vectors may contain elements that allow the inserted DNA to be transcribed into one or more mRNA molecules. Expression vectors additionally contain sequence elements operatively linked to the inserted DNA, which increase the half-life of the expressed mRNA and / or allow the translation of the mRNA into protein molecules. Detailed Implementation

[0078] This disclosure provides compositions and methods for improving gene therapy techniques for introducing heteropolynucleotides into target cells. The disclosure provides methods for inserting heteropolynucleotides into target sites (site-specific integration) in the genome of target cells. The heteropolynucleotides may contain transgenes encoding therapeutic proteins or non-protein regulatory elements. In some embodiments, the cells are eukaryotic cells, such as mammalian cells.

[0079] This disclosure offers numerous advantages over current gene therapy technologies, including: 1) the technology is RNA-based, using RNA template genes synthesized into the target cell genome, thus avoiding problems associated with DNA delivery into cells, such as unintended gene alterations that may impair cell function and promote tumorigenesis; 2) heteropolynucleotides can be inserted into so-called "safe harbor" sites, which do not cause harmful or undesirable alterations to the target cell genome or cell physiology; 3) there are no known limitations on the size or length of the heteropolynucleotides inserted into the target cell genome; and 4) there are no requirements regarding cell division, thus allowing targeting of post-mitotic cells, such as neurons. Some advantages of this disclosure are referred to as therapeutic addition by controlled synthetic insertion (TASCI). TM As shown in Table 1.

[0080] Table 1.

[0081]

[0082] The compositions and methods disclosed herein utilize a dual RNA delivery system to introduce heterologous polynucleotides into target cells; 1) a first RNA (e.g., mRNA) encoding a non-LTR retrotransposon reverse transcriptase protein (nrRT); and 2) a second RNA (also referred to as template RNA) comprising a protein-coding sequence (or open reading frame "ORF") and a sequence binding to the nrRT. The system may further include a delivery system for introducing both RNAs into the cytoplasm of the target cell. In some embodiments, the delivery system comprises lipid nanoparticles (LNPs).

[0083] After both RNAs are delivered to the cytoplasm of the target cell, the mRNA is translated by the cell's endogenous protein synthesis components to produce the nrRT protein. The nrRT protein then binds to the template RNA, forming a ribonucleoprotein (RNP) complex, which enters the nucleus of the target cell. Unbound by theory, it is currently believed that after delivery to the nucleus, the endonuclease (EN) domain of the nrRT protein cleaves the lower strand of the target genomic DNA, providing a 3' hydroxyl terminus, which acts as a primer for reverse transcription of the template RNA by the reverse transcriptase (RT) domain of the nrRT protein. After the first strand is synthesized to produce cDNA, the EN domain or a host endonuclease cleaves the opposite side (e.g., the upper strand) of the genomic DNA. The cleavage in the upper strand produces another 3' hydroxyl terminus, which acts as a primer for the synthesis of the second strand of cDNA. It is currently unknown whether the second strand DNA synthesis is carried out by the nrRT or by a cellular polymerase. The cleavage is subsequently repaired, resulting in the integration of the double-stranded cDNA into the target site in the genomic DNA. The proposed mechanism is as follows: Figure 1 As shown.

[0084] Those skilled in the art should understand that these two RNAs do not necessarily contain the nrRT protein and its naturally occurring homologous template RNA or its modified variants; rather, the nrRT protein and template RNA can be engineered separately to bind into different nrRTs and / or template RNAs. Eukaryotic non-LTR retrotransposon reverse transcriptase protein (nrRT)

[0085] In some embodiments, this disclosure provides RNA (e.g., mRNA) encoding the nrRT protein. In some embodiments, the nrRT protein comprises one or more, or a combination of, a DNA-binding domain, an RNA-binding domain, a reverse transcriptase domain, and a nuclease domain. The nuclease domain of the nrRT protein of this disclosure creates a single-stranded nick in the genomic DNA at the target site, producing a free 3' end of the genomic DNA that acts as a primer for reverse transcription of the template RNA into cDNA. After the first-strand cDNA synthesis, the nrRT protein introduces a nick in the second strand, which produces another 3' end of the genomic DNA that acts as a primer for second-strand cDNA synthesis at the target site. This results in the insertion of a double-stranded DNA molecule into the target site of the host cell's genomic DNA.

[0086] It should be understood that this disclosure covers any eukaryotic nrRT protein capable of binding to and reverse transcribing template RNA at target sites in the host cell genome. In some embodiments, the nrRT protein comprises proteins isolated from the white-throated bunting (Zonotrichia albicollis), the zebra finch (Taeniopygia guttata), and the white-throated bunting. (Tinamusguttatus), Geospiza fortis, Pungitis pungitis, Oryziaslatipes, Danio rerio, Oryzias melastigma, Petromyzon marinus, Salmo trutta, Salmo salar, Gasterosteusaculeatus, Drosophila mercatorum, Drosophila melanogaster, Nasonia vitripennis, Tribolium castaneum, Drosophila asimulans, Apis cerana, Bombyx mori, Lepidurus couesii, Triops cancriformis, Limulus polyphemus, Hydra The nrRT protein or its modified functional variants are derived from *Maginipapillata*, *Adinetavaga*, or *Ciona intestinalis*. In some embodiments, the mRNA encodes a protein isolated from the white-throated bunting, zebra finch, or diphtheria. The amino acid sequence of the nrRT protein is substantially the same as that of the following species: *Gnaphalium micranthum*, *Spinytail spp.*, *Melia azedarach*, *Gnaphalium micranthum*, *Syngonium micranthum*, *Zebrafish*, *Gnaphalium micranthum*, *Leptochloa crus-galli*, *Gnaphalium micranthum*, *Apis cerana*, *Bombyx mori*, *Lepidurus couesii*, *Horseshoe crab*, *Horseshoe crab*, *Hydramagnipapillata*, *Adineta vaga*, or *Glassy tunicate*. In some embodiments, the mRNA encodes a protein isolated from the white-throated bunting, zebra finch, and *Gnaphalium micranthum*. The nrRT protein of the following species has at least 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) amino acid sequence. In some embodiments, the nrRT protein comprises an nrRT protein isolated from other animals.

[0087] In some implementations, the RNA encoding nrRT contains one or more of the following: a 5' cap, a 5' UTR, an open reading frame (ORF) encoding nrRT, a 3' URT, or a polyA sequence at the 3' end.

[0088] In some implementations, the RNA encoding nrRT contains one or more modified uridine (U) nucleotides as described herein.

[0089] Figure 2 A diagram showing an exemplary mRNA encoding the nrRT disclosed herein is provided.

[0090] template RNA

[0091] In some aspects, the template RNA of this disclosure comprises (i) a promoter, (ii) a payload sequence, (iii) a polyA sequence, and (iv) an nrRT binding sequence. In some embodiments, the elements of the template RNA are operatively linked to each other. It should be understood that the relative positions of the individual elements in the template RNA can vary in the 5' to 3' direction. For example, in some embodiments, the template RNA comprises elements (i), (ii), (iii), and (iv) in the 5' to 3' direction. In some embodiments, the template RNA comprises elements (iv), (i), (ii), and (iii) in the 5' to 3' direction.

[0092] It should be further understood that the individual elements in the template RNA can vary in the 5' to 3' orientation relative to other elements. For example, in some embodiments, the promoter (i), payload sequence (ii), and / or poly sequence (iii) are in an anti-5' to 3' orientation relative to the element (iv). Furthermore, in some embodiments, the transcription direction of the payload sequence in the template can be reversed, such that in one orientation the promoter (i) is closest to the 5' end of the template RNA, or in a second orientation the promoter (i) is closest to the 3' end of the template RNA.

[0093] Figure 2 A diagram of an exemplary template RNA of this disclosure is shown.

[0094] In some embodiments, the promoter is the RNA polymerase (Pol) II promoter. In some embodiments, the promoter is selected from the EFS promoter, ABPnat mini promoter and CRNM-TTR enhancer promoter, AAV-rDNA TTR promoter or CBh promoter.

[0095] In some embodiments, the payload sequence encodes a reporter molecule protein, such as GFP or luciferase. In some embodiments, the payload sequence encodes a therapeutic protein that replaces or complements a defective gene or protein. In some embodiments, the therapeutic protein is used to treat a disease or condition of a subject or patient. In some embodiments, the therapeutic protein is selected from Factor VIII, Factor IX, and phenylalanine hydroxylase (PAH).

[0096] In some embodiments, the payload sequence encodes a protein in the “Gene Name” column of Table 7 below. In some embodiments, the therapeutic protein is used to treat the diseases or conditions shown in Table 7 below.

[0097] In some implementations, the payload sequence encodes an inhibitor of another protein. In some implementations, the inhibitor is a single-chain antibody.

[0098] In some embodiments, the payload sequence encodes a regulatory RNA. In some embodiments, the regulatory RNA is selected from ligand-binding riboswitches, such as ligand-activated riboswitches or aptazymes, small RNAs (sRNAs), small interfering RNAs (siRNAs), or short hairpin RNAs (shRNAs).

[0099] In some embodiments, the polyA sequence is selected from short SV40 poly, SNRP1 polyA, synthetic polyA, BHGpolyA, or BGH polyA min. In some embodiments, the template RNA includes the WPRE3 3' enhancer.

[0100] In some embodiments, the nrRT binding sequence comprises a 3' region isolated from a natural non-LTR reverse transcription element or a sequence from an organism containing a non-LTR reverse transcription element. In some embodiments, the nrRT binding sequence comprises a 3' UTR sequence. In some embodiments, the 3' UTR sequence is isolated from an organism containing a non-LTR reverse transcription element. In some embodiments, the 3' UTR sequence is isolated from an organism selected from: three-spined stickleback, Drosophila melanogaster, horseshoe crab, nine-spined stickleback, *Gypsy pupa*, *Gypsy medaka*, *Gypsy medaka*, *Gypsy medaka*, *Gypsy leucantha .... Fruit flies, silkworms, and *A. vaga*. In some embodiments, the nrRT binding sequence includes sequences isolated from three-spined sticklebacks, *Drosophila melanogaster*, horseshoe crabs, *Spinytail axolotl*, *Gypsy pupa*, *Gypsy medaka*, *Phyllostachys edulis*, *White-throated bunting*, *Gypsy siskinensis*, *Red flour beetle*, and *A. vaga*. The sequences of *Drosophila melanogaster*, *Bombyx mori*, and *A. vaga* have greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity). In some embodiments, the 3'UTR contains a sequence that has greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with any sequence selected from SEQ ID NO: 26-39.

[0101] In some embodiments, the nrRT binding sequence comprises a modified (non-natural) sequence. For example, the nrRT binding sequence may be modified to increase or decrease binding to the nrRT protein of this disclosure.

[0102] Modified uridine

[0103] In some embodiments, the mRNA encoding nrRT and / or the template RNA contains one or more modified uridine (U) nucleotides. RNA containing unmodified uridine can activate an innate immune response and is less stable in cells. Modified uridine can provide the following advantages: i) they reduce the innate immune response in the host organism when cells are transfected with the nrRT mRNA and template RNA of this disclosure, ii) they increase RNA stability, and iii) they increase the amount of protein produced during RNA transcription.

[0104] In some embodiments, the mRNA encoding the nrRT protein comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the ORF encoding nrRT comprises modified uridine (U) selected from one of the following: N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), or 5-methoxyuridine (5moU). In some embodiments, the ORF encoding nrRT comprises N1-methyl-pseudouridine (N1mΨU). In some embodiments, the ORF encoding nrRT comprises unmodified uridine and a mixture or combination of modified uridines selected from N1mΨU, ΨU, 5meU, and 5moU. The structure of the modified uridine is as follows: Figure 3 As shown.

[0105] In some implementations, the template RNA contains one or more modified uridine nucleotides. The inventors unexpectedly determined that template RNA containing one or more modified uridines resulted in successful integration and expression of the payload sequence at target sites in the genome.

[0106] In some embodiments, the template RNA comprises one or more modified uridines selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the template RNA comprises a single type of modified uridine selected from one of: N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), or 5-methoxyuridine (5moU). In some embodiments, the template RNA comprises N1-methyl-pseudouridine (N1mΨU). In some embodiments, the template RNA comprises unmodified uridine and a mixture or combination of modified uridines selected from N1mΨU, ΨU, 5meU, and 5moU.

[0107] In some embodiments, the template RNA containing modified uridine is not cleaved by ribozymes. In some embodiments, the template RNA containing modified uridine N1-methyl-pseudouridine (N1mΨU) or pseudouridine (ΨU) is not cleaved by ribozymes. In some embodiments, the template RNA containing modified uridine improves the efficiency of insertion into the eukaryotic genome compared to the template RNA containing unmodified uridine.

[0108] In some implementations, cytotoxicity is reduced when the template RNA contains modified uridine.

[0109] Those skilled in the art will understand that the modified uridine is distributed throughout the template RNA sequence, and in some embodiments, all uridines contain the same modified uridine (e.g., all uridines are N1-methyl-pseudouridine (N1mΨU) or all modified uridines are pseudouridine (ΨU)).

[0110] 5' ribozyme

[0111] As is known in the art, the native RNA template that binds to the homologous nrRT protein contains an active 5' ribozyme. The self-cleavage function of the ribozyme has previously been considered crucial for genome insertion. Therefore, in some embodiments, the template RNA further or optionally contains an active or functional 5' ribozyme sequence. In some embodiments, the 5' ribozyme is selected from HDV ribozymes (e.g., HDV_ac2, HDV_gu1, HDV_gu5b, HDV_gu6, HDV_gu5b_NP2), TriCasA ribozymes, L8 ribozymes (e.g., L8_gu6), SL28 ribozymes, or their native or semi-homogeneous ribozymes or modified variants. In some embodiments, the ribozyme sequence comprises a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence), or a sequence having greater than or equal to 60% sequence identity with a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence) (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity).

[0112] However, contrary to the teachings of the art, the inventors unexpectedly determined that template RNA engineered to have reduced activity, non-catalytically active ribozymes, and uncut ribozymes could be successfully used to insert heteropolynucleotides into target sites in the genomic DNA of target cells. Therefore, in some embodiments, the 5' ribozyme sequence is selected from partially active ribozymes, ribozymes with reduced catalytic activity, or non-catalytically active ribozyme sequences. In some embodiments, the template RNA does not contain a functional 5' ribozyme sequence. In some embodiments, the template RNA does not contain a 5' ribozyme sequence.

[0113] Add-ons

[0114] In some embodiments, the template RNA includes, further includes, or optionally includes 5' and 3' elements that regulate the insertion of the payload sequence into target sites in the host cell genome. Non-limiting examples of these elements are described below.

[0115] In some embodiments, the template RNA contains a Kozak co-translational initiation site located upstream of or at the 5' end of the payload sequence. In some embodiments, the Kozak sequence contains the sequence 5'-GCCACC-3' (SEQ ID NO:7).

[0116] In some embodiments, the template RNA includes an RNA polymerase (RNAP) terminator sequence located at the 5' of the promoter sequence. The function of the RNAP terminator sequence is to prevent RNA polymerase from reading the gene from the target insertion site. In some embodiments, the RNAP terminator sequence includes the sequence 5'-AGGTCGACCAGATGTCCGAGGTCGACCAGT TGTCCG-3' (SEQ ID NO:4).

[0117] In some embodiments, the template RNA includes a 5' sequence or 5' modification that protects the 5' end from degradation. In some embodiments, the 5' modification includes a 5' cap structure.

[0118] In some implementations, the template RNA includes a 5' sequence that facilitates the specific insertion of heteropolynucleotides into target sites in the eukaryotic genome.

[0119] In some embodiments, the template RNA includes a 3' sequence that facilitates site-specific insertion of heteropolynucleotides into the eukaryotic genome. In some embodiments, the template RNA includes a 3' sequence that enhances the efficiency and fidelity of target-induced reverse transcription.

[0120] In some embodiments, the template RNA contains a sequence that can be used to purify the template RNA. In some embodiments, the sequence that can be used to purify the template RNA contains a hairpin structure that binds to the PP7 capsid protein or a truncated version thereof. See, for example, Hogg, JR and Collins, K. RNA-based affinity purification reveals 7SK RNPs with distinct components and regulation. RNA 13,868–880 (2007).

[0121] In some embodiments, the template RNA contains a sequence that binds to a DNA-binding protein, allowing enrichment of the inserted double-stranded sequence in the target DNA by purifying a fragment of genomic DNA containing the DNA-binding protein-binding sequence. In some embodiments, the payload sequence is flanked by sequences that bind to DNA-binding proteins, such that one sequence is located at the 5' of the payload sequence (e.g., upstream of a promoter sequence) and another sequence is located at the 3' of the payload sequence (e.g., downstream of a polyA sequence). In some embodiments, the template RNA contains a lacO operon sequence that binds to a LacI protein. In some embodiments, the template RNA contains a first lacO operon sequence located at the 5' of the payload sequence and a second lacO operon sequence located at the 3' of the payload sequence.

[0122] In some implementations, the template RNA contains a polyA sequence located at the 3' of the nrRT binding sequence.

[0123] In some embodiments, the template RNA comprises (a) a 5' sequence homologous to a DNA sequence at the 5' of the target insertion site in a eukaryotic genome; (b) a 3' sequence homologous to a DNA sequence at the 3' of the target insertion site in a eukaryotic genome; or both (a) and (b). In some embodiments, the 5' homologous sequence comprises a homologous sequence of about 1 to 36 nucleotides that pairs with the complementary sequence of the target site. In some embodiments, the 3' homologous sequence comprises a homologous sequence of about 1 to 30 nucleotides that pairs with the complementary sequence of the target site.

[0124] In some implementations, the template RNA does not contain 5' phosphate.

[0125] Methods for inserting polynucleotides at target sites in the genome

[0126] This disclosure also provides methods for inserting heterologous polynucleotides into target sites in a eukaryotic genome. In some embodiments, the method comprises transfecting eukaryotic cells with: (a) RNA encoding a non-LTR reverse transcriptase protein (nrRT) comprising a reverse transcriptase domain and a nuclease domain; and (b) template RNA. In some embodiments, the template RNA comprises a promoter, a payload sequence, a polyA sequence, and an nrRT binding sequence.

[0127] In some embodiments, the template RNA comprises one or more modified uridines selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof. In some embodiments, the template RNA comprises unmodified uridine and a mixture of one or more modified uridines selected from N1mΨU, ΨU, 5meU, and 5moU.

[0128] In some implementations, the template RNA containing modified uridine cannot be cleaved by ribozymes.

[0129] In some implementations, nrRT is expressed in cells and catalyzes the insertion of a double-stranded heteropolynucleotide containing a payload sequence into a target site in the eukaryotic genome.

[0130] This method offers the advantage that template RNA containing modified uridine increases the efficiency of payload sequence insertion into the eukaryotic genome compared to template RNA containing unmodified uridine.

[0131] In some embodiments, the template RNA further comprises a 5' ribozyme sequence selected from an active ribozyme. In some embodiments, the ribozyme is selected from HDV ribozyme, TriCasA ribozyme, its natural homologous ribozyme, semi-homologous ribozyme, or variant.

[0132] This method also offers the unexpected advantage that the template RNA does not require a functional ribozyme for the insertion and expression of the payload sequence. Therefore, in some embodiments, the template RNA comprises a 5' ribozyme sequence selected from partially active ribozymes, ribozymes with reduced catalytic activity, or ribozymes with no catalytic activity. In some embodiments, the template RNA does not contain a functional 5' ribozyme sequence.

[0133] This method also offers the unexpected advantage that the template RNA does not require a 5' ribozyme sequence for the insertion and expression of the payload sequence. Therefore, in some embodiments, the template RNA does not contain a 5' ribozyme sequence.

[0134] Template RNA containing modified uridine can also reduce cytotoxicity compared to template RNA containing unmodified uridine. Therefore, in some embodiments, cytotoxicity is reduced when the template RNA contains a modified uridine selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof.

[0135] In some embodiments of this method, increasing the molar ratio of nrRT mRNA to template RNA delivered to target cells, compared to an equimolar (1:1) ratio, increases the insertion efficiency of the payload sequence at target sites in the genome. In some embodiments, increasing the total amount of RNA delivered to target cells increases the insertion efficiency of the payload sequence at target sites in the genome. In some embodiments, increasing both the molar ratio of nrRT mRNA to template RNA and the total amount of RNA delivered to target cells increases the insertion efficiency of the payload sequence at target sites in the genome. Representative, non-limiting examples illustrating the effects of the molar ratio of nrRT to template RNA and total RNA on payload expression are described in the examples.

[0136] In some embodiments of this method, the payload sequence encodes a therapeutic protein that replaces or supplements a defective gene or protein. In some embodiments, the therapeutic protein is used to treat a disease or condition in a subject or patient. In some embodiments, the therapeutic protein is selected from Factor VIII, Factor IX, and phenylalanine hydroxylase (PAH).

[0137] In some embodiments of this method, the payload sequence encodes an inhibitor of another protein. In some embodiments, the inhibitor is a single-chain antibody.

[0138] In some embodiments of this method, the payload sequence encodes a regulatory RNA. In some embodiments, the regulatory RNA is selected from ligand-binding riboswitches, such as ligand-activated riboswitches or aptazymes, small RNAs (sRNAs), small interfering RNAs (siRNAs), or short hairpin RNAs (shRNAs).

[0139] In some embodiments, the method includes transfecting eukaryotic cells. In some embodiments, the eukaryotic cells are transfected in vitro. In some embodiments, the eukaryotic cells are transfected in vivo. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the eukaryotic cells are human cells.

[0140] In some implementations, cells are transfected using LNP formulations, lipid transfection reagents, or by electroporation. In some implementations, viral vector transduction or transfection of cells is not performed.

[0141] In some embodiments of this method, the template RNA includes, further includes, or optionally includes 5' and 3' elements that regulate the insertion of the payload sequence into target sites in the host cell genome. Non-limiting examples of these elements are described below.

[0142] In some implementations, the template RNA contains a Kozak co-translational initiation site located upstream or 5' of the payload sequence.

[0143] In some implementations, the template RNA contains an RNA polymerase (RNAP) terminator sequence located at the 5' of the promoter sequence. The function of the RNAP terminator sequence is to prevent RNA polymerase from reading the gene from the target insertion site.

[0144] In some embodiments, the template RNA includes a 5' sequence or 5' modification that protects the 5' end from degradation. In some embodiments, the 5' modification includes a 5' cap structure.

[0145] In some implementations, the template RNA includes a 5' sequence that facilitates the specific insertion of heteropolynucleotides into target sites in the eukaryotic genome.

[0146] In some embodiments, the template RNA includes a 3' sequence that facilitates site-specific insertion of heteropolynucleotides into the eukaryotic genome. In some embodiments, the template RNA includes a 3' sequence that enhances the efficiency and fidelity of target-induced reverse transcription.

[0147] In some embodiments, the template RNA contains a sequence that can be used to purify the template RNA. In some embodiments, the sequence that can be used to purify the template RNA contains a hairpin structure that binds to the PP7 capsid protein or a truncated version thereof. See, for example, Hogg, JR and Collins, K. RNA-based affinity purification reveals 7SK RNPs with distinct composition and regulation. RNA 13,868–880 (2007).

[0148] In some embodiments, the template RNA contains a sequence that binds to a DNA-binding protein, allowing enrichment of the inserted double-stranded sequence in the target DNA by purifying a fragment of genomic DNA containing the DNA-binding protein-binding sequence. In some embodiments, the payload sequence is flanked by sequences that bind to DNA-binding proteins, such that one sequence is located at the 5' of the payload sequence (e.g., upstream of a promoter sequence) and another sequence is located at the 3' of the payload sequence (e.g., downstream of a polyA sequence). In some embodiments, the template RNA contains a lacO operon sequence that binds to a LacI protein. In some embodiments, the template RNA contains a first lacO operon sequence located at the 5' of the payload sequence and a second lacO operon sequence located at the 3' of the payload sequence.

[0149] In some embodiments, the template RNA further comprises a polyA sequence located at the 3' of the nrRT binding sequence. In some embodiments, the template RNA does not contain a 5' phosphate.

[0150] In some embodiments, the template RNA comprises (a) a 5' sequence homologous to a DNA sequence at the 5' of the target insertion site in a eukaryotic genome; (b) a 3' sequence homologous to a DNA sequence at the 3' of the target insertion site in a eukaryotic genome; or both (a) and (b). In some embodiments, the 5' homologous sequence comprises a homologous sequence of about 1 to 36 nucleotides that pairs with the complementary sequence of the target site. In some embodiments, the 3' homologous sequence comprises a homologous sequence of about 1 to 30 nucleotides that pairs with the complementary sequence of the target site.

[0151] In some embodiments, the target insertion site is located in a ribosomal RNA gene or ribosomal DNA (rDNA). In some embodiments, the target insertion site is located in genomic DNA encoding ribosomal RNA (rRNA). In some embodiments, the target insertion site is located in a 5S, 8S, 18S, or 28S rDNA sequence.

[0152] In some embodiments of this method, the nrRT binding sequence comprises a 3' region isolated from a natural non-LTR reverse transcription element or a sequence from an organism containing a non-LTR reverse transcription element. In some embodiments, the nrRT binding sequence comprises a 3' UTR sequence. In some embodiments, the 3' UTR sequence is isolated from an organism containing a non-LTR reverse transcription element. In some embodiments, the 3' UTR sequence is isolated from an organism selected from: three-spined stickleback, Drosophila melanogaster, horseshoe crab, nine-spined stickleback, scorpion larvae, medaka, killifish, white-throated bunting, zebra finch, red flour beetle, and white-throated magpie. Fruit flies, silkworms, and *A. vaga*. In some embodiments, the nrRT binding sequence includes sequences isolated from three-spined sticklebacks, *Drosophila melanogaster*, horseshoe crabs, *Spinytail axolotl*, *Gypsy pupa*, *Gypsy medaka*, *Phyllostachys edulis*, *White-throated bunting*, *Gypsy siskinensis*, *Red flour beetle*, and *A. vaga*. The sequence of *Drosophila melanogaster*, *Bombyx mori*, or *A. vaga* has greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity). In some embodiments, the 3'UTR contains a sequence that has greater than or equal to 60% identity with a sequence selected from any one of SEQ ID NO: 26-39 (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity).

[0153] In some embodiments, the nrRT binding sequence comprises a modified (non-natural) sequence. For example, the nrRT binding sequence may be modified to increase or decrease binding to the nrRT protein of this disclosure.

[0154] In some embodiments of this method, the RNA encoding nrRT comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU) and mixtures thereof, or comprises unmodified U and a mixture of modified U selected from N1mΨU, ΨU, 5meU and 5moU.

[0155] Safe harbor insertion site

[0156] In some embodiments, heteropolynucleotides are inserted into so-called "safe harbor" sites in the host cell genome, which do not alter normal cellular physiology or metabolism. Examples of safe harbor sites include regions of the genome with high copy number repetitive genes, such that disruption of one gene does not significantly alter normal cellular physiology or metabolism. Examples of high copy number regions include rDNA genes encoding rRNA. Therefore, in some embodiments, the target insertion site is located in ribosomal RNA genes or ribosomal DNA (rDNA). In some embodiments, heteropolynucleotides are inserted into genomic DNA encoding ribosomal RNA (rRNA). In some embodiments, heteropolynucleotides are inserted into 5S, 8S, 18S, or 28S rDNA sequences.

[0157] delivery method

[0158] The compositions of the present invention can be introduced into target cells using methods compatible with RNA delivery. In some embodiments, lipid nanoformation such as liposomes or lipid nanoparticles (LNPs), lipid transfection reagents, or by electroporation are used to introduce mRNA encoding the nrRT protein and template RNA into target cells. In some embodiments, viral transduction of target cells is not used. Viral transduction is associated with various undesirable effects on cells, including mutations in the host cell chromosome, random integration, and the presence of double-strand breaks that can lead to cytotoxicity.

[0159] Pharmaceutical Composition

[0160] Pharmaceutical compositions comprising mRNA encoding the nrRT protein described herein and template RNA are also provided. In some embodiments, the pharmaceutical composition comprises lipid nanoformation, such as liposomes or lipid nanoparticles (LNPs). In some embodiments, the pharmaceutical composition comprises pharmaceutically acceptable excipients or salts. Examples of pharmaceutically acceptable excipients are described in the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and the International Pharmacopoeia.

[0161] Treatment

[0162] Methods for treating subjects or patients with the RNA compositions described herein are also provided. These methods can be used to treat diseases associated with defects or mutated genes in the subject, such as, but not limited to, diseases caused by single-gene defects (monogenous diseases), such as sickle cell anemia, severe combined immunodeficiency (ADA-SCID / X-SCID), cystic fibrosis, hemophilia, Duchenne muscular dystrophy, Huntington's disease, Parkinson's disease, hypercholesterolemia, α-1 antitrypsin, chronic granulomatous disease, Fanconi anemia, and Gaucher disease. In some embodiments, the method can be used to treat spinal muscular atrophy and hereditary retinal dystrophy.

[0163] In some implementations, this method can be used to treat polygenic conditions such as, but not limited to, heart disease, cancer, diabetes, schizophrenia, Parkinson's disease, and Alzheimer's disease.

[0164] In some implementations, this method can be used to treat infectious diseases, such as HIV.

[0165] For example, in a patient with hemophilia A, the payload may encode a wild-type factor VIII protein. In a patient with hemophilia B, the payload may encode a wild-type factor IX protein. In some embodiments, the payload may encode a wild-type p53 gene in subjects with a defective p53 gene to help prevent tumor growth.

[0166] Representative examples of diseases or conditions that can be treated by the methods disclosed herein are shown in Table 7.

[0167] In some respects, this method is an in vivo method. In some implementations, this method is an ex vivo method.

[0168] In some embodiments, the method includes administering an effective dose of the pharmaceutical composition of this disclosure to a patient requiring treatment. The pharmaceutical composition may be administered via any suitable method that results in the targeted integration of the payload sequence into one or more cells of the subject. In some embodiments, the pharmaceutical composition is administered intravenously, intramuscularly, subcutaneously, intraocularly, intraretinously, intracentrally, or intranasally.

[0169] The effective dose range can be 0.1 to 100 mg of active ingredient per kg of subject or patient weight (including endpoints and any subranges therein). The effective dose range can also be 1 microgram to 200 micrograms of active ingredient per dose for adults (including endpoints and any subranges therein). A skilled medical professional can easily determine the effective dose.

[0170] In some embodiments, cells are removed from a subject or patient before in vitro transfection with the mRNA encoding the nrRT protein and template RNA of this disclosure. In some embodiments, the subject or patient is human, and cells are removed from the human body and transfected with the mRNA encoding the nrRT protein and template RNA of this disclosure. After in vitro transfection, the correct insertion of the heterologous polynucleotide containing the payload sequence can be determined, for example, by amplifying the sequence at the 5' and / or 3' insert junction and / or amplifying the payload sequence. Correctly targeted insertion can also be determined by sequencing the genomic target site. Expression of the payload sequence can also be determined, for example, by detecting the expression of the product encoded by the payload sequence (such as a protein or regulatory RNA). After determining the correct integration and / or expression of the payload sequence, the correctly targeted cells are administered to the subject (autologous therapy).

[0171] Example

[0172] The following examples are for illustrative purposes only and do not limit the claimed invention.

[0173] Example 1.

[0174] This embodiment provides a representative method for producing template RNA containing modified uridine.

[0175] Plasmid DNA for in vitro transcription (IVT) to produce template RNA was completely digested using restriction enzymes BbsI-HF and PvuI. The linearized plasmid was purified by extraction with phenol-chloroform-isoamyl alcohol (PCI) and quantified using Nanodrop. In vitro transcription was performed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, cat#E2040) in the presence of the recommended amounts of T7 RNA polymerase premix, the appropriate reaction buffer, 50 ng / µl of linearized plasmid DNA, 10 mM of ATP, GTP, CTP, and the corresponding modified UTP. The reaction mixture was incubated at 37°C for 2 hours, followed by DNase treatment to remove the DNA template. For each 20 µl IVT reaction, 2 µl of DNase I (NEB, cat#M0303S), 10 µl of 10x DNase buffer, and 68 µl of nuclease-free water were added to a final volume of 100 µl. The mixture was incubated at 37°C for 3 hours.

[0176] The obtained RNA transcripts were purified using Oligo(d)T25 magnetic beads (NEB Cat#S1419S). 5 mg of beads were used for each 20 μL IVT reaction. The beads were equilibrated by washing three times with 250 μL of 1x wash buffer (20 mM Tris-HCl, pH 7.5, 500 mM LiCl, and 1 mM EDTA). The DNase-treated RNA was mixed 1:1 (v:v) with 2x binding buffer (0.1% Triton X-100 in 2x wash buffer) and pipetteted to the corresponding number of equilibrated beads. The mixture was incubated at 37°C for 5 min, then at room temperature on a vortex mixer for 15 min. The beads were washed three times with 250 μL of 1x wash buffer, and then once with 250 μL of 1x low-salt wash buffer (20 mM Tris-HCl, pH 7.5, 200 mM LiCl, and 1 mM EDTA). RNA was eluted by adding 100 μL of nuclease-free H2O to the beads and incubating at 37°C for 5 minutes.

[0177] 5' triphosphate was removed from RNA transcripts using CIAP (Promega Cat#M2825). 100 μL of eluted dT-purified RNA was mixed with 0.5 μL of CIAO, 30 μL of 5x CIAP buffer, and 19.5 μL of nuclease-free water. The mixture (150 μL) was incubated at 37 °C for 30 min and stopped by adding 6 μL of 10% SDS and 1.5 μL of 0.5 M EDTA. The purified RNA was extracted and precipitated using PCI, then resuspended in nuclease-free H2O to a volume equal to the original input volume of the dT-purified RNA. The resuspended RNA was quantified using Nanodrop and its integrity was checked using Tapestation.

[0178] Example 2.

[0179] This embodiment provides a representative method for transfecting cells using mRNA encoding the nrRT protein and template RNA encoding the GFP reporter gene.

[0180] Prior to transfection, hTERT RPE-1 cells were lifted from 30% to 50% confluence plates using trypsin-EDTA (0.25%) and phenol red (Gibco, 25200056) and seeded into 6-well plates at a density of 500,000 cells per well. Each transfection was repeated. 10 μL of Messenger Max (Invitrogen Lipofectamine MessengerMAX, LMRNA003) was diluted in 250 μL of Opti-MEM and incubated at room temperature for 10 minutes. A total of 5 μg of nrRT mRNA and template RNA were diluted in 250 μL of Opti-MEM at a 1:3 molar ratio. The diluted RNA in Opti-MEM was then mixed with the diluted and incubated Messenger Max and incubated at room temperature for 5 minutes. The resulting mixture was then added to two wells (250 μL each) seeded with 500,000 cells. The transfected cells were placed in an incubator at 37°C and 5% CO2. Cells were imaged on days 1 and 2 post-transfection to assess cell health and transfection efficiency via image analysis. On day 2, cells were washed with 1 mL of 1x PBS and 500 μL of trypsin-EDTA (0.25%) and incubated at 37°C for 3 minutes in a 5% CO2 incubator.

[0181] Example 3

[0182] This embodiment provides a representative method for analyzing the ribozyme cleavage efficiency of template RNA containing uridine modification.

[0183] Following the protocol described in Example 1, a minimized version of the template RNA (HDV_gu6_GFP) containing only the 5' module sequence was generated, with uridine replaced 100% by various modified uridines (see Table 4). After the DNase treatment step, 200 μl of Oligo binding buffer was added to 100 μl of the DNase-treated RNA sample, and then mixed with 800 μl of ethanol (95-100%). Approximately 750 μL of the mixture was transferred to a Zymo-Spin IC column (Zymo, Cat#D4060) in a collection tube and centrifuged. The eluent was discarded. The remaining sample was transferred to a Zymo-Spin IC column and centrifuged at 10,000-16,000 xg. The eluent was discarded. 750 μl of DNA wash buffer was added to the column and centrifuged for 1 minute to ensure complete removal of the wash buffer. The column was carefully transferred to a nuclease-free tube. 15 μl of water was added directly to the column matrix and centrifuged. Quantification was performed using Nanodrop. Purify RNA at 120V with 25 ng per lane on a 10% Criterion TBE-urea polyacrylamide gel (Bio-Rad, Cat#3450089) until bromophenol blue reaches the bottom of the gel. Add SYBR Gold (ThermoFisher, Cat#S11494) diluted 1:10,000 to water and stain the gel by shaking for 10 minutes at room temperature, protected from light. Wash the gel with water before photographing.

[0184] ImageJ's optical density analysis and background subtraction were used to quantify the cutting efficiency. Results ( Figure 4 As shown in Table 2), different uridine substitutions resulted in different ribozyme cleavage efficiencies. Using unmodified uridine achieved near-complete cleavage. Using 5 mU or 5 molU resulted in ribozyme cleavage efficiencies >80%. Conversely, using 5 mC, ΨU, or N1 mΨU resulted in very low, undetectable cleavage products.

[0185] Table 2. Ribozyme cleavage efficiency with different uridine modifications.

[0186] U ΨU N1mΨU 5moU 5meU 5meC Cut 8995 566 0 9780 10047 0 Uncut 195 9190 4450 2056 1128 6913 Total 9190 9756 4450 11836 11175 6913 Cutting efficiency 98％ 6％ 0％ 83％ 90％ 0％

[0187] Using the protocol described in Example 2, the corresponding full-length version of HDV_gu6_GFP template RNA modified with 5 meU or N1 mpU was co-transfected with nrRT (TaGu RT mRNA) into hTERT RPE-1 cells. GFP image analysis was performed on day 2 post-transfection. Template RNA with 5 mU modification resulted in low payload integration, such as a low number of GFP-positive cells and high cytotoxicity. Figure 4 This is reflected in the fact that template RNA modified with N1mpU resulted in a significantly higher number of GFP-positive cells and lower virulence.Figure 5 ).

[0188] A second template RNA, HDV_ac2_GFP, with different uridine modifications was generated using the protocol described in Example 1 and transfected into hTERT RPE-1 cells as described in Example 2 to evaluate the effect of uridine modification on payload expression efficiency and cell health. Results ( Figure 6 The results indicated that both unmodified U and 5mU resulted in a low number of GFP-positive cells and high cytotoxicity. Modification with 5mU resulted in a very low number of GFP-positive cells and low cytotoxicity. Consistent with the HDV_gu6_GFP template RNA, the use of N1mΨU or ΨU resulted in a significantly higher percentage of GFP-positive cells without causing significant cytotoxicity.

[0189] Example 4

[0190] This embodiment describes a junction analysis to assess the integration efficiency of payload sequences at target sites in the genome and to compare the integration efficiency of template RNA with uridine modification.

[0191] gDNA extraction and qPCR

[0192] Transfected cells were washed with PBS, precipitated by centrifugation, and rapidly frozen. Cells were lysed at 56°C for 10 minutes with cell lysis buffer (0.1M EDTA, 0.5% SDS, 10mM Tris-HCl pH 7.5, 0.2 mg / mL RNase A), followed by lysis at 37°C for 1–3 hours. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to the cell lysate, vortexed at maximum speed for 10 seconds, and centrifuged at 21,000 x g for 5 minutes at room temperature. The aqueous layer containing genomic DNA was removed and mixed with an equal volume of 100% isopropanol + 300 mM sodium chloride, and centrifuged at 21,000 x g for 10 minutes to precipitate the genomic DNA. The genomic DNA precipitate was washed with 70% ethanol and centrifuged at 21,000 x g for 5 minutes. The genomic DNA precipitate was air-dried for 5–10 minutes and then resuspended in nuclease-free water. Total genomic DNA was quantified using the 1X DNA HS Quantification Kit (Invitrogen Cat#Q33231) according to the manufacturer's instructions. Quantitative PCR was performed using the NEB Luna Universal One-Step qPCR Kit (NEB Cat#M3003). Each reaction used 5 nanograms of DNA as a template, and each sample was performed in technical duplicates or triplicate. Each reaction used the corresponding forward and reverse primers at a concentration of 0.5 μM. Cycling conditions were: one cycle at 95°C for 5 min, followed by 40 cycles (95°C for 15 s, 60°C for 30 s), and then a melting curve analysis step at 65°C to 95°C. Quantitative analysis was performed as described in the "qPCR Data Analysis" section below.

[0193] Cell-Direct qPCR

[0194] Transfected cells were washed with PBS and frozen in tissue culture plates at -80°C. Cells were lysed at 37°C for 10 min with direct cell lysis buffer (5 mM EDTA, 0.5% SDS, 10 mM Tris-HCl pH 7.5, 40 μg / mL proteinase K). Cell lysates were diluted 1:1 with nuclease-free water, heated at 37°C for 5 min, and then heated at 95°C for 5 min. Cell lysates were further diluted 1:10 with nuclease-free water. Quantitative PCR was performed using the NEB Luna Universal One-Step qPCR Kit (NEB Cat#M3003). Each reaction used 5 μL of diluted cell lysate as template, and each sample was technically replicated or triple-replicated. Each reaction used the corresponding forward and reverse primers at a concentration of 0.5 μM (see Table 3). The cycling conditions were: one cycle at 95°C for 5 min, followed by 40 cycles of (95°C for 15 sec, 60°C for 30 sec), and then melting curve analysis at 65°C to 95°C. Quantitative analysis was performed as described in the "qPCR Data Analysis" section below.

[0195] qPCR data analysis

[0196] Quantification was accomplished by establishing a uniform fluorescence signal across all primer settings and samples and determining at which cycle number the fluorescence signal exceeded a threshold (called the Cq value) for each well. The quantification of the 3' junctions from each sample was normalized to the quantification of Tbp1 (single-copy gene) from the same sample by subtracting the average Cq value of Tbp1 from the average Cq value from the associated junctions. The data was expressed as a "fold of Tbp1" by transforming ΔCq:2(-ΔCq).

[0197] Table 3. Primers used in the junction analysis.

[0198] Primer name / target Sequence (5' to 3') Human Tbp1 forward CCGGAATCCCTATCTTTAGTCC Human Tbp1 reverse TGCTGCCTTTGTTGCTCTTC 3' junction forward AACGCGTCAATACCATCTGAC 3' junction reverse GGAATCTCGTTCATCCATTCATG

[0199] Following the protocol described in Example 3, three different template RNAs containing five different uracil nucleotides (U, 5meU, 5moU, N1mpU, and pU) were transfected into hTERT RPE-1 cells along with TaGu RT mRNA. Cells were collected and genomic DNA was extracted from each sample according to the above protocol. Ligation site analysis based on qPCR was performed according to the above procedure. The results are summarized in Table 4. For each template RNA, the 3' insertion efficiency resulting from using N1mΨU or ΨU was at least 2-5 times higher than that from unmodified U. The other two modifications, 5meU or 5moU, resulted in similar 3' insertion efficiencies.

[0200] Table 4. Comparison of 3' integration efficiency of template RNAs with different U modifications.

[0201]

[0202] Example 5

[0203] This example describes a target site for integrating a payload sequence into the genome that does not require a functional 5' ribozyme in the template RNA.

[0204] Template RNA containing various 5' module sequences (see Table 5) encoding a GFP reporter gene as the payload was generated using the in vitro transcription (IVT) protocol described in Example 1. Urate in the IVT RNA was replaced with N1mΨU. The resulting RNA was co-transfected with TaGu RT mRNA into hTERT RPE-1 cells as described in Example 2. GFP image analysis of the transfected cells is summarized in Table 5. The results show that N1mΨU modification allows integration of the GFP gene into the target site in the genome without requiring the template RNA's 5' module to contain an active ribozyme, a complete ribozyme structure, or any ribozyme sequence.

[0205] Table 5. Summary of the effect of the 5' module of template RNA on gene insertion efficiency

[0206]

[0207] Example 6

[0208] This example describes how the molar ratio of nrRT mRNA to template RNA and / or the amount of total RNA delivered to the target cell affects insertion efficiency.

[0209] Prior to transfection, hTERT RPE-1 cells were lifted from 30% to 50% confluence plates using trypsin-EDTA (0.25%) and phenol red (Gibco, 25200056) and incubated at 37°C with 5% CO2 until the dilution series was completed (no more than 30 minutes). The total amount of Messenger Max (Invitrogen Lipofectamine MessengerMAX, LMRNA003) was diluted in 140 μL (number of wells x 30 μL x number of plates) of Opti-MEM and incubated for 10 minutes. The required total amount of Messenger Max was based on a volume-to-weight ratio of 2 μL Messenger Max to 1 μg RNA. TaGu-RT mRNA and HDV_gu5b-luciferase-n1mpU RNA were mixed at a specific molar ratio (see Table 6) and then diluted in 140 μL of Opti-MEM. The diluted RNA in Opti-MEM was mixed with the diluted Messenger Max and incubated at room temperature for 5 minutes. Serial dilutions were performed in 96-well plates, starting with the highest dose (1.25 μg) and decreasing to the lowest dose (0.01 μg) per molar ratio along the rows. 20,000 cells were then added to each well. Luciferase assays were performed on days 1 and 2 using a Bright-Glo Luciferase assay system (Promega, Cat#E2620). For quantitative fluorometry, Agilent's Cytation 5 with Gen5 software was used, with the following settings: endpoint / kinetic readout type: luminescent fiber; gain: 135; integration time: 1 sec; readout height: 4.50 mm. Platform mixing was achieved by clicking "Shake," selecting the "Linear" shake mode, and setting the duration to "0:04". The intensity of the luminescent signal reflected the expression level of the luciferase protein, which is a result of the integration of the luciferase gene encoded by the template RNA into the genomic site. The results are shown in Table 6. The strongest luminescent signal was observed when the molar ratio of nrRT to template RNA was 1:6 and the total RNA dose was 0.08 μg / well.

[0210] Table 6. The effect of the molar ratio of nrRT to template RNA and the total dose on payload expression.

[0211]

[0212] Table 7. Representative diseases and conditions that can be treated using the methods disclosed herein.

[0213]

[0214]

[0215]

[0216] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or changes will arise from the conception of those skilled in the art, which should be included within the spirit and scope of this application and the appended claims. All publications, serial numbers, patents and patent applications cited herein are hereby incorporated in their entirety for all purposes.

[0217] Informal sequence list:

[0218] Template RNA sequence:

[0219] HDVRZ-28_gu5b_GFP_GeFo full-length template RNA (SEQ ID NO:1):

[0220]

[0221] pp7 sequence (SEQ ID NO:2):

[0222] 5'GGATAACCGCGTATGAGCGGTATCCT.

[0223] HDV_gu5b ribozyme with XbaI at 3' (SEQ ID NO:3):

[0224] 5'GGCGGGAGTAACTATGACTCTCTTAAGGAAAAGAGAATCATAGAACGTCAGCAGCCTCCTCGCGGCCCCGCCGGTAACACAGAGGAACACCCTGTGGCGAATGCTGACGA(TCTAGA)

[0225] Polymerase terminator (SEQ ID NO:4):

[0226] 5'AGGTCGACCAGATGTCCGAGGTCGACCAGTTGTCCG

[0227] LacI binding site (SEQ ID NO:5):

[0228] 5'TGTGGAATTGTGAGCGCTCACAATTCCACA(LacO)

[0229] CBh promoter (SEQ ID NO:6):

[0230] 5’CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGGCGTACG

[0231] Kozak sequence (SEQ ID NO:7): GCCACC

[0232] eGFP ORF (SEQ ID NO:8):

[0233] 5’ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0234] SV40 polyA with HindIII site at 5’ (SEQ ID NO:9)

[0235] 5’(AAGCTT)GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTGTGGAATTGTGAGCGCTCACAATTCCACA

[0236] GeFo 3' UTR with NotI site at 5' (SEQ ID NO:10):

[0237] 5’GCGGCCGCTGA)GGTAGATAATCTTTGTATAGTGGGGGGGGATCTCATGTACCGGGTTTCTTTTATTTGATTTTCAATAAAACAGACGGTAGCTAGGTTCGCAAGGCAGCCACAAGCCAAAGATAGGTAGGGTGCTCATAGTGAGTAGGGACAGTGCCTTTTGATTCACAACGCGTCAATACCATCTGACACGGATACCCTTACCGGACTTGTCATGATCTCCCAGACTTGTCCAAGGTGGACGGGCCACCTTTACTTAACCCGGAAAAGGAACATATATTAATTATATGTGTTCGGAAAA

[0238] r4 and polyA with BbsI site at 3' (SEQ ID NO:11):

[0239] 5’TAGCAAAAAAAAAAAAAAAAAAAAAAAA(GTCTTC)

[0240] G1. Luciferase ORF (SEQ ID NO:12):

[0241]

[0242] 5' module:

[0243] TriCasA (bold sequence is pp7 sequence) (SEQ ID NO:13):

[0244] 5’GGAGACGGTCAACCGCGTAGGAGCGGTGACCGGAATTCGGCGGGAGTAACTATGACTCTCTTAAGGAGTCATAGAGCCAGAACCTCCTCGTGGTCCCGCTGGGCACAGGGATTAATTTTTCTGTGGCAAATTTGACTGGCTTCAGAGAGCGTTTTTCGAAGTGGACTGTGTGACTGCGTTCCCCCCTTAGTTGCTATATCCGCTTCGATTAACATCTCACCTCGACGTATAAGATCATT

[0245] HDV_ac2 (SEQ ID NO:14):

[0246] 5’GGAGAACCGCGTAGGAGCGGTCTCCTGGCGGGAGTAACTATGACTCTCTTAAAAAAGAGAATCATAGAACGTCAGCAGCCCCCTCACGGCCCCGCCGGTAACACAGAGGAACACCCTGTGGCGAATGCTGACGA

[0247] HDV_gu1 (SEQ ID NO:15):

[0248] 5’GGAGAACCGCGTAGGAGCGGTCTCCTGGCGGGAGTAACTATGACTCTCTTAAAAAAGAGAATCATAGAACGTCAGCAGCCTCCTCGCGGCCCCGCCGGTAAGATTCCGAAAGGAATCGCGAATGCTGACGA

[0249] HDV_gu5b (SEQ ID NO:16):

[0250] 5’GGAGAACCGCGTAGGAGCGGTCTCCTGGCGGGAGTAACTATGACTCTCTTAAGGAAAAGAGAATCATAGAACGTCAGCAGCCTCCTCGCGGCCCCGCCGGTAACACAGAGGAACACCCTGTGGCGAATGCTGACGA

[0251] HDV_L8_gu6(SEQ ID NO:17):

[0252] 5’GGTAAACGGCGGGAGTAACTATGACTCTCTTAAAAAAGAGAATCATAGAACGTCAGCGGCCTCCACGCGGCCCCGCCGGAACGCAGAGGAACACCCTGCGGCGAACGCTGACGC

[0253] HDV_gu6(SEQ ID NO:18):

[0254] 5’GGATAACCGCGTATGAGCGGTATCCTGGCGGGAGTAACTATGACTCTCTTAAAAAAGAGAATCATAGAACGTCAGCGGCCTCCACGCGGCCCCGCCGGAACGCAGAGGAACACCCTGCGGCGAACGCTGACGA

[0255] HDV_gu5b_CatDead(SEQ ID NO:19):

[0256] 5’GGCGGGAGTAACTATGACTCTCTTAAGGAAAAGAGAATCATAGAACGTCAGCAGCCTCCTCGCGGCCCCGCCGGTAACACAGAGGAACACCCTGTGGAGAATGCTGACGA

[0257] HDV_gu5b_NP2(SEQ ID NO:20):

[0258] 5’GGAAAAGAGAATCATAGAACGTCAGCAGCCTCCTCGCGGCCCCGCCGGTAACACAGAGGAACACCCTGTGGCGAA

[0259] SL28(SEQ ID NO:21):

[0260] 5’GGCGGGAGTAACTATGACTCTCTTAACAAAGAGAGAATAGTAACTCCCG

[0261] 28NoRZ(SEQ ID NO:22):

[0262] 5’GGCGGGAGTAACTATGACTCTCTTAA

[0263] TaGu Native Ribozyme (Zebra Finch) (SEQ ID NO:23):

[0264] 5’GGCGGGAGTAACTATGACTCTCTTAAGGGTCTAGTTACAACTGGGCATCGCTGCAGAGATCGCACCTCCTCGTGGTCCCGCTGGTAGCCCTTCGAAGGGTGACTAAGTCGATCTCTGCCCCAGGTACGGAGCCGTTGGGACTCACCAGTCCAACGTAACTCCTGCCTAAATTCGGTGAAACAAATTCCTCGGTAAAAAGCCCCATGGCTTCTTGCCCGAAACCTGGCCCCCCGGTTTCAGCAGGGGCAATGAGTTTGGAAAGTGGACTGACCACCCACTCCGTTCTCGCCATCGAACGTGGTCCCAATTCGTTGGCAAATTCCGGATCAGACTTTGGGGGGGGGGGTCTGGGGCTACCGTTACGCCTATTGAGGGTATCGGTCGGCACTCAGACCTCCCGCTCCGACTGGGTAGACCTGGTGTCCTGGAGCCACCCAGGACCCACGTCTAAGTCCCAGCAGGTTGACCTGGTGTCTTTATTTCCTAAACACCGGGTTGACCTGTTATCCAAAAACGACCAGGTAGACCTGGTGGCTCAATTTTTACCATCTAAATTTCCCCCCAATTTGGCAGAAAATGATTTGGCTTTGCTGGTGAACTTAGAGTTCTACAGATCGGATTTGCATGTGTATGAGTGTGTTCATTTTGCTGCACATTGGGAGGGATTAAGTGGTTTGCCTGAGGTGTATGAACAACTTGCACCACAACCGTGTGTGGGAGAAACTTTACATTCTAGCCTCCCACGAGACAGTGAACTGTTTGTGCCTGAAGAGGGGAGCAGCGAGAAGGAGAGCGAGGACGCGCCAAAAACATCTCCTCCGACGCCTGGGAAACATGGTTTGGAACAGACTGGGGAGGAAAAAGTG

[0265] TiGu Native Ribozyme (Diphtheria )(SEQ ID NO:24):

[0266] 5’GGCGGGAGTAACTATGACTCTCTTAACTGGGGACCGTGGTTACAACCCGGGCTTAGCTGCAGAGACAGTACCTCCCCGTGGTTCCCGCCGGACCCCGTAACATCGGGTGACTGAATCTGTCTCTGCCCCGGGAGTAGTTCCTCCTTGCCCTATTGACCAGCGGTCGCCGGCTGCTCAATAGTATTCTAGGCGTGAAATATAGCGATAGTCCTAGTGGTTGTCTTACTGGGCCATAGCCCCTTGCTTCAGGGGTCATTCGCGAAGTCTCTCAGGAGAACTGGGGGTGGTGTTCTTCTGGGTATAGCTAAACCCCCTAGACTGTGTCCGATCCATGGGGTCCTGGATCGTGAATTTCGTTTCGGTGGCGACTCAGACGGGAGAATTCCCTGTGGATACGGCCAGGAGGGCACCTGTGCCGGTAACATCATACCCTGAGTCGGAATGCCACATACCGTTGCCCCTGACATTTTGTAACTCGGATGTGACTATTTGGGGAGGGGTTCGCCCTGAACCGGTGGACTGCTTGGGTGATCTTCCAGAGGTGTATGATGCACTCCCAGGGGTGGCTGGGCCTCGGGAATCGGTGGGTGGGAGCCCGCCGGGAGAAGGGGTCAGGTCGCCAGGGATTGCGTCACCCTCTGGTACTGCGGTCCAACATGATTTTGGGAGTCCCATCCTCGTACCGG

[0267] ZoAl Natural Ribozyme (White-crowned Sparrow) (SEQ ID NO:25):

[0268] 5’GGCGGGAGTAACTATGACTCTCTTAAGGCGACTTGAGAAGGTCTGGTTACAACTGGGCATAGCTGCAGAGATCGCGCCTCCTCGTGGCCCCGCTGGTAAGCCCTTAACAGGGTGACTAAGTCGATCTCTGCCCCAGTCCAGGAGCCGCTGGGTTTCACCAGCCCAGCGATTCCTTCCAAATTCGGTGAAACAAATTCCTCGGTAAAAGCCGCGTGGCTTATTGCCTGAAACCTGGCCCCCCGGTTTCAGACAGGGGCAAAGAGTTCGGAAGTGGACTGACCACCCACCCCGAACCCGAGAGCGAATCTGGTCATGACCCAACTGTCCCAAATCCTGGTCCGTCTCTTGGAGCGGGGGAAGGTGCACAGCCACTACCCTTACTCAGGGTATCGGTGGGCACCCAAACCTGTGAAGAGGACTTTATAACATCTAGACCAACCAAATTACCCGGAATTGAATCAGAATTAGGCCCGCTGGTGAAGTTTTCTTTAGAGGTTTACAGGTCAGATCTTAAGGGGGATGTGCAATTTGAGGGGATTCATTTTCCAGATAATTGGGGGGTACTGGAGGGGTTTCCTGAGGTGTACGAACAACTGGCACCACAGCCAAACGGGGGAGACGAGTTAAATCATAGTCTCCCAGGGGACAGGGAGGGGGATGTACTTGAGAAGGATAGCAGCGAAAAGGAGAAGGAGGCTGCACCAGAGGCATTGCCCTCAGTGCAAAGGGCCCGCAGTGAACAGTTGCC

[0269] III. 3’ module:

[0270] GeFo 3’ UTR (Medium Ground Finch) (SEQ ID NO:26):

[0271] 5’GGTAGATAATCTTTGTATAGTGGGGGGGGATCTCATGTACCGGGTTTCTTTTATTTGATTTTCAATAAAACAGACGGTAGCTAGGTTCGCAAGGCAGCCACAAGCCAAAGATAGGTAGGGTGCTCATAGTGAGTAGGGACAGTGCCTTTTGATTCACAACGCGTCAATACCATCTGACACGGATACCCTTACCGGACTTGTCATGATCTCCCAGACTTGTCCAAGGTGGACGGGCCACCTTTACTTAACCCGGAAAAGGAACATATATTAATTATATGTGTTCGGAAAA

[0272] ZoAl 3' UTR (White-throated Sparrow) (SEQ ID NO:27):

[0273] 5’TAGGTAGTCACATTGCACTTTCTGTAACTTGCACTGGGTGTGGGATGTGGGCCTGGGGTGTGGGTTATGGGGTATATATGTGGGATATTCTGGTGGGAATGTCCATTCACTGTATGCCTATCTTTTTAATAAAAAGACGGTAGCTAGGTTCGCGAAGCAGCCACAAGCCAATAGCCAGTTAGGTAGCTCATAGTGGGTAGGTGACAGGAACCTTTGACTCAGAACGCGTCCATTAACATCTAGAACGGACCAAACTTCGGACATGCACCGATTAACCGGATTTGTCCAAGGTGGACGGGCCACCTTTACTTAACCCGGAAAGGGAACATATATAGTTATATGTGTTCGTAATA

[0274] TaGu 3' UTR (Zebra Finch) (SEQ ID NO:28):

[0275] 5’TAATTCAGGTTATTTAGATGCTTAGTTTTTGTACCTTTCTTGTTTTGTTTAGGATTTTGATAGTGTTAGTATTTTTATATTTTTGTACGATTGCATAATGTTCTTTTTTATACAGTTCTGTTTTAATAAAATAGACGATAGCTAGAGACGTTAGGGCAGCCACAAGCCAGTTAGGTAGCGGATAGTAGGTAGGAACAGACTTTTACTATTTCATAACGCGTCAATTACCACCTGATTTGGACCAATTCACGGGATTTGTCCAAGGTGGACGGGCCACCTTTACTTAACCCGGAAAAGGAACATATATAATTTATGTGTGTTCGAT AAA

[0276] TiGu_3’UTR (Diphtheria )(SEQ ID NO:29):

[0277] 5’TAGGGGGCTTGGCATTTCTCATTGCCTGCTCCTGAAAGGATATGGGTCCTGCGTCGCGTGGTAGGCAGACCCATTCGTCCGAGTAGGGGGCTTGGCAGTNTCCATTGCCTGTGCCCGAAAGGACGTGGGTCATCTGGTCTGTCTGCCTACACCTCTCTAGACTTGTAACATCTAGTCTGTCAACAAGATCAAAATTCTTCACACAGACGACCGAGCTTGCTCAGTCTTCCTGTACCCGCAGAATTTTGCTCTTGCTCTCCTTTGGCTGTGTCCTGGACGTGGGACTATTCCATCTCGTCCCAAATGCCGCGTCCAATTATACCGGATTTGACAAAGCGGACGGCCCGCTTTATAAGCCGGAAAAGGTGCCTTGTAAAATTGCAAGGTTCATTAAATAG

[0278] BoMo 3’UTR (Bombyx mori)(SEQ ID NO:30):

[0279] 5’TGAGCCTTGCACAGTAGTCCAGCGGTAAGGGTGTAGATCAGGCCCGTCTGTTTCTCCCCCGGAGCTCGCTCCCTTGGCTTCCCTTATATATTTTAACATCAGAAACAGACATTAAACATCTACTGATCCAATTTCGCCGGCGTACGGCCACGATCGGGAGGGTGGGAATCTCGGGGGTCTTCCGATCCTAATCCATGATGATTACGACCTGAGTCACTAAAGACGATGGCATGATGATCCGGCGATGAAAA

[0280] OrLa 3’UTR (Medaka) (SEQ ID NO:31):

[0281] 5’TGAGGGGGACAGCTGGGAGTCTCGGCATGATTACAAATCTTGCGCTGCACTCGGATGTCGTCCCCGTGACGGACACATTAATCCGGAAAGCGAGTGGTGACTCGCCTCAAG

[0282] TriCasB 3’UTR (Red flour beetle) (SEQ ID NO:32):

[0283] 5’TAAAATCTCCTGACCAACTAGCTCACTGACTAATTTTAAACTGTCCTGTCTTACTTGTTTTACACGTGCTCTGTGGCGGGGCCATTTACACCCCGTCGCAACACAACCTGTAAATACTTGTGTATGTCTGTTTATGTCCTAATTTATTATTTTAAACAGATCTTGGCCATGGTCTCGGCCAACCAATTAAAGTCAGTGATGCGAGTCGCAATGCGGAGCAAGAGACCTAGGCGTGTATTTATTGCTGGCATGCGGCGCCGGAGCCGGTCATCTGCTATGGGGAGCAATGGCCGGGCGGATACCTCCACGTGGTTCCCTGTGGGTGGCCCGTCGAGGACGGTAACCAGCGAAACTCCGTAAAGTCCTTCTTACGAGAAGGAACTCCGGTTAAAGATTTTTCCAAGCCTGTACACGTGATTCCCTTGGAACAAGCAAAGTGTGGTTCCCTCGAGAGGGCCCAGGTCAGGAGTTCGCAATAGTGGGCTGCAAGAGTTCATGCTGGGCTACAGTGTCAGGACGAAGAGTGGGTAGTGATCGCAAAATCACGTGAATAGCTACCCCCCGCCTGGCACCACTAGACAACAACAAGGGGTACGACAGCTCTTCTGTCGAAAGTTCGGGCGCACACCCGTAAAAGG

[0284] DroSi 3’UTR (Drosophila simulans) (SEQ ID NO:33):

[0285] 5’TAGCTAAAACGTTTGGTTCAAAACATTTGCTTGCTGTCTTGGCATAACATCAATAAAGGCATAAACATCGCAAAATAATGGTTATATATAAATGGCTATGAGGATGGTTTTAGTACGTAGGCGTTGCGGAACTTCGGTTCAGATAGAGCAATGAATCGTGCATGCTAGGAAAACTGACCACACGCAGTGTTGGCAGCCCTAGTATCTTTCGATAGATTTCCATACCTCCGCGATCAAAAAAAA AAAAAAAAAAAAAAA

[0286] Pupu 3’UTR (Stickleback) (SEQ ID NO:34):

[0287] 5’TAGGGTTCCTCCACCCTCCGGCTGACGAACAGCTGGTAAACGGGGGGGCGGTGGGGTGCCTCTCCAGCCGACTGATACAGGAGTAAGGGACGGTGGGGTCGCATCCAGGAAGCGCAGCACCGCGATGCCGAAACTGATGTGCAGTATAACACAGAAAGCCTAAAGGGCCAAAAG

[0288] Lipo 3’UTR (Horseshoe Crab) (SEQ ID NO:35):

[0289] 5’TAAATTTTGTCTCTTTCCCCAATGATGTCTACTAGCACGCTGCCGAAGCTAGATAGATTGAGGAATCTGCGTAATCTGTAATGATTACGCCTCATGGGCATCTATCGGTAGCGTCGACCCTGACGTTAAATTGGGTAATAAGAAATAT

[0290] Navi 3’UTR (Nasonia vitripennis) (SEQ ID NO:36):

[0291] 5’TGACCTGAACAAAACGTGTTGTCTTGTCTTGTCTAAAACTATTTATTCGAAATAAGGGGAGGCTAACTGCCTGCAAGTTGAACGCGAAAGTTAGACCTTCCCACCTAAAGCCCAAAAGTGATCGGGGAATGAATCCGCGGGTGACCCCAGAGTTGGGTAAACCCTTGAAACGTTGGAGAAGCGGAAGAGAGTCCCGCCACCGAGCATCGAGTGCTGCGGCGCCCGAATGAAACCGATCGCGGATGGTGCAAGTCGTAGGACGGGGCACGACCTAAGCCTCTGTCACGGCGGCGAAGCCAGGAATCACCATGCAAAGGTGTGAACTGGGGCGGATACCTCCACGGGGTTTCCCTGGGCATCGCGCGAGCGATGGCCAAAGTCCGCTTTCTCAGCTACAAAACAAAAATGGTATGAGACTTCGTTAACACTAATTTTTCCGAGCCTAGCAGGCTCCCTTGACAACGCTTATGAATCTGGAAAAGGACACAAAGTGGAAAAAGCGCTGATGGTGGACAAAAGTCAGTTGAGACTTGATATCAGTTGTTTTGACTAAGAATTTTATTATCGTTGACTTTTAAATATTTTATTATTGACTGTTAATATACTGACTTGGGACCAAGTCATCTCTGTTACCCGGTACCGGTTCCTGTCATCAAACCGGAAAGTCCGTCCCACGTAATGTGGTAGACGCAGGAG

[0292] GaAc 3’UTR (stickleback) (SEQ ID NO:37):

[0293]

[0294] DrMe 3'UTR (Drosophila melanogaster) (SEQ ID NO:38):

[0295] 5’TAGCTAAATCGTTTGGTTCAAAACATTTGCTTGCTGTCTTGGCATAACATCAATAAAGGCATAAACATCGCAAAATAATGGTTATAATTAAATGGCTATGAGGATGGTTTTAGTACGTAGGCGTTGCGGAACTTCGGTTCATATAGAGCAATGAATCGTGCATGCTAGGAAAACTGACCACACACAGTGTTGGCAGACCTAGTATCTTTCGAAGATTTCCATACCTCCGCGATCAAAAAAAAAAAAAAAAAAAAAA

[0296] AdVa 3'UTR (Drosophila melanogaster) (SEQ ID NO:39):

[0297] 5’TGAACTAGTCTCCTTCTTCTATTAGTCAGTCTAATTAATTTTTCTTACATTCTACATCTAGTTCCATTATTAAATTGGTATGATCAGTGCTATCTCTGCTACACTCAATGCTTAATCGTATGTTATTGACAGTCTGACACTTGATTACTCTTACGACATATGCACTGTTTGCTTCAGAGAAACCACTGTTCATATAGTGAAGTTCCTCAGTTTTCTGTTGATATATTCTTCTTTCATTCTCGCTTCTCCTTTTCTACTGTGTTCTTTTTATCAGTTTTTTGTGGAAAAATTGAGAATAAATAAAGT

Claims

1. A method for inserting heteropolynucleotides at a target site in a eukaryotic genome, the method comprising: Transfect eukaryotic cells with the following substances: (a) RNA encoding a non-LTR reverse transcriptase protein (nrRT) containing both a reverse transcriptase domain and a nuclease domain; and (b) Template RNA; The template RNA comprises a promoter, a payload sequence, a polyA sequence, and an nrRT binding sequence. The template RNA comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof, or The template RNA comprises a mixture containing unmodified uridine and one or more modified uridines selected from N1mΨU, ΨU, 5meU and 5moU; The template RNA containing modified uridine cannot be cleaved by ribozymes, and The nrRT is expressed in the cell and catalyzes the insertion of a double-stranded heteropolynucleotide containing the payload sequence into the target site in the eukaryotic genome.

2. The method of claim 1, wherein the template RNA containing modified U increases the insertion efficiency of the payload sequence into the eukaryotic genome compared to the template RNA containing unmodified U.

3. The method according to claim 2, wherein the template RNA further comprises a 5' ribozyme sequence selected from active ribozymes, partially active ribozymes, ribozymes with reduced catalytic activity, or ribozymes without catalytic activity.

4. The method according to claim 3, wherein the 5' ribozyme is selected from HDV ribozyme, TriCasA ribozyme or its natural homologous ribozyme, semi-homologous ribozyme or variant.

5. The method according to claim 3, wherein the 5' ribozyme sequence comprises a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence), or a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:3 or 13-22 (without pp7 binding sequence).

6. The method according to claim 1, wherein the template RNA does not contain a functional 5' ribozyme sequence or does not contain a 5' ribozyme sequence.

7. The method of claim 1, wherein cytotoxicity is reduced when the template RNA contains modified U.

8. The method of claim 1, wherein the template RNA further comprises a 5' sequence protecting the 5' end from degradation.

9. The method of claim 1, wherein the template RNA further comprises a 5' sequence that facilitates the specific insertion of the heteropolynucleotide site into a target site in the eukaryotic genome.

10. The method of claim 1, wherein the nrRT binding sequence comprises a 3'UTR sequence.

11. The method of claim 10, wherein the 3'UTR sequence is isolated from an organism selected from: three-spined stickleback, fruit fly, horseshoe crab, nine-spined stickleback, golden fly larvae, ground finch, medaka, white-throated bunting, zebra finch, red flour beetle, and white-throated... Fruit fly, silkworm and A. vaga.

12. The method of claim 11, wherein the 3'UTR comprises a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:26-39.

13. The method of claim 1, wherein the template RNA further comprises a 3' sequence that promotes the specific insertion of the heteropolynucleotide site into the eukaryotic genome and / or enhances the efficiency and fidelity of target-induced reverse transcription.

14. The method of claim 1, wherein the template RNA further comprises one or more of the following: i) an RNA polymerase terminator, ii) a sequence that can be purified, iii) a sequence encoding a protein that can be enriched, iv) a Kozak sequence of the payload sequence 5' and / or v) a polyA sequence located at the nrRT binding sequence 3'.

15. The method of claim 1, wherein the template RNA further comprises: (a) A 5' sequence homologous to the DNA sequence at the target insertion site 5' in the said eukaryotic genome; or (b) A 3' sequence homologous to the DNA sequence at the target insertion site 3' in the said eukaryotic genome; or Both (a) and (b).

16. The method of claim 1, wherein the payload sequence encodes i) a therapeutic protein that replaces or supplements a defective gene or protein, or ii) an inhibitor of another protein.

17. The method of claim 16, wherein the therapeutic protein is selected from factor VIII, factor IX, and phenylalanine hydroxylase (PAH).

18. The method of claim 16, wherein the inhibitor is a single-chain antibody.

19. The method of claim 1, wherein the payload sequence encodes a regulatory RNA.

20. The method of claim 1, wherein the payload sequence encodes a protein selected from the genes in Table 7.

21. The method of claim 1, wherein adjusting i) the molar ratio of the nrRT mRNA to the template RNA and / or ii) the amount of total RNA delivered to the target cells increases the insertion efficiency.

22. The method of claim 1, wherein the template RNA is deficient in 5' phosphate.

23. The method of claim 1, wherein the RNA encoding the nrRT comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof, or A mixture containing unmodified U and modified U selected from N1mΨU, ΨU, 5meU and 5moU.

24. The method of claim 1, wherein the eukaryotic cells are transfected in vitro.

25. The method of claim 1, wherein the eukaryotic cells are transfected in vivo.

26. The method of claim 1, wherein the eukaryotic cell is a mammalian cell.

27. The method of claim 1, wherein the eukaryotic cell is a human cell.

28. The method of claim 27, wherein the human cell is removed from the human subject, transfected with the RNA of (a) and (b) to insert the heteropolynucleotide into the genome of the human cell, and applied to the human subject.

29. The method according to any one of claims 24 to 28, wherein the cells are transfected with an LNP preparation, a lipid transfection reagent, or by electroporation.

30. A composition comprising: (a) RNA encoding a non-LTR reverse transcriptase protein (nrRT) containing both a reverse transcriptase domain and a nuclease domain; and (b) Template RNA; The template RNA comprises a promoter, a payload sequence, a polyA sequence, and an nrRT binding sequence. The template RNA comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof, or The template RNA comprises a mixture containing unmodified uridine and one or more modified uridines selected from N1mΨU, ΨU, 5meU and 5moU; The template RNA containing modified uridine cannot be cleaved by ribozymes.

31. The composition of claim 30, wherein the template RNA further comprises a 5' ribozyme sequence selected from active ribozymes, partially active ribozymes, ribozymes with reduced catalytic activity, or ribozymes without catalytic activity.

32. The composition according to claim 31, wherein the 5' ribozyme is selected from HDV ribozyme, TriCasA ribozyme or its natural homologous ribozyme, semi-homologous ribozyme or variant.

33. The composition of claim 31, wherein the 5' ribozyme sequence comprises a sequence selected from any one of SEQ ID NO:3 or 13 to 22 (without pp7 binding sequence), or a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:3 or 13-22 (without pp7 binding sequence).

34. The composition of claim 30, wherein the template RNA does not contain a functional 5' ribozyme sequence or does not contain a 5' ribozyme sequence.

35. The composition of claim 30, wherein the template RNA further comprises a 5' sequence protecting the 5' end from degradation.

36. The composition of claim 30, wherein the template RNA further comprises a 5' sequence that facilitates the specific insertion of the heteropolynucleotide site into a target site in the eukaryotic genome.

37. The composition of claim 30, wherein the nrRT binding sequence comprises a 3'UTR sequence.

38. The composition according to claim 38, wherein the 3'UTR sequence is isolated from an organism selected from: three-spined stickleback, fruit fly, horseshoe crab, nine-spined stickleback, golden fly larvae, ground finch, medaka, white-throated bunting, zebra finch, red flour beetle, and white-throated... Fruit fly, silkworm and A. vaga.

39. The composition of claim 38, wherein the 3'UTR comprises a sequence having greater than or equal to 60% sequence identity (e.g., greater than or equal to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence selected from any one of SEQ ID NO:26-39.

40. The composition of claim 30, wherein the template RNA further comprises a 3' sequence that promotes the specific insertion of the heteropolynucleotide site into the eukaryotic genome and / or enhances the efficiency and fidelity of target-induced reverse transcription.

41. The composition of claim 30, wherein the template RNA further comprises one or more of the following: i) an RNA polymerase terminator, ii) a sequence that can be purified, iii) a sequence encoding a protein that can be enriched, iv) a Kozak sequence at the 5' of the payload sequence, and / or v) a polyA sequence located at the 3' of the nrRT binding sequence.

42. The composition of claim 30, wherein the template RNA further comprises: (a) A 5' sequence homologous to the DNA sequence at the target insertion site 5' in the said eukaryotic genome; or (b) A 3' sequence homologous to the DNA sequence at the target insertion site 3' in the said eukaryotic genome; or Both (a) and (b).

43. The composition of claim 30, wherein the payload sequence encodes i) a therapeutic protein that replaces or complements a defective gene or protein, or ii) an inhibitor of another protein.

44. The composition of claim 43, wherein the therapeutic protein is selected from factor VIII, factor IX and phenylalanine hydroxylase (PAH).

45. The composition of claim 43, wherein the inhibitor is a single-chain antibody.

46. ​​The composition of claim 30, wherein the payload sequence encodes regulatory RNA.

47. The composition of claim 30, wherein the payload sequence encodes a protein selected from the genes in Table 7.

48. The composition of claim 30, wherein the template RNA is deficient in 5' phosphate.

49. The composition of claim 30, wherein the RNA encoding the nrRT comprises one or more modified uridine (U) nucleosides selected from N1-methyl-pseudouridine (N1mΨU), pseudouridine (ΨU), 5-methyluridine (5meU), 5-methoxyuridine (5moU), and mixtures thereof, or A mixture containing unmodified U and modified U selected from N1mΨU, ΨU, 5meU and 5moU.

50. A pharmaceutical composition comprising the composition according to any one of claims 30 to 49.

51. The pharmaceutical composition of claim 50, wherein the composition is formulated into a lipid nanoparticle selected from liposomes or lipid nanoparticles (LNPs).

52. The pharmaceutical composition according to claim 50 or 51, further comprising a pharmaceutically acceptable excipient or salt.

53. A method of treating a disease or condition in a subject, comprising administering to the subject an effective amount of the pharmaceutical composition according to any one of claims 50 to 52.

54. The method of claim 53, wherein the disease or condition is selected from sickle cell anemia, severe combined immunodeficiency (ADA-SCID / X-SCID), cystic fibrosis, hemophilia, Duchenne muscular dystrophy, Huntington's disease, Parkinson's disease, hypercholesterolemia, α-1 antitrypsin, chronic granulomatous disease, Fanconi anemia, and Gaucher disease.

55. The method of claim 53, wherein the disease or condition is selected from Table 7.

Images