Ad4-55 / Ad7-3 type tetravalent recombinant adenovirus vaccine and application thereof

Abstract

The invention discloses an Ad4-55 / Ad7-3 type tetravalent recombinant adenovirus vaccine and an application of the Ad4-55 / Ad7-3 type tetravalent recombinant adenovirus vaccine. The preparation method comprises the following steps: replacing a fifth hypervariable region of an HAdV-4 hexon in an HAdV-4 genome with a second hypervariable region of an HAdV-55 hexon to obtain a recombinant adenovirus Ad4-55; and replacing the first hypervariable region of the HAdV-7 hexon in the HAdV-7 genome with the first hypervariable region of the HAdV-3 hexon, so as to obtain the recombinant adenovirus Ad7-3. And mixing the recombinant adenovirus Ad4-55 and the recombinant adenovirus Ad7-3 to obtain the tetravalent recombinant adenovirus vaccine. Experiments prove that when the tetravalent recombinant adenovirus vaccine prepared by the invention is used for immunizing mice, high-level specific IgG antibodies and neutralizing antibodies can be induced. According to the present invention, the important application value is provided for the prevention and control of HAdV-3, HAdV-7, HAdV-4 and HAdV-55.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to a type 4 Ad4-55 / Ad7-3 tetravalent recombinant adenovirus vaccine and application thereof. BACKGROUND

[0002] Human adenovirus (HAdV) is a non-enveloped icosahedral double-stranded DNA virus with a genome length of more than 30 kb, encoding more than 40 proteins; its icosahedral capsid is composed of three major structural proteins hexon, penton, and fiber, and four minor structural proteins (IIIa, VI, VIII, and IX). All these proteins can be targeted by neutralizing antibodies (NAbs) induced by natural infection or immunization. Since the first HAdV was isolated from adenoid tissue in 1953, as of October 2024, HAdV has been classified into 116 genetic subtypes. According to serology and phylogenomics, it is divided into seven types A to G. Among them, the members of the B group are further divided into two subgroups, B1 (types 3, 7, 16, 21, and 50, etc.) and B2 (types 11, 14, 34, and 35, etc.). HAdV-55 is classified as a B2 subgroup, which is derived from the hexon gene rearrangement between HAdV-11 and HAdV-14.

[0003] Adenoviruses have high species specificity, but they commonly infect all vertebrates, including humans, other mammals, birds, reptiles, and fish. HAdV can infect humans through multiple routes, including respiratory droplets, fecal-oral route, and contact with contaminated food, water, or surfaces, invasion of organs such as bladder, liver, or brain, and infection through ocular mucosa. HAdV infection is very common, and almost all individuals are infected with at least one type of adenovirus. A large number of studies on the seroprevalence of HAdV-1 to HAdV-33 found that 74.6% of the population were positive for at least one adenovirus. Depending on a person's age, immune status, and population factors, the signs and symptoms of adenovirus infection can vary. HAdV infection can cause fever, cough, pneumonia, and even death, posing a serious threat to human health.

[0004] Different HAdV species are associated with different types of disease, and genetic recombination of different HAdV capsid genes can lead to changes in tissue tropism and symptom characteristics. Different types of adenovirus have unique clinical manifestations due to their tissue tropism. Since 1969, extensive epidemiological investigations have been conducted on various adenoviruses. The pathogenic characteristics and respiratory infection symptoms caused by different adenovirus serotypes have been identified. Species A (such as HAdV-12, HAdV-31), mainly cause gastrointestinal infections. The original B1 virus (such as HAdV-3, HAdV-7, HAdV-14 and HAdV-55), mainly causes respiratory tract infections, which can cause severe bronchial inflammation and pneumonia. And the original B2 virus, except HAdV-14, is associated with kidney and urinary tract infections. Species C (such as HAdV-1 and HAdV-2), mainly cause respiratory and gastrointestinal infections. Species D and E (such as HAdV-8 and HAdV-4), can cause conjunctivitis and respiratory tract infections. Species F (such as HAdV-40 and HAdV-41) and G (such as HAdV-52) can cause gastrointestinal inflammation. Among them, the main pathogenic serotypes of species B and E adenovirus are HAdV-3, HAdV-4, HAdV-7, HAdV-11, HAdV-14 and HAdV-55.

[0005] Among all human HAdVs, HAdV-4 and HAdV-7 are identified as the main cause of repeated outbreaks of acute respiratory disease and pneumonia in recruits of all military branches (army, navy, air force and marines). Among B species HAdVs, HAdV-3 and HAdV-7 have been found in global epidemics. HAdV-3 and HAdV-7 are widespread in children and can cause acute respiratory infections. HAdV-55 is one of the most important serotypes that cause severe acute respiratory infections in many countries around the world. Compared with other adenovirus genotypes, HAdV-55 induces more obvious symptoms of pneumonia. This enhanced virulence seems to be more complexly related to the specific tropism of HAdV-55 to airway and alveolar stem cells, plus its enhanced affinity to the cell receptor of fibrin, leading to its increased infectivity. While HAdV-55 often occurs in adults and causes severe pneumonia. Therefore, HAdV-55 can spread widely and cause a catastrophic epidemic.

[0006] The treatment of HAdV infection is mainly symptomatic treatment, and there is no effective specific drug for HAdV, which affects the prevention and treatment of HAdV infection. Vaccination is one of the most effective means to prevent diseases. Since there are many types of HAdV, developing a broad-spectrum vaccine against HAdV is an important research goal. At present, there is no HAdV vaccine available to the public. Since there are many types of HAdV B, and HAdV-4 of E type is the first HAdV discovered with zoonotic origin. Developing a multivalent vaccine against HAdV-3, HAdV-7, HAdV-4 and HAdV-55 is still an important goal. SUMMARY

[0007] The purpose of the present application is to prevent diseases caused by HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

[0008] The present application first protects a recombinant virus combination. The recombinant virus combination can include a recombinant adenovirus Ad4-55 and a recombinant adenovirus Ad7-3; the recombinant adenovirus Ad4-55 can express the HAdV-55 hexon second hypervariable region; and the recombinant adenovirus Ad7-3 can express the HAdV-3 hexon first hypervariable region.

[0009] In the recombinant virus combination, the recombinant adenovirus Ad4-55 is a recombinant virus obtained by replacing the amino acid sequence of the HAdV-4 hexon fifth hypervariable region in the HAdV-4 genome with the amino acid sequence of the HAdV-55 hexon second hypervariable region; the amino acid sequence of the HAdV-4 hexon fifth hypervariable region is shown in SEQ ID NO: 3; and the amino acid sequence of the HAdV-55 hexon second hypervariable region is shown in SEQ ID NO: 4.

[0010] In the recombinant virus combination, the recombinant adenovirus Ad7-3 is a recombinant virus obtained by replacing the amino acid sequence of the HAdV-7 hexon first hypervariable region in the HAdV-7 genome with the amino acid sequence of the HAdV-3 hexon first hypervariable region; the amino acid sequence of the HAdV-7 hexon first hypervariable region is shown in SEQ ID NO: 7; and the amino acid sequence of the HAdV-3 hexon first hypervariable region is shown in SEQ ID NO: 8.

[0011] In the recombinant virus combination, the replacing the amino acid sequence of the HAdV-4 hexon fifth hypervariable region in the HAdV-4 genome with the amino acid sequence of the HAdV-55 hexon second hypervariable region is achieved by replacing the gene encoding the HAdV-4 hexon fifth hypervariable region in the HAdV-4 genome with the gene encoding the HAdV-55 hexon second hypervariable region; the nucleotide sequence of the gene encoding the HAdV-4 hexon fifth hypervariable region can be as shown in SEQ ID NO: 1; and the nucleotide sequence of the gene encoding the HAdV-55 hexon second hypervariable region can be as shown in SEQ ID NO: 2.

[0012] In the recombinant virus combination, the replacing the amino acid sequence of the HAdV-7 hexon first hypervariable region in the HAdV-7 genome with the amino acid sequence of the HAdV-3 hexon first hypervariable region is achieved by replacing the gene encoding the HAdV-7 hexon first hypervariable region in the HAdV-7 genome with the gene encoding the HAdV-3 hexon first hypervariable region; the nucleotide sequence of the gene encoding the HAdV-7 hexon first hypervariable region can be as shown in SEQ ID NO: 5; and the nucleotide sequence of the gene encoding the HAdV-3 hexon first hypervariable region can be as shown in SEQ ID NO: 6.

[0013] The recombinant virus combination according to any of the above embodiments can specifically consist of the recombinant adenovirus Ad4-55 and the recombinant adenovirus Ad7-3 according to any of the above embodiments.

[0014] The present application also protects a vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55, which can contain the recombinant virus combination according to any of the above embodiments. Specifically, the vaccine can be used for preventing HAdV-3, HAdV-7, HAdV-4 and HAdV-55, i.e., a tetravalent vaccine, specifically an Ad4-55 / Ad7-3 type tetravalent vaccine.

[0015] The present application also protects a method for increasing the neutralizing antibody titer and / or the specific IgG antibody level in an animal, which can be achieved by injecting the recombinant virus combination according to any of the above embodiments into the animal.

[0016] The use of the recombinant virus combination according to any of the above embodiments in increasing the specific IgG antibody level and / or the neutralizing antibody titer in an animal also belongs to the protection scope of the present application.

[0017] In the use according to any of the above embodiments, the neutralizing antibody can be a neutralizing antibody against HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

[0018] The present application also protects the use of any of the above-mentioned recombinant virus combinations in the preparation of a vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55. In particular, the vaccine can be used for preventing HAdV-3, HAdV-7, HAdV-4 and HAdV-55, i.e. a tetravalent vaccine, in particular an Ad4-55 / Ad7-3 type tetravalent vaccine.

[0019] The present application also protects the use of any of the above-mentioned recombinant virus combinations in reducing the incidence of adenovirus infection.

[0020] In the above-mentioned use, the adenovirus can be HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

[0021] The present application also protects the use of at least one of any of the above-mentioned HAdV-55 hexon second hypervariable region, any of the above-mentioned HAdV-3 hexon first hypervariable region, any of the above-mentioned HAdV-4 hexon fifth hypervariable region, any of the above-mentioned HAdV-7 hexon first hypervariable region, any of the above-mentioned gene encoding HAdV-55 hexon second hypervariable region, any of the above-mentioned gene encoding HAdV-4 hexon fifth hypervariable region, any of the above-mentioned gene encoding HAdV-3 hexon first hypervariable region and any of the above-mentioned gene encoding HAdV-7 hexon first hypervariable region in the preparation of a vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

[0022] Any of the above-mentioned vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55 is in particular prepared using any of the above-mentioned recombinant virus combinations as antigens.

[0023] The inventors of the present application explore the genomic capsid protein DNA of HAdV-4 and HAdV-7, replace the amino acid sequence of the fifth hypervariable region of HAdV-4 hexon in the HAdV-4 genome with the amino acid sequence of the second hypervariable region of HAdV-55 hexon by using antigen epitope insertion technology, to obtain recombinant adenovirus Ad4-55; replace the amino acid sequence of the first hypervariable region of HAdV-7 hexon in the HAdV-7 genome with the amino acid sequence of the first hypervariable region of HAdV-3 hexon, to obtain recombinant adenovirus Ad7-3. Experiments prove that the vaccine prepared by mixing the recombinant adenovirus Ad4-55 and the recombinant adenovirus Ad7-3 constructed by the present application can produce specific IgG antibodies and neutralizing antibodies against HAdV-3, HAdV-7, HAdV-4 and HAdV-55 by intraperitoneal injection of mice. After intraperitoneal challenge (the challenge materials used are HAdV-3, HAdV-7, HAdV-4 and HAdV-55, respectively), the copy number of HAdV-3, HAdV-7, HAdV-4 and HAdV-55 in the lungs of the mice is reduced, that is, the specific IgG antibodies and neutralizing antibodies produced in the mice after immunization have a protective effect on HAdV-3, HAdV-7, HAdV-4 and HAdV-55. The present application has important application value for the prevention and control of HAdV-3, HAdV-7, HAdV-4 and HAdV-55. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The Hexon alignment results of HAdV-3, HAdV-7, HAdV-4 and HAdV-55 in Example 1.

[0025] Figure 2 The agarose gel electrophoresis detection results of the PCR amplification products of the positive monoclonals in part (2) of step one 4 in Example 2.

[0026] Figure 3 The sequencing results of the positive monoclonals in part (3) of step one 4 in Example 2.

[0027] Figure 4 The agarose gel electrophoresis detection results of the PCR amplification products of the positive monoclonals in part (1) of step two 6 in Example 2.

[0028] Figure 5 The sequencing results of the positive monoclonals in part (2) of step two 6 in Example 2.

[0029] Figure 6 The cell morphology when the Ad4-55 virus liquid in step three 1 in Example 3 infects 293 cells for 24-48 h.

[0030] Figure 7Cell morphology of 293 cells infected with step three 1Ad7-3 virus stock in Example 3 for 24-48h.

[0031] Figure 8 Agarose gel electrophoresis detection result of PCR amplification product of (1) Ad4-55 virus stock in step three 2 of Example 3.

[0032] Figure 9 Sequencing result of PCR amplification product of (1) Ad4-55 virus stock in step three 2 of Example 3.

[0033] Figure 10 Agarose gel electrophoresis detection result of PCR amplification product of (2) Ad7-3 virus stock in step three 2 of Example 3.

[0034] Figure 11 Sequencing result of PCR amplification product of (2) Ad7-3 virus stock in step three 2 of Example 3.

[0035] Figure 12 Detection result of Example 4, step two, when 1 test virus is HAdV-4.

[0036] Figure 13 Detection result of Example 4, step two, when 1 test virus is HAdV-55.

[0037] Figure 14 Detection result of Example 4, step two, when 1 test virus is HAdV-7.

[0038] Figure 15 Detection result of Example 4, step two, when 1 test virus is HAdV-3.

[0039] Figure 16 Result of Example 4, step two, 2 IgG antibody level against Ad3-HVR1 peptide segment.

[0040] Figure 17 Result of Example 4, step two, 2 IgG antibody level against Ad4-HVR7 peptide segment.

[0041] Figure 18 Result of Example 4, step two, 2 IgG antibody level against Ad7-HVR5 peptide segment.

[0042] Figure 19 Result of Example 4, step two, 2 IgG antibody level against Ad55-HVR2 peptide segment.

[0043] Figure 20 Detection result of Example 4, step three, 3 RT-PCR detection of copy number of HAdV-4.

[0044] Figure 21 Detection results of copy number of HAdV-55 detected by 3RT-PCR in step three of Example 4.

[0045] Figure 22 Detection results of copy number of HAdV-7 detected by 3RT-PCR in step three of Example 4.

[0046] Figure 23 Detection results of copy number of HAdV-3 detected by 3RT-PCR in step three of Example 4. DETAILED DESCRIPTION

[0047] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application in any way.

[0048] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0049] In the quantitative test in the following examples, three repeated experiments were set, and the average value was taken.

[0050] The HAdV used in the following examples is shown in Table 1.

[0051] Table 1

[0052]

[0053] Example 1, Epitope analysis and screening of HAdV-3 and HAdV-55

[0054] 1. Alignment of Hexon of HAdV-3, HAdV-7, HAdV-4 and HAdV-55 to determine the Hypervariable Region (HVR).

[0055] The alignment results are shown in Table 1. Figure 1

[0056] ​2. After step 1, bioinformatics analysis was performed on the 7 HVRs of HAdV-3 and HAdV-55, respectively, including antigen similarity analysis (https: / / ddg-pharmfac.net / vaxijen / VaxiJen / VaxiJen.html), toxicity analysis (https: / / webs.iiitd.edu.in / raghava / toxinpred / multi_submit.php) and solubility analysis (https: / / www.biotech.ou.edu / ).

[0057] The analysis results are shown in Tables 2 and 3. After comparison, HAdV-3 HVR1 and HAdV-55 HVR2 with high antigen similarity score, no toxicity and high solubility were selected.

[0058] Table 2

[0059]

[0060] Table 3

[0061]

[0062] Example 2, Construction of Virus Infecting Clone pAd4-55 Recombinant Plasmid and pAd7-3 Recombinant Plasmid

[0063] I. Construction of pAd4-55 Recombinant Plasmid

[0064] 1. Amplification of Target Fragment

[0065] The pBRAd4-L3-Kan-sacB plasmid was used as a template, and a primer pair composed of Primer 4-1: 5'-TCTGAACAGCATCGTGGGTC-3' and Primer 4-2: 5'-CGGTTTACTTTCTTCATCTGAAACTTTCAAAAAGAAAGCCAGGTCTATATC-3' was used for PCR amplification, and a fragment of 956 bp was recovered using a gel recovery kit (AP-GX-50, Axygen).

[0066] The pBRAd4-L3-Kan-sacB plasmid was used as a template, and a primer pair composed of Primer 4-3: 5'-TTGAAAGTTTCAGATGAAGAAAGTAAACCGGTTGACTTGCAGACTCCAG-3' and Primer 4-4: 5'-AGGTGGCGTAGAGGTTAATGC-3' was used for PCR amplification, and a fragment of 1018 bp was recovered using a gel recovery kit.

[0067] 2. Perform overlap PCR on the fragments

[0068] Fuse fragment one and fragment two to obtain an overlap PCR reaction solution.

[0069] The PCR reaction system consists of 10 μL 2x PrimeSTAR Max DNA Polymerase (R045A, TaKaRa), 1 μL fragment one (50 ng / μL), 1 μL fragment two (50 ng / μL), and 8 μL deionized water.

[0070] PCR reaction conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 10 cycles; 72°C for 10 min for sufficient extension.

[0071] 3. Amplify the recombinant fragment

[0072] Dilute the overlap PCR reaction solution 5-fold and use it as a template, and perform PCR amplification using a primer pair consisting of primer Primer 4-1: 5'-TCTGAACAGCATCGTGGGTC-3' and primer Primer 4-4: 5'-AGGTGGCGTAGAGGTTAATGC-3', and use a gel recovery kit to recover a recombinant fragment with a size of 1944 bp.

[0073] The recombinant fragment is the Ad4-Ad55HVR2 targeting fragment.

[0074] 4. Use the pBRAd4-L3-Kan-sacB plasmid to target the Ad4-Ad55HVR2 targeting fragment to obtain a pAd4-55 recombinant plasmid

[0075] (1) 100 ng pBRAd4-L3-Kan-sacB plasmid and 500 ng Ad4-Ad55 HVR2 targeting fragment were added into E. coli DY380 electrotransformation competent cells, mixed well; then added into pre-cooled 0.1 mL electroporation cup, and transformed by Bio-Rad GenePuLser electroporation instrument (GenePuLser, Bio-Rad) under the condition of 1.8 KV, 25 μF, 200 ohms. After electroporation, 1 mL of antibiotic-free LB liquid medium (adding deionized water to Tryptone 10 g, yeast extract 5 g and NaCl 10 g to 1000 mL, mixing well, and autoclaving at 121 ℃ for 20 min) was immediately added, and the cells were cultured at 30 ℃, 200 rpm for 2 h. 100 μL of the bacterial solution was spread on LB + 60% sucrose + ampicillin resistant plate (adding deionized water to Tryptone 10 g, yeast extract 5 g and NaCl 10 g to 1000 mL, mixing well, and autoclaving at 121 ℃ for 20 min, and then adding 60% sucrose and ampicillin (A8180, Solarbio) after cooling to an appropriate temperature, and culturing overnight to obtain a single colony.

[0076] (2) The single colony obtained in step (1) was used as a template, and primer Primer4-5: 5'-TGACGCACACGGACGAAC-3' and primer Primer4-6: 5'-AACCAGTCCTTGGTCATGTTG-3' were used as a primer pair for PCR amplification, and the PCR amplification product was obtained and subjected to agarose gel electrophoresis. Then, the following judgment was made: if the PCR amplification product contains a DNA fragment with a size of 2624 bp, the single colony is a positive single colony. The positive single colony contains a pAd4-55 recombinant plasmid.

[0077] Some of the test results are shown in Figure 2 (2-6 are all positive single colonies). The results show that the band size of the positive single colony is consistent with the expected size.

[0078] (3) The positive single colony was sequenced using primer Primer4-7: 5'-GATAGAAGCTGATGGGCTGC-3'.

[0079] The sequencing results are shown in Figure 3 .

[0080] The results show that the pAd4-55 recombinant plasmid is obtained by mutating "gacagcaaaactattgttgctaactacgatccagatattgtaatgtacacagaaaat" (coding the fifth hypervariable region of the hexon of type 4 adenovirus, SEQ ID NO: 1) in the pBRAd4-L3-Kan-sacB plasmid to "ttgaaagtttcagatgaagaaagtaaaccg" (coding the second hypervariable region of the hexon of type 55 adenovirus, SEQ ID NO: 2); the mutation results in the mutation of the amino acids at positions 255-273 of the HAdV-4 Hexon from "DSKTIVANYDPDIVMYTEN" (i.e. the fifth hypervariable region of the hexon of type 4 adenovirus, SEQ ID NO: 3) to "LKVSDEESKP" (i.e. the second hypervariable region of the hexon of type 55 adenovirus, SEQ ID NO: 4).

[0081] 5. The pAd4-55 plasmid is extracted from the positive monoclonal using the QIAprep Spin Miniprep Kit (27104, Qiagen).

[0082] II. Construction of pAd7-3 Recombinant Plasmid

[0083] 1. Amplification of target fragment

[0084] The pAd7 plasmid is used as a template, and the primer pair consisting of Primer 7-1:

[0085] 5'-GCTTTCAAGATGGCCACCCCATCGATGATGCCCCAATGG-3' and Primer 7-2: 5'-tgtgtttgtggtggtagttactgcattgtctcgattcgttgtaactatCCACTGAGATGTGTTAGG-3' is used for PCR amplification, and the 462 bp fragment 1 is recovered using a gel recovery kit.

[0086] The pAd7 plasmid is used as a template, and the primer pair consisting of Primer 7-3:

[0087] 5'-atagttacaacgaatcgagacaatgcagtaactaccaccacaaacacaTTTGGCATTGCTTCCACG-3' and Primer 7-4: 5'-TGCATTCAGTTGTGATGCTTGGCCGGCCAAAACTCC-3' is used for PCR amplification, and the 633 bp fragment 2 is recovered using a gel recovery kit.

[0088] 2. Perform overlap PCR on the fragments

[0089] Fuse fragment 1 and fragment 2 to obtain an overlap PCR reaction solution.

[0090] The PCR reaction system is composed of 10 μL of 2x KeyPo Master Mix (PK511-03, Vazyme), 1 μL of fragment 1 (50 ng / μL), 1 μL of fragment 2 (50 ng / μL), and 8 μL of deionized water.

[0091] PCR reaction conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 5 s, 72°C extension for 30 s, 10 cycles; 72°C for 10 min.

[0092] 3. Amplify the recombinant fragment

[0093] Dilute the overlap PCR reaction solution 5-fold and use it as a template, and perform PCR amplification using a primer pair composed of primer Primer7-1 and primer Primer7-4, and recover the recombinant fragment of 1047 bp in size using a gel recovery kit.

[0094] 4. Enzymatic digestion of pAd7 vector

[0095] Digest the pAd7 vector with FseI and ClaI, and recover the vector backbone using a gel recovery kit.

[0096] The enzyme digestion reaction system is 30 μL, composed of 1.5 μg of pAd7 vector, 1.5 μL of FseI (R0588V, NEW ENGLAND BioLabs), 1.5 μL of ClaI (R0197S, NEW ENGLAND BioLabs), 3 μL of 10x Cutsmart Buffer, and deionized water.

[0097] Enzymatic digestion reaction conditions: 37°C for 4 h.

[0098] 5. Seamless cloning

[0099] Perform seamless cloning on the recombinant fragment recovered in step 3 and the vector backbone recovered in step 4, and then transform into E. coli DH10B competent cells (TSC-C09, Beijing Genesee Biotechnology Co., Ltd.) to obtain single colonies.

[0100] 6. Identification

[0101] (1) Using the obtained monoclonal as a template, PCR amplification was performed with a primer pair consisting of Primer 7-5: 5'-TGGAAGACATCAATTTTTCATCCCTG-3' and Primer 7-6: 5'-ACGAACATCGGGATCATAGC-3'. The PCR amplification product was subjected to agarose gel electrophoresis. Then, it was determined as follows: if the PCR amplification product contained a DNA fragment of 2028 bp in size, the monoclonal was a positive monoclonal. The positive monoclonal contained the pAd7-3 recombinant plasmid.

[0102] Part of the detection results are shown in Table 1. Figure 4 (2-8 are all positive monoclonals). The results show that the band sizes of the positive monoclonals are consistent with the expectations.

[0103] (2) The positive monoclonal was sequenced with Primer 7-7: 5'-CCACCCCATCGATGATGC-3'.

[0104] The sequencing results are shown in Table 2. Figure 5 .

[0105] The results show that the pAd7-3 recombinant plasmid is a recombinant plasmid obtained by mutating "ATAGTTACAACGGGAGAAGACAATGCCACCACATACACA" (encoding the first hypervariable region of the hexon of type 7 adenovirus, SEQ ID NO: 5) of the pAd7 plasmid into "atagttacaacgaatcgagacaatgcagtaactaccaccacaaacaca" (encoding the first hypervariable region of the hexon of type 3 adenovirus, SEQ ID NO: 6); this mutation causes the amino acids at positions 136-148 of the HAdV-7 Hexon to be mutated from "IVTTGEDNATTYT" (i.e., the first hypervariable region of the hexon of type 7 adenovirus, SEQ ID NO: 7) to "IVTTNRDNAVTTTTNT" (i.e., the first hypervariable region of the hexon of type 3 adenovirus, SEQ ID NO: 8).

[0106] 7. The pAd7-3 plasmid was extracted from the positive monoclonal using a QIAprep Spin Miniprep Kit.

[0107] Example 3, Packaging and identification of recombinant virus Ad4-55 (i.e., recombinant adenovirus Ad4-55) and recombinant virus Ad7-3 (i.e., recombinant adenovirus Ad7-3)

[0108] I. Preparation of recombinant virus

[0109] 1. Take pAd4-55 recombinant plasmid, linearize it with restriction enzyme AsisI (R0630L, NEW ENGLAND BioLabs), and recover about 35969 bp large fragment DNA. Take pAd7-3 recombinant plasmid, linearize it with restriction enzyme PmeI (R0560L, NEW ENGLAND BioLabs), and recover about 35256 bp large fragment DNA.

[0110] Recover DNA by phenol chloroform extraction.

[0111] 2. Take large fragment DNA obtained in step 1, transfect 293 cells with the help of transfection reagent Lipo3000 (L3000015, invitrogen), and culture for 5-10 days. Release virus by repeated freezing and thawing for three times. Remove cell debris by centrifugation at 1200 rpm for 5 min, and filter the supernatant with 0.45 μM filter to obtain P0 generation virus liquid.

[0112] II. Amplification and purification of recombinant virus

[0113] 1. Infect 293 cells with P0 generation virus liquid, add 2% FBS DMEM medium (DMEM medium (12491-015, Gibco) + 2% heat-inactivated (56°C for 30 min) fetal bovine serum (11011-8611, Sijiqing) and 1% penicillin-streptomycin mixture (03.12001A, Eallbio)), and culture in 37°C, 5% carbon dioxide cell incubator. Release virus by repeated freezing and thawing for three times after complete cytopathic effect. Remove cell debris by centrifugation at 1200 rpm for 5 min, filter the supernatant with 0.45 μM filter to obtain P1 generation virus liquid.

[0114] Continue to perform virus passage according to the above steps.

[0115] 2. Purification of recombinant virus is completed by Shenzhen Hanmei Biotechnology Co., Ltd.

[0116] III. Identification of recombinant virus

[0117] 1. Morphological observation

[0118] Cell morphology of Ad4-55 virus liquid (all the following are virus liquid prepared by using pAd4-55 recombinant plasmid) infected 293 cells cultured for 24-48 h is shown in Figure 6 Cell morphology of Ad7-3 virus liquid (all the following are virus liquid prepared by using pAd7-3 recombinant plasmid) infected 293 cells cultured for 24-48 h is shown in Figure 7 .

[0119] 2. Epitope identification of recombinant virus

[0120] (1) Extract the genomic DNA of Ad4-55 virus liquid and use it as a template for PCR detection of HVR5 position. Specifically, use Primer 4-8: 5'-TACAAAGTGCGCTACACGCTG-3' and Primer 4-9: 5'-TCAACGGAAAGCAATAGTTTGG-3' for PCR amplification, and perform agarose gel electrophoresis on the PCR product.

[0121] The agarose gel electrophoresis result is shown in Figure 8 , and the fragment size of the PCR product of Ad4-55 virus liquid is 937 bp.

[0122] Sequence the PCR product using Primer 4-8, and the sequencing result is shown in Figure 9 . The sequencing result is correct.

[0123] (2) Extract the genomic DNA of Ad7-3 virus liquid and use it as a template for PCR detection of HVR1 position. Specifically, use Primer 7-7: 5'-CCACCCCATCGATGATGC-3' and Primer 7-8: 5'-TGGGCTTGTTGTCTGCAG-3' for PCR amplification, and perform agarose gel electrophoresis on the PCR product.

[0124] The agarose gel electrophoresis result is shown in Figure 10 , and the fragment size of the PCR product of Ad7-3 virus liquid is 534 bp.

[0125] Sequence the PCR product using Primer 7-7, and the sequencing result is shown in Figure 11 . The sequencing result is correct.

[0126] Example 4, Mouse immunization evaluation of recombinant adenovirus Ad4-55 and recombinant adenovirus Ad7-3

[0127] I. Mouse immunization and serum sample collection

[0128] Divide the C57BL / 6JNifdc mice randomly into a vaccine group and a PBS group, 5 mice in each group.

[0129] The vaccine group was immunized with a mixture of purified Ad4-55 recombinant adenovirus and Ad7-3 recombinant adenovirus (i.e. a tetravalent recombinant adenovirus vaccine) by intraperitoneal injection at 0d (first immunization), 14d (second immunization), and 28d (third immunization). The immunization dose was as follows: 1x10 7 VP Ad4-55+1x10 7 VP Ad7-3 mixed immunization, 200 μL per mouse. The second immunization was 7x10 7VP Ad4-55 + 7x10 7 VP Ad7-3 mixed immunization, volume 200 μL per mouse. Three immunizations were 1x10 8 VP Ad4-55 + 1x10 8 VP Ad7-3 mixed immunization, volume 200 μL per mouse.

[0130] The PBS group was injected intraperitoneally with PBS buffer at 0d, 14d, 28d, respectively. The injection dose was 200 μL per mouse.

[0131] All mice were collected blood at 35d. After blood collection, stand for 1h, centrifuged at 4℃, 6000rpm for 10min, collect the upper serum, and store at-80℃ after aliquot.

[0132] II. Sample detection after immunization

[0133] 1. Neutralizing antibody titer detection

[0134] In order to determine the neutralizing activity of each serum sample to HAdV-3, HAdV-7, HAdV-4 and HAdV-55, neutralizing antibody detection experiment was carried out. The specific steps are as follows:

[0135] (1) The serum was mixed with the same volume of test virus liquid (containing 1x10 5 VPHAdV-3, HAdV-7, HAdV-4 or HAdV-55) in a 96-well plate (3599, Corning) with a dilution of 1:9, and the virus-serum mixture was incubated at 37℃, 5% CO2 for 1 hour.

[0136] The serum titer range was 1:40 to 1:20480.

[0137] (2) After step (1) was completed, the virus-serum mixture was inoculated into 293 cell monolayer (cell confluence was 80%) in a 96-well plate at a volume of 100 μL per well, and after incubation at 37℃, 5% CO2 for 2 hours, the culture supernatant in each well was removed.

[0138] (3) After step (2) was completed, 100 μL of DMEM medium (12491-015, Gibco) containing 2% FBS, 2% heat-inactivated (56℃ for 30 minutes) fetal bovine serum (11011-8611, Sijiqing) and 1% penicillin-streptomycin mixture (03.12001A, Eallbio) was added to each well, and the cells were maintained at 37℃, 5% CO2 for 3d, and the cells were observed to evaluate the appearance of CPEs to determine the highest titer of antibodies in the serum that could neutralize the virus.

[0139] The detection results are shown in Table 2. Figure 12-15 The experimental results show that the neutralizing antibody titers of the serum of the immunized mice against the test virus HAdV-3 are 1:640-1:1280; the neutralizing antibody titers of the serum of the immunized mice against the test virus HAdV-7 are 1:5120-1:10240; the neutralizing antibody titers of the serum of the immunized mice against the test virus HAdV-4 are 1:5120-1:10240; and the neutralizing antibody titers of the serum of the immunized mice against the test virus HAdV-55 are 1:2560-1:5120. It can be seen that the tetravalent recombinant adenovirus vaccine can induce neutralizing antibody activity against HAdV-3, HAdV-7, HAdV-4 and HAdV-55 and increase the neutralizing antibody titer.

[0140] 2. Specific IgG antibody detection

[0141] The expression of IgG antibodies in individual serum samples against the corresponding immunogen was measured by ELISA. The specific steps are as follows:

[0142] (1) 96-well 1x8 Flat Bottom (42592, Costar) was coated with Ad4-HVR7 peptide segment, Ad55-HVR2 peptide segment, Ad7-HVR5 peptide segment or Ad3-HVR1 peptide segment diluted with 100 μL of coating buffer (C1050, Solarbio) per well at 4°C overnight, i.e. 0.2 μg / well.

[0143] The amino acid sequences of the Ad4-HVR7 peptide segment, the Ad55-HVR2 peptide segment, the Ad7-HVR5 peptide segment and the Ad3-HVR1 peptide segment are shown in Table 4.

[0144] Table 4

[0145] Peptide name Peptide amino acid sequence Peptide amino acid number Ad4-HVR7 VKVKTDAGSEKWDKDDTTVSNA 22 Ad55-HVR2 LKVSDEESKP 10 Ad7-HVR5 DGREAADAFSPEIVLYTEN 19 Ad3-HVR1 IVTTNRDNAVTTTTNT 16

[0146] (2) After step (1) is completed, wash three times with 200 μL of washing solution (SEKF102, Solarbio), and then block with 5% BSA blocking solution (RF101-100, Jingmei Biotechnology Co., Ltd.) at 37°C for 1 hour.

[0147] (3) After step (2) is completed, dilute the serum sample 100 times with PBS (03.15018C, Eallbio). After the blocked plate is washed three times with 200 μL of washing solution (SEKF102, Solarbio), add 100 μL of diluted serum, and incubate at 37°C for 1 hour.

[0148] (4) After completing step (3), wash the plate incubated with serum three times with 200 μL washing buffer (SEKF102, Solarbio), add 100 μL of HRP-labeled goat anti-mouse IgG (ZB-2305, Zhongshan Jinqiao) secondary antibody diluted 1:5000 with PBS buffer, and incubate at 37°C for 1 hour.

[0149] (5) After completing step (4), wash the plate containing the secondary antibody three times with 200 μL of washing buffer (SEKF102, Solarbio), then add 100 μL of soluble single-component TMB substrate solution (PA107-01, TIANGEN) and incubate at 37°C in the dark for 30 min. Add 100 μL of stop solution (C1058-100 ml, Solarbio) to stop the color development, and then readthe plate at 450 nm optical density (OD) using a microplate reader. 450 Colorimetric analysis was performed.

[0150] Test results are shown Figure 16-19 The results showed that after stimulation with the target peptides, the average absorbance (OD) of the specific IgG antibody levels against each peptide in the serum of the vaccine group was [data missing]. 450 The levels of HAdV-3 (nm) and HAdV-7 (HAdV-4) were significantly higher than those in the PBS group. This indicates that the quadrivalent recombinant adenovirus vaccine can induce specific IgG antibodies against HAdV-3, HAdV-7, HAdV-4, and HAdV-55, and the levels of specific IgG antibodies are increased.

[0151] III. qRT-PCR determination of HADV-3, HADV-7, HADV-4, and HADV-55 viral genome copies in mice challenged with HADV-3 and HADV-7.

[0152] 1. C57BL / 6JNifdc mice were randomly divided into 9 groups, with 5 mice in each group.

[0153] Four groups received a mixed immunization with Ad4-55 and Ad7-3, specifically: purified Ad4-55 recombinant adenovirus and Ad7-3 recombinant adenovirus were administered via intraperitoneal injection on day 0 (primary immunization), day 14 (secondary immunization), and day 28 (tertiary immunization). The immunization dosage was as follows: Primary immunization (1×10⁻⁶) 7 VPAd4-55+1×10 7 VPAd7-3 mixed immunization), volume 200μL / animal. Second immunization (7×10 7 VP Ad4-55+7×10 7 VPAd7-3 mixed immunization), 200 μL / animal. Triple immunization (1×10⁻⁶). 8 VPAd4-55+1×10 8 VPAd7-3 mixed immunization), volume 200μL / animal.

[0154] Five groups were immunized with PBS (i.e. non-immunized), specifically: intraperitoneal injection with PBS buffer at 0d, 14d, 28d, respectively. The injection dose was 200 μL per mouse.

[0155] 2. After completion of step 1, all mice were intraperitoneally injected with challenge virus at 35d.

[0156] Challenge of each group was as follows:

[0157] Group One: Ad4-55 + Ad7-3 mixed immunization, 1 x 10 9 Challenge with VPHAdV-7;

[0158] Group Two: Ad4-55 + Ad7-3 mixed immunization, 1 x 10 9 Challenge with VPHAdV-3;

[0159] Group Three: Ad4-55 + Ad7-3 mixed immunization, 1 x 10 9 Challenge with VPHAdV-4;

[0160] Group Four: Ad4-55 + Ad7-3 mixed immunization, 1 x 10 9 Challenge with VPHAdV-55;

[0161] Group Five: PBS immunization, 1 x 10 9 Challenge with VPHAdV-7;

[0162] Group Six: PBS immunization, 1 x 10 9 Challenge with VPHAdV-3;

[0163] Group Seven: PBS immunization, 1 x 10 9 Challenge with VPHAdV-4;

[0164] Group Eight: PBS immunization, 1 x 10 9 Challenge with VPHAdV-55;

[0165] Group Nine: PBS immunization, no challenge.

[0166] Three days after challenge, blood was collected from the mice, and the mice were immediately sacrificed by cervical dislocation.

[0167] 3. qRT-PCR determination of viral genome copies of HAdV-3, HAdV-7, HAdV-4 and HAdV-55 in challenged mice

[0168] (1) Extraction of RNA from lung tissue of mice

[0169] Dissect the mouse lung, put 0.1 g of mouse lung tissue into a centrifuge tube, add 500 μL of Trizol to each tube, homogenize completely on ice, centrifuge at 4°C and 12000 rpm for 15 min, take the supernatant into a 1.5 mL centrifuge tube, add 150 μL of chloroform, shake for 15 sec, centrifuge at 4°C and 12000 rpm for 15 min, the sample is divided into water phase layer and organic layer, collect the upper water sample layer into a new enzyme-free centrifuge tube, add 500 μL of isopropanol to precipitate the RNA in the water phase, place on ice for 10 min, centrifuge at 4°C and 12000 rpm for 15 min, discard the supernatant, add 1 mL of pre-cooled 75% alcohol to wash the precipitate, centrifuge at 4°C and 12000 rpm for 10 min, discard the supernatant, aspirate the residual moisture, dry, and then add 50 μL of DEPC water to dissolve the RNA, thus obtaining the mouse lung tissue RNA.

[0170] The concentration and purity of the mouse lung tissue RNA were detected by NanoDrop.

[0171] (2) Reverse transcription to synthesize cDNA

[0172] 1 μg of mouse lung tissue RNA was reverse transcribed into cDNA using a reverse transcription kit (R333-01, Vazyme).

[0173] (3) qRT-PCR

[0174] The cDNA of mouse lung tissue was used as a template for qRT-PCR to determine the viral genome copies of HAdV-3, HAdV-7, HAdV-4 and HAdV-55.

[0175] The reaction system was composed of 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix (Q712-02, Vazyme), 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of cDNA and 7 μL of DEPC water.

[0176] The nucleotide sequences of the upstream primer and the downstream primer for detecting viruses are shown in Table 5.

[0177] Table 5

[0178] HAdV Nucleotide sequence of upstream primer (5’-3’) Nucleotide sequence of downstream primer (5’-3’) HAdV-4 ACTATTGTTGCTAACTACGATCC TGGGTCTGTTAGGCATGG HAdV-7 TACAACGGGAGAAGACAATGC ATCGGCATAAATGGGCTTG HAdV-55 TAGGGGTTCCAACAACCAGTTAC TCCATGGCAGACAAATTACCCTG HAdV-3 ACAACCGAAGGAGGGGTTG TCAGACGTTCCTGGTTTATATACCAC

[0179] The detection results are shown in Figure 20-23The results show that after Ad4-55 / Ad7-3 mixed immunization, the mice are attacked by HAdV-3, HAdV-7, HAdV-4 and HAdV-55 respectively (namely the post-immunization attack group), and after 3 days, the copy numbers of HAdV-3, HAdV-7, HAdV-4 and HAdV-55 in the lungs are all lower than those of the non-immunization direct attack group, proving that the antibodies against HAdV-3, HAdV-7, HAdV-4 and HAdV-55 produced by the mice after immunization have protective effect on the attack of HAdV-3, HAdV-7, HAdV-4 and HAdV-55.

[0180] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application.

Claims

1. A recombinant virus combination comprising a recombinant adenovirus Ad4-55 and a recombinant adenovirus Ad7-3; the recombinant adenovirus Ad4-55 expresses a HAdV-55 hexon second hypervariable region; the recombinant adenovirus Ad7-3 expresses a HAdV-3 hexon first hypervariable region; the recombinant adenovirus Ad4-55 is a recombinant virus obtained by replacing the amino acid sequence of a HAdV-4 hexon fifth hypervariable region in a HAdV-4 genome with the amino acid sequence of a HAdV-55 hexon second hypervariable region; the amino acid sequence of the HAdV-4 hexon fifth hypervariable region is shown in SEQ ID NO: 3; the amino acid sequence of the HAdV-55 hexon second hypervariable region is shown in SEQ ID NO: 4; the recombinant adenovirus Ad7-3 is a recombinant virus obtained by replacing the amino acid sequence of a HAdV-7 hexon first hypervariable region in a HAdV-7 genome with the amino acid sequence of a HAdV-3 hexon first hypervariable region; the amino acid sequence of the HAdV-7 hexon first hypervariable region is shown in SEQ ID NO: 7; the amino acid sequence of the HAdV-3 hexon first hypervariable region is shown in SEQ ID NO:

8. 2.The recombinant virus combination according to claim 1, wherein: the replacement of the amino acid sequence of the HAdV-4 hexon fifth hypervariable region in the HAdV-4 genome with the amino acid sequence of the HAdV-55 hexon second hypervariable region is achieved by replacing a gene encoding the HAdV-4 hexon fifth hypervariable region in the HAdV-4 genome with a gene encoding the HAdV-55 hexon second hypervariable region; the nucleotide sequence of the gene encoding the HAdV-4 hexon fifth hypervariable region is shown in SEQ ID NO: 1; the nucleotide sequence of the gene encoding the HAdV-55 hexon second hypervariable region is shown in SEQ ID NO:

2. 3.The recombinant virus combination according to claim 1, wherein: the replacement of the amino acid sequence of the HAdV-7 hexon first hypervariable region in the HAdV-7 genome with the amino acid sequence of the HAdV-3 hexon first hypervariable region is achieved by replacing a gene encoding the HAdV-7 hexon first hypervariable region in the HAdV-7 genome with a gene encoding the HAdV-3 hexon first hypervariable region; the nucleotide sequence of the gene encoding the HAdV-7 hexon first hypervariable region is shown in SEQ ID NO: 5; the nucleotide sequence of the gene encoding the HAdV-3 hexon first hypervariable region is shown in SEQ ID NO:

6. the recombinant virus combination consists of the recombinant adenovirus Ad4-55 and the recombinant adenovirus Ad7-3 according to any one of claims 1 to 3. 5.A vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55, comprising the recombinant virus combination according to any one of claims 1 to 4. ​ ​ ​ ​ 4. The recombinant viral combination of any one of claims 1 to 3, wherein: ​ ​ 6. A method for increasing neutralizing antibody titer and / or specific IgG antibody level in an animal, by injecting into the animal the recombinant virus combination of any one of claims 1 to 4.

7. Use of the recombinant virus combination of any one of claims 1 to 4 in the manufacture of a vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

8. Use of the recombinant virus combination of any one of claims 1 to 4 in increasing specific IgG antibody level and / or neutralizing antibody titer in an animal.

9. Use of the recombinant virus combination of any one of claims 1 to 4 in reducing the incidence of adenovirus infection; said adenovirus being HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55.

10. Use of at least one of the HAdV-55 hexon second hypervariable region of claim 1, the HAdV-3 hexon first hypervariable region of claim 1, the HAdV-4 hexon fifth hypervariable region of claim 1, the HAdV-7 hexon first hypervariable region of claim 1, the gene encoding the HAdV-55 hexon second hypervariable region of claim 2, the gene encoding the HAdV-4 hexon fifth hypervariable region of claim 2, the gene encoding the HAdV-3 hexon first hypervariable region of claim 3 and the gene encoding the HAdV-7 hexon first hypervariable region of claim 3 in the manufacture of a vaccine for preventing HAdV-3, HAdV-7, HAdV-4 and / or HAdV-55. ​

Images