CRISPR-Cas13a (clustered regularly interspaced short palindromic repeats-associated protein 13a) system-based nucleic acid detection method for electrochemical detection of influenza B virus, kit and application

By combining the CRISPR-Cas13a system with electrochemical methods, a specific crRNA targeting the HA gene of influenza B virus was designed, enabling rapid, simple, and highly sensitive detection of influenza B virus. This solves the problems of complex equipment and cumbersome operation in existing technologies and is suitable for on-site detection.

CN120989306APending Publication Date: 2025-11-21ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511128376.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing methods for detecting influenza B virus require specialized equipment and are complex to operate, making it difficult to achieve rapid, simple, and highly sensitive detection.

Method used

An electrochemical detection method based on the CRISPR-Cas13a system was adopted. By combining RT-RAA primers and the CRISPR-Cas13a electrochemical system, a specific crRNA was designed to target the conserved region of the influenza B virus HA gene. The high specificity and high sensitivity of CRISPR-Cas13a were used to recognize and cleave the electrochemical reporter RNA, and the influenza B virus nucleic acid was detected by an electrochemical workstation.

Benefits of technology

It achieves high-sensitivity (100 copies/µL) influenza B virus detection without the need for complex equipment. It is simple to operate, suitable for on-site testing, and has rapid signal response and high specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989306A_ABST
    Figure CN120989306A_ABST
Patent Text Reader

Abstract

The invention relates to a CRISPR-Cas13a (clustered regularly interspaced short palindromic repeats-CRISPR-Cas13a) system-based nucleic acid detection method for electrochemical detection of influenza B virus, a kit and application. The kit comprises: an (RT) RAA primer group, which is used for targeting an influenza B virus HA gene conserved region; the CRISPR-Cas13a system contains an LwCas13a protein and crRNA (Complementary Ribonucleic Acid), and the LwCas13a protein and the crRNA can form a complex. The detection method comprises the following steps: performing (RT) RAA isothermal amplification on target RNA; transcribing the T7 to generate single-stranded RNA; the CRISPR-Cas13a is used for identifying the target RNA, activating the trans-cleavage activity and cutting off the electrochemical report RNA; biotin is separated through streptavidin magnetic beads, and methylene blue (MB) redox peak signals are detected through square wave voltammetry. The method has the advantages of high specificity, high sensitivity (100 copy / microliter), high signal response speed, simplicity in operation and the like, and is suitable for field detection. The method has important application value in influenza B virus screening and public health emergency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to an electrochemical detection method, kit, and application for influenza B virus nucleic acid detection based on the CRISPR-Cas13a system. Background Technology

[0002] Influenza B virus, belonging to the genus *Influenza* of the family Orthomyxoviridae, is one of the common pathogens causing influenza in humans. Compared to influenza A virus, influenza B virus has lower variability, resulting in a relatively stable epidemic cycle and typically causing seasonal influenza outbreaks annually. Influenza B virus is primarily transmitted through droplets, spreading to others via coughing, sneezing, or direct contact. After infection, patients usually exhibit typical influenza symptoms, including fever, cough, sore throat, muscle aches, headache, and fatigue. Although influenza B symptoms are generally mild, serious complications such as pneumonia or heart problems can still occur in some high-risk groups (such as the elderly, pregnant women, and those with weakened immune systems). Therefore, early diagnosis and prevention of influenza B virus are of great importance. Existing detection methods include real-time quantitative PCR and antigen detection, but these methods sometimes require specialized equipment and are relatively complex to operate. Therefore, developing simpler, faster, and more sensitive detection technologies is crucial for influenza prevention and control. Summary of the Invention

[0003] To address the technical problems existing in the prior art, this invention provides an electrochemical detection method and application for influenza B virus nucleic acid detection based on the CRISPR-Cas13a system, which can detect influenza B virus rapidly, conveniently and with high sensitivity.

[0004] According to a first aspect of the technical solution of the present invention, the present invention first provides an electrochemical detection kit for influenza B virus nucleic acid based on the CRISPR-Cas13a system, comprising the following components: 1) A set of (RT)RAA primers for electrochemical detection and / or electrochemical nucleic acid detection of influenza B virus based on the CRISPR-Cas13a system; 2) A CRISPR-Cas13a system for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system, comprising Cas13a protein and crRNA, or a complex of the two; 3) A CRISPR-Cas13a electrochemical system for electrochemical nucleic acid detection of influenza B virus, Cas13a protein and crRNA, or a complex of the two; The crRNA serves as an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the conserved region of the influenza B virus HA gene; the target sequence of the conserved region of the influenza B virus HA gene is located at positions 678-897 of the influenza B virus HA gene; the Cas13a protein is the LwCas13a protein. In a preferred embodiment, the target sequence of the conserved region of the influenza B virus HA gene is shown at positions 678-897 of the gene sequence numbered NC_002207.1 in the GenBank database.

[0005] According to a second aspect of the present invention, a method for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system is provided, comprising using the (RT)RAA primers described above for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system and / or the CRISPR-Cas13a system and the CRISPR-Cas13a electrochemical system for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system.

[0006] In a preferred embodiment, the method further includes using a primer combination for specifically amplifying the target sequence of influenza B virus; the single-stranded DNA molecule sequence of the (RT)RAA primer combination is shown in Table 4; the single-stranded DNA molecule sequence of the crRNA is shown in Table 1. According to a third aspect of the technical solution of the present invention, the present invention also provides the application of the above-described reagent kit or method in the preparation of products having the following functions: 1) Detect whether the target nucleic acid is pathogen nucleic acid; This invention also provides any of the following substances: A1) The aforementioned crRNA; A2) The aforementioned Cas13a protein and crRNA, or a complex formed by the two; A3) The primer combination mentioned above.

[0007] According to the fourth aspect of the technical solution of the present invention, the present invention also provides any of the following applications: B1) The application of the above-mentioned technologies or substances in the detection or auxiliary detection of influenza B virus; B2) The application of the above-mentioned technology or substances in the preparation of products for detecting or assisting in the detection of influenza B virus; B3) The application of the above-mentioned techniques or substances in detecting or assisting in the detection of whether the sample to be tested contains influenza B virus; B4) The application of the above-mentioned technologies or substances in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains influenza B virus; B5) The application of the above-mentioned technologies or substances in screening or assisting in the screening of drugs for the prevention and treatment of influenza B virus; B6) The application of the above-mentioned technologies or substances in the preparation of products for screening or assisting in the screening of drugs for the prevention and treatment of influenza B virus; B7) Application of the above-mentioned substances in the preparation of the above-mentioned techniques.

[0008] In some embodiments, the application is for non-diagnostic purposes.

[0009] According to a fifth aspect of the technical solution of the present invention, the present invention provides a method for detecting or assisting in the detection of influenza B virus, the method being for non-diagnostic purposes, the method comprising using the above-described technique to detect whether the sample to be tested is or is a candidate for influenza B virus.

[0010] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a technology for detecting influenza B virus based on (RT)RAA / CRISPR-Cas13a nucleic acid detection technology, including a CRISPR-Cas13a system for electrochemical detection of influenza B virus nucleic acid based on the CRISPR-Cas13a system and a CRISPR-Cas13a electrochemical system for electrochemical detection of influenza B virus nucleic acid. Through design, construction and screening, it ultimately provides a (RT)RAA amplification primer combination for detecting influenza B virus, the target sequence to be detected and a specific crRNA that can target the target sequence, which can achieve highly sensitive and highly specific detection of influenza B virus.

[0011] 2. The present invention does not require complex and precise temperature control equipment; the entire process can be achieved with only a simple and compact constant temperature heating device and an electrochemical workstation. The present invention has high specificity and high sensitivity (10...). 0 With advantages such as high speed (copies / microliter), fast signal response, and simple operation, it is suitable for on-site testing. It has significant application value in the detection and identification of influenza B virus infection. Attached Figure Description

[0012] Figure 1 This is a schematic diagram of the present invention.

[0013] Figure 2 A schematic diagram for target selection.

[0014] Figure 3A To amplify 10 using (RT)RAA-F1 and (RT)RAA-R1 primer sets 2 Figure 1: CRISPR fluorescence detection results of crRNA screening after copying / microliter concentration of plasmid; Figure 3BTo amplify 10 using (RT)RAA-F1 and (RT)RAA-R1 (RT)RAA primers 2 Figure 1 shows the analysis of CRISPR fluorescence detection results for crRNA screening after copying / microliter concentration of plasmid; Figure 4A To amplify 10 using (RT)RAA 9 sets of primers respectively 2 Figure showing the primer screening results for CRISPR-Cas13a fluorescence detection using crRNA2 for copies / microliter concentration plasmids; Figure 4B Based on Figure 4A Analysis of primer screening results based on fluorescence values ​​when x=2Cycles; Figure 4C Based on Figure 4A Heatmap analysis of primer screening results based on fluorescence values ​​when x=2Cycles; Figure 5A Figure showing the sensitivity results of the CRISPR-Cas13a electrochemical system for detecting influenza B virus nucleic acid. Figure 5B Figure 1. Analysis of the sensitivity results of CRISPR-Cas13a electrochemical system for detecting influenza B virus nucleic acid. Figure 6A Figure showing the results of CRISPR-Cas13a electrochemical system for detecting the specificity of influenza B virus nucleic acid in the CRISPR-Cas13a system. Figure 6B Figure 1 shows the analysis results of the CRISPR-Cas13a electrochemical system for detecting the specificity of influenza B virus nucleic acid. Detailed Implementation

[0015] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0016] The reagents and their sources involved in the following examples are as follows: NTP mix (NEB, N0466S), RNase inhibitor (Murine RNase inhibitor, NEB, M0314L), T7 RNA polymerase (NEB, M0251L), 2*Taq PCR MasterMix (Jiangsu Kangwei Century, CW2965M), NEB T7 Rapid and Efficient RNA Synthesis Kit (NEB, USA, E2050S), Tris Balanced Phenol (Solepro, T0250), Chloroform (Sinopharm Group, 10006818), RNA purification magnetic beads (Beckman Coulter, A63987), (RT) RAA amplification kit (Hangzhou Zhongce, S001ZC), (RT) RAA amplification kit (fluorescent type) (Hangzhou Zhongce, S002ZC), electrochemical reporter RNA (TAKARA, FAM-20U-Biotin), RNase-free Enzyme-free water (TaKaRa, 9012), HEPES buffer (ThermoFisher, 15630080), MgCl2 solution (ThermoFisher, AM9530G), LwCas13a protein (Nanjing GenScript, P50502002).

[0017] Example 1: Principle of electrochemical influenza B virus detection based on (RT)RAA / CRISPR.

[0018] Detection designs based on (RT)RAA / CRISPR, such as Figure 1 As shown, it includes the following steps: 1. RT-RAA isothermal amplification The isothermal amplification system is the reaction system recommended in the RT-RAA nucleic acid amplification kit instructions (template volume is 5 μL). The reaction system consists of: 1 tube of reaction powder, 25 μL of Buffer A, 2.5 μL of Buffer B, 2 μL of RT-RAA upstream primer (10 μmol), 2 μL of RT-RAA downstream primer (10 μmol), 13.5 μL of enzyme-free water, and 5 μL of RNA sample. The RT-RAA amplification steps are as follows: ① Prepare a mixture containing A Buffer, 10 μmol of RT-RAA upstream primer, 10 μmol of RT-RAA downstream primer, and enzyme-free water according to the reaction system. Mix well and add the mixture to the detection unit tube containing the reaction powder. ② Add the RNA sample to the detection unit tube. ③ Add B Buffer to the cap of the detection unit tube. ④ Cap the tube, invert and shake gently 5-6 times to mix thoroughly, and centrifuge at low speed for 10 seconds. ⑤ Place the prepared detection unit tube in a 42℃ constant temperature metal bath and incubate for 30 minutes until amplification is complete.

[0019] RT-RAA (Reverse Transcription Recombinase-Aided Amplification) isothermal amplification technology offers advantages such as high sensitivity, rapid efficiency, no need for complex equipment, and ease of operation. It can rapidly amplify RNA at low temperatures, making it suitable for high-sensitivity applications such as virus detection, and it eliminates the need for expensive thermal cyclers, requiring only simple temperature control equipment.

[0020] 2. Steps and parameter settings for T7 transcription The T7 transcription system is as follows: 2 μL NTP Buffer Mix (25 mM), 1 μL Murine RNase Inhibitor (40 U / μL), 0.5 μL T7 RNA Polymerase (50 U / μL), 0.5 μL HEPES (1 M), 0.25 μL MgCl2 (1 M), 10.75 μL BeyoPure™ Ultrapure Water (RNase / DNase-free, Sterile), 2.5 μL RNaseAlert™ Substrate V2 (2 μmol / L), 1.5 μL crRNA (100 ng / μL), 1 μL GenCRISPRTMLwaCas13a Nuclease (1 μmol), 5 μL RT-RAA amplification product, totaling 25 μL.

[0021] Parameter settings: Reaction temperature, 37℃; Reaction time, 1h; Reaction program, (37℃ 45s, 37℃ 1min 15s) * 30 Cycles; The main advantages of T7 transcription include: highly efficient RNA synthesis, capable of rapidly synthesizing large amounts of RNA within 1-2 hours; high specificity, as T7 RNA polymerase can efficiently recognize specific T7 promoter sequences, reducing non-specific transcription; ease of operation, as the in vitro transcription system does not require cell involvement, making it suitable for large-scale RNA synthesis; adjustable product yield, allowing for flexible control of RNA production through optimized reaction conditions; high purity of the produced RNA product, suitable for subsequent experiments such as RNA interference and RNA modification; and wide applications in RNA interference, gene expression analysis, RNA structure research, vaccine development, and synthetic biology, making it the preferred method for RNA synthesis in many research and industrial applications.

[0022] 3. The CRISPR-Cas13a system identifies and binds to the target sequence. Design and synthesize primers for the CRISPR-Cas13a system: Based on the selected conserved β-transfer sequence, design the upstream RT-RAA primer, which contains the T7 promoter sequence with a length of 23 bp. The total length of the upstream primer is 53 bp. The downstream RAA primer is 30 bp in length. When designing the downstream primer, [the following steps are taken regarding reverse [the process]]. The reverse complementation-SMS2 sequence was used in the Nanjing Detai Biotechnology mirror (https: / / www.detaibio.com / sms2 / rev_comp.html) for reverse writing. Three pairs of upstream and downstream primers for RAA amplification were designed using this method. Avoiding the region of the RT-RAA primer, a 28bp crRNA was designed. The upstream primer was a universal template, half of the T7 plus Cas13a protein backbone sequence. The template was the reverse complemented sequence of the protein backbone plus the target. The downstream primer was the first 20 bp of the selected target sequence. Three crRNAs were designed using this method. After primer design, the sequences were sent to a biotechnology company for primer powder synthesis. Upon arrival, the primers were diluted to 10 μmol with enzyme-free water and stored at -20℃ until use.

[0023] The CRISPR-Cas13a fluorescence detection system was configured as follows: 2 μL NTP Buffer Mix (25 mM), 1 μL Murine RNase Inhibitor (40 U / μL), 0.5 μL T7 RNA Ploymerase (50 U / μL), 0.5 μL HEPES (1 M), 0.25 μL MgCl2 (1 M), 10.75 μL BeyoPure™ Ultrapure Water (RNase / DNase-free, Sterile), 2.5 μL RNaseAlert™ Substrate V2 (2 μmol / L), 1.5 μL crRNA (100 ng / μL), 1 μL GenCRISPRTMLwaCas13a Nuclease (1 μmol), and 5 μL RT-RAA amplification product, for a total of 25 μL. The CRISPR-Cas13a fluorescence detection steps are as follows: After preparing the fluorescence detection system according to the reaction quantity, mix it thoroughly by pipetting and dispensing, add the amplification product, centrifuge at low speed for 2 seconds, place it on a real-time PCR instrument, select the FAM channel (excitation wavelength 490nm, emission wavelength 520nm), and incubate at a constant temperature of 37℃.

[0024] The parameters were set as follows: 37℃ for 15s, 37℃ for 1 min 45s, with 2 min constituting one cycle, for a total of 30 cycles. Fluorescence signals were acquired every 2 min for a total of 60 min, and changes in fluorescence values ​​were monitored in real time. The experimental principle is that when crRNA recognizes the target sequence, it activates the non-specific cleavage function of the Cas13a protein, cutting single-stranded RNA present in the solution.

[0025] The CRISPR-Cas13a system boasts numerous advantages, including high specificity, high sensitivity, ease of operation, rapid detection, and the elimination of the need for complex equipment, making it a highly promising nucleic acid detection technology. It not only provides accurate RNA detection but also has applications in various fields, including virus detection, gene diagnostics, and basic research. With continuous technological advancements, the CRISPR-Cas13a system is expected to become a crucial tool for nucleic acid detection in the future.

[0026] The CRISPR-Cas13a electrochemical detection system was configured as follows: 4 μL NTP Buffer Mix (25 mM), 4 μL T7 RNA Ploymerase (10 U / μL), 1 μL HEPES (1 M), 1 μL MgCl2 (1 M), 22 μL BeyoPure™ UltrapureWater (RNase / DNase-free, Sterile), 2 μL electrochemical reporter RNA (20 μmol), 1 μL crRNA (100 ng / μL), 3 μL GenCRISPRTMLwaCas13a Nuclease (1 μmol), and 5 μL RT-RAA amplification product, for a total of 40 μL.

[0027] The detection steps for the CRISPR-Cas13a electrochemical biosensor are as follows: ① After preparing the CRISPR-Cas13a electrochemical detection system according to the reaction quantity, mix it by pipetting and add 2 μL of amplification product and incubate it in a metal bath at 37℃ for 30 min; ② Take 36 μL of streptavidin magnetic beads into a 0.2 PCR tube (one system is 36 μL) and wash three times with enzyme-free water. Discard the supernatant and place it on a magnetic rack to stand for 1 min. ③ Place the incubated detection system into a PCR tube containing magnetic beads, aspirate and mix well, and let stand at room temperature for 1 minute. This process can separate biotin and leave methylene blue in the detection solution. ④ Place the PCR tube containing the test solution and magnetic beads on a magnetic rack and let it stand for 2 minutes; ⑤ Using the Chenhua CHI660E electrochemical workstation, set the square wave voltammetry detection parameters as follows: initial potential -0.5V, termination potential 0V, potential increment 0.006V, amplitude 0.05V, frequency 50 Hz, settling time 2 s, and detection sensitivity 10E-6A. ⑥ Draw a drop of test solution, add it to the electrode sheet and spread it evenly, covering the working electrode, auxiliary electrode and reference electrode, and wait for the test results.

[0028] The advantage of this electrochemical detection method is that it can detect target molecules without the need for electrode pretreatment, making it more convenient and simpler to operate compared to general electrochemical detection methods.

[0029] Step S1: First, viral nucleic acid is extracted and processed, with the viral nucleic acid serving as the sample to be tested. Step S2: After the sample to be tested is processed, the viral nucleic acid is amplified using selected (RT)RAA amplification primers containing the T7 promoter sequence to obtain a target sequence containing the T7 promoter, which can be recognized and transcribed by T7 RNA polymerase in subsequent steps. Step S3: The (RT) RAA amplification product is then used for CRISPR detection. The DNA sequence with the T7 promoter is recognized by the T7 RNA polymerase in the system and transcribed into single-stranded RNA. The crRNA can specifically recognize the target sequence. After recognition, it activates the non-specific trans-cleavage activity of the Cas13a protein, cleaving the electrochemical reporter RNA probe in the system into MB and biotin residues. In step S4, the obtained reaction system was subjected to adsorption and separation of biotin groups using streptavidin immunomagnetic beads, and the redox peak signal of methylene blue remaining in the test solution was detected using square wave voltammetry with an electrochemical workstation.

[0030] The criteria for judging the results are as follows: The positive threshold is the peak value of the negative oxidation current plus three standard deviations. Samples above the positive threshold are considered positive samples, and samples below the positive threshold are considered negative samples.

[0031] Establishment of pathogen detection methods: 1. (RT)RAA amplification of the target fragment.

[0032] Nucleic acid is extracted from the sample to be tested as the target nucleic acid, which is used as a template for pre-amplification.

[0033] The isothermal amplification system is the reaction system recommended in the RT-RAA nucleic acid amplification kit instructions (template volume is 5 μL). The reaction system consists of: 1 tube of reaction powder, 25 μL of Buffer A, 2.5 μL of Buffer B, 2 μL of RT-RAA upstream primer (10 μmol), 2 μL of RT-RAA downstream primer (10 μmol), 13.5 μL of enzyme-free water, and 5 μL of RNA sample.

[0034] The RT-RAA amplification steps are as follows: ① Prepare a mixture containing A Buffer, 10 μmol of RT-RAA upstream primer, 10 μmol of RT-RAA downstream primer, and enzyme-free water according to the reaction system. Mix well and add the mixture to the detection unit tube containing the reaction powder. ② Add the RNA sample to the detection unit tube. ③ Add B Buffer to the cap of the detection unit tube. ④ Cap the tube, invert and shake gently 5-6 times to mix thoroughly, and centrifuge at low speed for 10 seconds. ⑤ Place the prepared detection unit tube in a 42℃ constant temperature metal bath and incubate for 30 minutes until amplification is complete.

[0035] 2. CRISPR-Cas13a fluorescence detection.

[0036] The CRISPR-Cas13a fluorescence detection system is as follows: 2 μL NTP Buffer Mix (25 mM), 1 μL Murine RNase Inhibitor (40 U / μL), 0.5 μL T7 RNA Ploymerase (50 U / μL), 0.5 μL HEPES (1 M), 0.25 μL MgCl2 (1 M), 10.75 μL BeyoPure™ Ultrapure Water (RNase / DNase-free, Sterile), 2.5 μL RNaseAlert™ Substrate V2 (2 μmol / L), 1.5 μL crRNA (100 ng / μL), 1 μL GenCRISPRTMLwaCas13a Nuclease (1 μmol), 5 μL RT-RAA amplification product, totaling 25 μL.

[0037] The CRISPR-Cas13a fluorescence detection procedure is as follows: After preparing the fluorescence detection system according to the reaction quantity, mix thoroughly by pipetting and aliquoting, add the amplification product, centrifuge at low speed for 2 seconds, place on a real-time PCR instrument, select the FAM channel (excitation wavelength 490nm, emission wavelength 520nm), and incubate at 37℃. The program used is: 37℃ for 15s, 37℃ for 1min45s, 2min as one cycle, for a total of 30 cycles. Fluorescence signals are collected every 2min for a total of 60min, and changes in fluorescence values ​​are monitored in real time.

[0038] 3. Electrochemical detection The CRISPR-Cas13a electrochemical detection system is as follows: NTP Buffer Mix (25mM) 4 μL, T7 RNA Ploymerase (10U / μL) 4 μL, HEPES (1M) 1 μL, MgCl2 (1M) 1 μL, BeyoPure™ UltrapureWater (RNase / DNase-free, Sterile) 22 μL, electrochemical reporter RNA (20 μmol) 2 μL, crRNA (100 ng / μL) 1 μL, GenCRISPRTMLwaCas13a Nuclease (1 μmol) 3 μL, RT-RAA amplification product 5 μL, totaling 40 μL.

[0039] The detection steps for the CRISPR-Cas13a electrochemical biosensor are as follows: ① After preparing the CRISPR-Cas13a electrochemical detection system according to the reaction quantity, mix thoroughly by pipetting and add 2 μL of amplification product. Incubate in a metal bath at 37°C for 30 min. ② Rinse the streptavidin magnetic beads (36 μL per system) three times with enzyme-free water, discarding the supernatant and leaving only the magnetic beads in the PCR tube. ③ Place the incubated detection system into the PCR tube containing the magnetic beads, aspirate and mix, and let stand at room temperature for 1 min. ④ Place the PCR tube containing the detection solution on a magnetic rack and let stand for 2 min. ⑤ Using a Chenhua CHI660E electrochemical workstation, set the square wave voltammetry detection parameters as follows: initial potential -0.5 V, termination potential 0 V, potential increment 0.006 V, amplitude 0.05 V, frequency 50 Hz, and standing time 2 minutes. s, the detection sensitivity is set to 10E-6A; ⑥ Draw a drop of detection liquid and add it to the electrode sheet and spread it evenly, covering the working electrode, auxiliary electrode and reference electrode), and wait for the detection results.

[0040] Example 2: Design, preparation and screening of crRNA primers.

[0041] I. Analysis of conserved region sequences and plasmid synthesis.

[0042] Download 600 HA gene sequences of influenza B viruses from October 2023 to March 2024 from the NCBI website, with the output file in FASTA format. Align the sequences using MAFFT Version 7 (MAFFT alignment and NJ / UPGMA phylogeny (cbrc.jp)). Then open the file with CAJViewer 8.1 (version 8.1.73.0). Based on 90% conservation, the selected conserved sequences are located at positions 678-897, with a length of 220 bp. The design diagram is shown below. Figure 2As shown. (The light blue rectangle represents the selected conserved sequence of the influenza HA gene, located at positions 678-897 of the HA gene. The pink rectangle to the left of the light blue rectangle represents the position of the upstream primer (RT) for the RAA designed based on the selected conserved gene region; the purple rectangle to the right represents the position of the downstream primer (RT) for the RAA designed based on the selected conserved gene region. Since the downstream primer needs to be reverse complementary to the original sequence, the arrow points to the left; the blue rectangle in the middle represents the position of the crRNA designed based on the selected conserved gene region.) The plasmid containing the conserved sequence was synthesized by Beijing Bomaide Gene Technology Co., Ltd. The wild-type plasmid will have the following sequence: CAAAGCCCCAGAAGTTCACCTCATCTGCCAACGGAGTGACCACACACTACGTCTCACAGATTGGTGGCTTCCCAAATCAAACAGAAGACGGAGGACTACCACAAAGTGGCAGAATTGTTGTTGATTACATGGTGCAAAAATCTGGAAAAACAGGAACAATTACCTATCAAAGAGGTATTTTGTTGCCTCAAAAGGTGTGGTGCGCAAGTGGCAAGAGCAA (SEQ ID NO. 1); Plasmids were obtained by inserting them into the pUC57 vector. II. Design of crRNA Avoiding the region where RT-RAA primers were designed, a 28bp crRNA was selected for design. The upstream portion was a universal template, half of the T7 plus Cas13a protein backbone sequence. The template itself was the protein backbone with the target sequence inversely complementary. The downstream portion was the first 20 bp of the selected target sequence. Three crRNAs were designed using this method for subsequent selection. The oligonucleotide sequences are shown in Table 1 and were synthesized by Beijing Bomaide Company.

[0043] Table 1. Nucleic acid sequences used for preparing crRNA

[0044] III. Preparation of crRNA (1) PCR amplification: Using crRNA-Template as the amplification template and crRNA-F and crRNA-R as primers, PCR reaction was performed to obtain a crRNA transcription template with the T7 promoter. The PCR reaction system is shown in Table 2. PCR reaction program: pre-denaturation (95℃ for 5 min); denaturation, annealing, and extension (95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s) for 35 cycles; continued extension (72℃ for 10 min).

[0045] Table 2. PCR reaction system for preparing crRNA

[0046] (2) Purification and recovery of PCR products: Tris-balanced phenol and chloroform were vortexed in equal proportions, centrifuged at 10,000 rpm for 10 min, and the supernatant was discarded to prepare nucleic acid extraction reagent. 600 μL of nucleic acid extraction reagent was added to 200 μL of PCR product, vortexed, centrifuged at 10,000 rpm for 5 min, the supernatant was aspirated and mixed with anhydrous ethanol at a ratio of 3:7, centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, 200 μL of 70% ethanol was added, and centrifuged at 10,000 rpm for 10 min. This operation was repeated twice. Finally, the supernatant was discarded, and the white precipitate at the bottom of the tube was left to air dry at room temperature for about 10 min. It was then dissolved in 50 μL of enzyme-free water, and the concentration was finally measured using an ultra-micro spectrophotometer.

[0047] (3) In vitro transcription: 1 μg of purified PCR product (calculate the required product volume based on the measured concentration) was added to 20 μL of T7 RNA polymerase transcription system and incubated at 37°C for 12 h to transcribe crRNA. The transcription system is shown in Table 3.

[0048] Table 3. Reaction system for in vitro transcription of crRNA

[0049] (4) crRNA purification: Shake the RNA Clean XP magnetic beads well, add 36 μL of magnetic beads to the 20 μL system after transcription, mix well and aspirate 10 times, and let stand at room temperature for 3-5 min. Then place on a magnetic rack for 5-10 min until the system is clear, and discard the supernatant. Add 200 μL of 70% ethanol, let stand at room temperature for 30 s, and discard the supernatant (3 times in total). Do not touch the magnetic beads during the operation. Air dry at room temperature for about 10 min. Finally, add 40 μL of enzyme-free water, mix well, and aspirate the supernatant to obtain crRNA. Measure the concentration using an ultra-micro spectrophotometer, and finally dilute to 100 ng / μL and store at -80℃ for later use.

[0050] IV. Screening of crRNA 1. First, use 10 2 Isothermal amplification was performed using copies / µL of influenza B virus plasmid. The isothermal amplification system was the reaction system recommended in the RT-RAA nucleic acid amplification kit instructions (template volume: 5 µL). The reaction system consisted of: 1 tube of reaction powder, 25 µL of Buffer A, 2.5 µL of Buffer B, 2 µL of RT-RAA upstream primer (10 µmol), 2 µL of RT-RAA downstream primer (10 µmol), 13.5 µL of enzyme-free water, and 5 µL of RNA sample.

[0051] 2. The RT-RAA amplification steps are as follows: ① Prepare a mixture containing A Buffer, 10 μmol of RT-RAA upstream primer, 10 μmol of RT-RAA downstream primer, and enzyme-free water according to the reaction system. Mix well and add the mixture to the detection unit tube containing the reaction powder. ② Add the RNA sample to the detection unit tube. ③ Add B Buffer to the cap of the detection unit tube. ④ Cap the tube, invert and shake gently to mix thoroughly 5-6 times, and centrifuge at low speed for 10 seconds. ⑤ Place the prepared detection unit tube in a 42℃ constant temperature metal bath and incubate for 30 minutes until amplification is complete.

[0052] 3. Next, following the CRISPR-Cas13a fluorescence detection system and procedures, crRNA1, crRNA2, and crRNA3 were used to detect the amplification results. The template used for positive samples was the target fragment, and the negative sample was a negative control with RNase-free enzyme-free water instead of crRNA.

[0053] Test results as follows Figure 3A , Figure 3B As shown, all three crRNAs detected wild-type plasmids. The differences in fluorescence values ​​were statistically significant (****: P < 0.0001, ***: P < 0.001). Among them, crRNA2 consistently showed higher fluorescence values ​​than crRNA1 and crRNA3 throughout the detection process. Therefore, crRNA2 (GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACAGGTAATTGTTCCTGTTTTTCCAGATTT (SEQ ID NO. 4)) was selected as the optimal crRNA for detecting influenza B virus.

[0054] Example 3: Design, synthesis and screening of (RT)RAA primers.

[0055] I. Design and Synthesis of (RT)RAA Primers Based on the conserved sequence of the selected plasmid, and following the RAA primer design principles: ① Primer length: 25-35 bp; ② Avoid repeated G and C at the 5' end, and preferably have G or C at the 3' end; ③ The G and C base content should ideally be 30-50%; ④ The product length should ideally be 100-200 bp. Primers for (RT)RAA were designed using Primer 5.0. A T7 promoter sequence was added to the 5' end of the forward primer of the designed RAA primers, allowing the amplified product to be transcribed into RNA by T7 RNA polymerase for crRNA recognition. Three upstream RT-RAA primers and three downstream RT-RAA primers were designed, as shown in the schematic diagram below. Figure 2 As shown in Table 4, the oligonucleotides were synthesized by Beijing Bomeide Gene Technology Co., Ltd.

[0056] Table 4. RT-RAA Primer Sequences

[0057] II. Screening of (RT) RAA primers using isothermal amplification combined with CRISPR-Cas13a fluorescence detection system According to the copy number calculation formula: copies / µL = 6.02 × 10⁻⁶ 23 ×concentration (nanograms / µl) × 10 9 / Plasmid length × 660, dilute the wild-type influenza B virus plasmid to a concentration of 10. 2 The experiment was conducted using copies / µL. The three upstream primers and three downstream primers from Table 2 were paired and combined in pairs. The amplification results were then subjected to CRISPR-Cas13a fluorescence detection (for isothermal amplification and fluorescence detection methods, refer to the section on the establishment of pathogen detection methods).

[0058] Test results as follows Figure 4A , Figure 4B , Figure 4C As shown in the fluorescence detection curve, statistical analysis of the fluorescence values ​​at x=2 cycles among the nine primer pairs used revealed that, except for primer pairs F1R1, F1R2, and F3R2, which showed no statistically significant difference in fluorescence values ​​compared to the negative control group, the other six primer pairs showed statistically significant differences compared to the negative control group (****: P<0.0001, ***: P<0.001; **: P<0.01). A heatmap of the fluorescence values ​​at x=2 cycles showed that the F2 and R3 primer pair had the highest fluorescence value. Therefore, the F2 and R3 primer pair was selected as the optimal primer pair to establish a CRISPR-Cas13a fluorescence detection system for influenza B virus.

[0059] Example 4: Sensitivity evaluation of CRISPR-Cas13a electrochemical detection of influenza B virus based on optimal crRNA and optimal (RT)RAA primers. The wild-type influenza B virus plasmid was serially diluted 10-fold to evaluate the sensitivity of the electrochemical detection method based on optimal crRNA and optimal (RT) RAA CRISPR-Cas13a, and the experimental method in Example 1 was followed.

[0060] The reaction system includes the following substances: The electrochemical reporter RNA (custom-synthesized by Baori Biotechnology (Beijing) Co., Ltd.) consists of 20 units of MB-UUUUUUUUUUUUUUUUUUU-Biotin (where MB is Methylene Blue). The two ends of the electrochemical probe are labeled with MB and biotin, respectively. MB has an electrochemical signal, and biotin can be adsorbed by streptavidin.

[0061] The crRNA2 (GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACaggtaattgttcctgtttttccagattt (SEQ ID No. 4)) screened in Example 1 was used. Primers used were F2 (aattctaatacgactcactataggttcacctcatctgccaacggagtgaccaca (SEQ ID No. 10)) and R3 (cacttgcgcaccacaccttttgaggcaaca (SEQ ID No. 14)) screened in Example 2. The specific steps are as follows: 1. The wild-type influenza B virus plasmid synthesized in Example 1 was serially diluted 10-fold. The diluted plasmid was used as a template, and the amplification product using RNase-free water as a template was used as a negative control. The plasmid was amplified by (RT)RAA according to the steps in Example 1.

[0062] 2. Take 2 μL of (RT) RAA amplification product and detect the (RT) RAA amplification product according to the method in Example 1.

[0063] Test results as follows Figure 5A , Figure 5B As shown, when detecting wild-type influenza B virus plasmids, when the concentration is greater than or equal to 10... 0 When the concentration is less than 10 μL, the result is interpreted as a positive sample; when the concentration is less than 10 μL, the result is interpreted as a positive sample. 0 When the copy / microliter is reached, the result is interpreted as negative. Therefore, the sensitivity of this method for detecting influenza B virus nucleic acid using the CRISPR-Cas13a system is 10. 0 copy / micro-rise.

[0064] Example 5: Evaluation of the specificity of CRISPR-Cas13a electrochemical detection of influenza B virus based on optimal crRNA and optimal (RT)RAA primers. The specificity of the detection method was evaluated using nucleic acids from six other common respiratory infectious diseases, following the method described in Example 1.

[0065] The reaction system includes the following substances: The electrochemical reporter RNA (custom-synthesized by Baori Biotechnology (Beijing) Co., Ltd.) consists of 20 units of MB-UUUUUUUUUUUUUUUUUUU-Biotin (where MB is Methylene Blue). The two ends of the electrochemical probe are labeled with MB and biotin, respectively. MB has an electrochemical signal, and biotin can be adsorbed by streptavidin.

[0066] The crRNA2 (GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACaggtaattgttcctgtttttccagattt (SEQ ID No. 4)) screened in Example 1 was used. Primers used were F2 (aattctaatacgactcactataggttcacctcatctgccaacggagtgaccaca (SEQ ID No. 10)) and R3 (cacttgcgcaccacaccttttgaggcaaca (SEQ ID No. 14)) screened in Example 2. The specific steps are as follows: 1. Using influenza A virus (H1N1) RNA standards, human parainfluenza virus type 1 RNA standards, human rhinovirus type 77 RNA standards, human respiratory syncytial virus type A RNA standards, human respiratory syncytial virus type B RNA standards, and novel coronavirus (SARS-CoV-2) N gene pseudovirus nucleic acid standards as templates, the nucleic acids of 12 different pathogens were amplified by RT-RAA according to the method in Example 1 (CRISPR-Cas13a electrochemical detection). At the same time, the amplification product with the wild-type plasmid of influenza B virus as template was set as a positive control (PC), and the amplification product with RNase-free enzyme-free water as template was set as a negative control (NC).

[0067] 2. Take 2 μL of (RT)RAA amplification product and detect the (RT)RAA amplification product according to the method in Example 1 (CRISPR-Cas13a electrochemical detection).

[0068] Test results as follows Figure 6A , Figure 6B As shown, except for the influenza B virus sample (used as a positive control) which showed a statistically significant difference from the negative control, the other pathogen nucleic acid samples did not show statistically significant differences from the negative control. These results indicate that this detection method has good specificity.

[0069] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A kit for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system, characterized in that, Includes the following components: 1) A set of (RT)RAA primers for electrochemical detection and / or electrochemical nucleic acid detection of influenza B virus based on the CRISPR-Cas13a system; 2) A CRISPR-Cas13a system for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system, comprising Cas13a protein and crRNA, or a complex of the two; 3) A CRISPR-Cas13a electrochemical system for electrochemical nucleic acid detection of influenza B virus, Cas13a protein and crRNA, or a complex of the two; The crRNA is an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the conserved region of the influenza B virus HA gene; the target sequence of the conserved region of the influenza B virus HA gene is located at positions 678-897 of the influenza B virus HA gene; the Cas13a protein is the LwCas13a protein.

2. The reagent kit according to claim 1, characterized in that, The conserved target sequence of the HA gene of the influenza B virus is shown as positions 678-897 of the gene sequence numbered NC_002207.1 in the GenBank database.

3. The reagent kit according to claim 1, characterized in that, The sequences of the (RT)RAA primers and the crRNA primers are shown in SEQ ID No. 1-SEQ ID No.

14.

4. A method for detecting influenza B virus nucleic acid using an electrochemical detection system based on CRISPR-Cas13a, characterized in that, It includes the use of the kit described in any one of claims 1-3.

5. The method according to claim 4, characterized in that, The method further includes using a primer combination for specifically amplifying the target sequence of influenza B virus; the primer combination consists of SEQ ID No. 10 and SEQ ID No.

14.

6. Any of the following substances: A1) The crRNA as described in any one of claims 1-3; A2) The Cas13a protein and crRNA as described in any one of claims 1-3, or a complex thereof; A3) The primer combination as described in claim 5.

7. Any of the following applications: B1) The use of any of the kits described in claims 1-3, any of the methods described in claims 4-5, or any of the substances described in claim 6 in the detection or assistance of electrochemical detection of influenza B virus nucleic acid based on the CRISPR-Cas13a system; B2) The use of the kit according to any one of claims 1-3, the method according to any one of claims 4-5, or the substance according to claim 6 in the preparation of products for detecting or assisting in the electrochemical detection of influenza B virus nucleic acid based on the CRISPR-Cas13a system; B3) The use of the kit according to any one of claims 1-3, the method according to any one of claims 4-5, or the substance according to claim 6 in detecting or assisting in the detection of whether a sample to be tested contains influenza B virus; B4) The use of the kit according to any one of claims 1-3, the method according to any one of claims 4-5, or the substance according to claim 6 in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains influenza B virus; B5) The use of the kit according to any one of claims 1-3, the method according to any one of claims 4-5, or the substance according to claim 6 in screening or assisting in screening drugs for the prevention and treatment of influenza B virus; B6) The use of the kit according to any one of claims 1-3, the method according to any one of claims 4-5, or the substance according to claim 6 in the preparation of products for screening or assisting in screening for influenza B virus prevention and treatment drugs; B7) Use of the substance of claim 7 in any of the kits described in claims 1-3.

8. The application according to claim 7, characterized in that, The application is not for diagnostic purposes.

9. A method for electrochemical detection of influenza B virus nucleic acid based on a CRISPR-Cas13a system, characterized in that, The electrochemical detection method for influenza B virus nucleic acid based on the CRISPR-Cas13a system is a non-diagnostic method. The method includes using any of the kits described in claims 1-3, any of the methods described in claims 4-5, or the substance described in claim 6 to detect whether the sample to be tested is or is a candidate for influenza B virus.

Citation Information

Patent Citations

  • Temperature sensor, method for calibrating the same, and semiconductor device

    US10006818B2