Herpes simplex virus mRNA vaccine as well as preparation method and application thereof

Abstract

The invention provides a herpes simplex virus mRNA vaccine as well as a preparation method and application thereof. According to the present invention, through a series of selection and optimization, the antigen protein suitable for preparing the mRNA vaccine, especially the combination of gD2 and gE1, is obtained, and the divalent vaccine prepared based on the antigen protein has excellent effect. The novel mRNA vaccine disclosed by the invention can efficiently induce humoral immune response, cellular immune response and T cell immune response, so that the novel mRNA vaccine can be effectively used for preventing and controlling herpes simplex virus infection, and can simultaneously cover the prevention and control of two viruses, namely HSV-1 and HSV-2.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology and immunology, and more particularly, the present application relates to a herpes simplex virus mRNA vaccine, a preparation method and application thereof. BACKGROUND

[0002] Herpes simplex virus (HSV) is a kind of double-stranded DNA enveloped virus, which is divided into HSV-1 and HSV-2 according to antigenicity. It is one of the most widely prevalent viruses in the world. Among them, HSV-2 and part of HSV-1 can cause genital herpes, which causes serious life and economic burden to patients and becomes a serious public health problem worldwide.

[0003] HSV-1 is mainly infected through close contact, oral mucosa, nasal mucosa and ocular mucosa, causing oral herpes, ocular conjunctival inflammation, and children infected with HSV-1 are also prone to brain infection, causing severe encephalitis, which can cause high mortality if not treated in time.

[0004] HSV-2 is mainly transmitted through sex, mainly causing herpes of the reproductive system, and genital herpes is most common in women. The infection rate of women is almost twice that of men, and men can cause herpes of the penis. Part of HSV-1 strains can also cause genital herpes, mainly manifested as herpes of the perineum. In a small number of cases, pregnant women infected with HSV-2 or a small number of HSV-1 strains and genital herpes can cause neonatal birth canal infection during delivery, causing neonatal herpes, and severe cases can cause encephalitis, and even death. In addition, HSV-2 infection can increase the risk of HIV infection by about three times, and is one of the important pathogens of sexually transmitted diseases (STD).

[0005] In summary, the current situation of HSV infection is serious and complex, and asymptomatic infection caused by infection is common, which is easy to spread widely in the population. Genital infection caused by HSV-2 seriously affects the quality of life, and is easy to cause infection of other pathogens in immunodeficient population, which is one of the major problems in clinical and public health.

[0006] At present, there is no specific antiviral drug, and no vaccine has been marketed, so it is urgent to develop a new, efficient and broad-spectrum vaccine against herpes simplex virus. SUMMARY

[0007] The purpose of the present application is to provide a herpes simplex virus mRNA vaccine, a preparation method and application thereof.

[0008] In a first aspect of the present application, a method for preparing a herpes simplex virus mRNA vaccine is provided, comprising: (1) providing a recombinant plasmid, wherein a nucleic acid encoding a herpes simplex virus (HSV) surface glycoprotein is introduced; the herpes simplex virus surface glycoprotein is selected from: gD2, gE1, gC1, or a combination thereof; (2) linearizing the recombinant plasmid, transcribing in vitro into mRNA, capping to obtain a modified mRNA, and preparing an mRNA vaccine.

[0009] In one or more embodiments, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1 (gD2-gE1), or a combination of gD2 and gC1 (gD2-gC1); preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1.

[0010] In one or more embodiments, the gD2, gE1, gC1 is a truncated gD2, a truncated gE1, a truncated gC1; wherein the truncated gD2 has a sequence of 26-333 in its full-length amino acid sequence; the truncated gE1 has a sequence of 21-419 in its full-length amino acid sequence; the truncated gC1 has a sequence of 25-480 in its full-length amino acid sequence.

[0011] In one or more embodiments, the nucleic acid encoding the herpes simplex virus surface glycoprotein is introduced into a construct to form a recombinant construct, which is transcribed in vitro into the mRNA; the recombinant construct comprises, operably linked (5'→3'): 5'UTR, nucleic acid encoding an immunoglobulin signal peptide, nucleic acid encoding a herpes simplex virus surface glycoprotein, 3'UTR, polyA.

[0012] In one or more embodiments, in (2), the preparation of the mRNA vaccine comprises: (i) dissolving lipids in anhydrous ethanol to form an organic phase; (ii) dissolving the mRNA in a citric acid buffer to form an aqueous phase; (iii) thoroughly mixing the organic phase with the aqueous phase, and optionally performing ultrafiltration, dialysis, centrifugation, and / or concentration adjustment (including dilution or concentration) to obtain the mRNA vaccine.

[0013] In one or more embodiments, the herpes simplex virus surface glycoprotein further comprises a surface glycoprotein gB, gC, gD, and / or gE derived from gD2, gE1, gC1 of HSV-1 or HSV-2.

[0014] In another aspect of the present application, a recombinant construct for in vitro transcription to produce mRNA is provided, comprising, operably linked (5'→3'): 5'UTR, nucleic acid encoding an immunoglobulin signal peptide, nucleic acid encoding a herpes simplex virus surface glycoprotein, 3'UTR, polyA.

[0015] In one or more embodiments, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1 (gD2-gE1), or a combination of gD2 and gC1 (gD2-gC1); preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1.

[0016] In one or more embodiments, the gD2, gE1, gC1 is a truncated gD2, a truncated gE1, a truncated gC1; wherein the truncated gD2 has a sequence of 26-333 in its full-length amino acid sequence; the truncated gE1 has a sequence of 21-419 in its full-length amino acid sequence; the truncated gC1 has a sequence of 25-480 in its full-length amino acid sequence.

[0017] In another aspect of the present application, there is provided use of the recombinant construct for in vitro transcription of mRNA for preparing a herpes simplex virus mRNA vaccine.

[0018] In another aspect of the present application, there is provided an mRNA vaccine prepared by in vitro transcription of a nucleic acid encoding a herpes simplex virus surface glycoprotein into mRNA, and capping to prepare the mRNA vaccine; the herpes simplex virus surface glycoprotein is selected from gD2, gE1, gC1, or a combination thereof.

[0019] In one or more embodiments, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1 (gD2-gE1), or a combination of gD2 and gC1 (gD2-gC1); preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1.

[0020] In one or more embodiments, the gD2, gE1, gC1 is a truncated gD2, a truncated gE1, a truncated gC1; wherein the truncated gD2 has a sequence of 26-333 in its full-length amino acid sequence; the truncated gE1 has a sequence of 21-419 in its full-length amino acid sequence; the truncated gC1 has a sequence of 25-480 in its full-length amino acid sequence.

[0021] In another aspect of the present application, there is provided use of the mRNA vaccine in preparing a pharmaceutical composition for inhibiting herpes simplex virus infection.

[0022] In one or more embodiments, the mRNA vaccine generates a humoral immune response, a cellular immune response, and a T cell immune response in vivo.

[0023] In one or more embodiments, the mRNA vaccine generates protective neutralizing antibodies against both herpes simplex virus 1 (HSV-1) and herpes simplex virus 2 (HSV-2) in vivo, which persist for a long time.

[0024] In another aspect of the present application, a pharmaceutical composition comprising the mRNA vaccine is provided; or a pharmaceutical kit comprising the mRNA vaccine, or a pharmaceutical composition comprising the mRNA vaccine is provided.

[0025] Other aspects of the present application will be apparent to those skilled in the art from consideration of the disclosure herein. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 , mRNA vaccine construction schematic diagram and mRNA quality detection diagram;

[0027] A: mRNA vaccine construction mode diagram. UTR: untranslated region, SP: signal peptide (human immunoglobulin signal peptide), GOI: Gene Of Interest;

[0028] B: mRNA quality detection.

[0029] Figure 2 , Analysis of in vitro expressed protein of mRNA;

[0030] A-C: Western blot detection of mRNA expressing gC1 (25-480aa), gD2 (26-333aa), gE1 (21-419aa) in HEK293T cells and cell culture supernatant.

[0031] Figure 3 , mRNA candidate vaccine induces humoral immune response in mice;

[0032] A: mRNA vaccination schematic diagram of Balb / c mice;

[0033] B-C: Detection of neutralizing antibodies in mouse serum;

[0034] D: gD2-specific IgG antibody levels in mouse serum after mRNA vaccine vaccination;

[0035] E: gC1-specific IgG antibody levels in mouse serum after gD2-gC1 mRNA vaccine vaccination;

[0036] F: gE1-specific IgG antibody levels in mouse serum after gD2-gE1 mRNA vaccine vaccination;

[0037] The data presented in the charts are mean ± standard error (mean ± SEM). Statistical methods used for comparing differences among multiple groups were one-way ANOVA and Tukey's multiple comparisons test. P ≥ 0.05 indicates no statistical difference (ns), P < 0.05 indicates a statistical difference, and *** indicates P < 0.001, **** indicates P < 0.0001.

[0038] Among them, gC1 is gC1(25-480aa), gD2 is gD2(26-333aa), and gE1 is gE1(21-419aa).

[0039] Figure 4 mRNA candidate vaccines induce cellular immune responses;

[0040] A: Schematic diagram of mice receiving mRNA vaccine;

[0041] B: ELIspot detection of IFN-γ expression in mouse spleen lymphocytes after stimulation with gD2 peptide library;

[0042] C: gD2 peptide library stimulates CD4+ T cells in mouse spleen lymphocytes to secrete cytokines;

[0043] D: Inactivation of HSV-1 stimulates CD4+ T cells in mouse spleen lymphocytes to secrete cytokines;

[0044] The data presented in the charts are mean ± standard error (mean ± SEM). The statistical methods used to compare differences among multiple groups were one-way ANOVA and Tukey's multiple comparisons test. P < 0.05 indicates a statistical difference, and * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0045] Among them, gC1 is gC1(25-480aa), gD2 is gD2(26-333aa), and gE1 is gE1(21-419aa).

[0046] Figure 5 mRNA candidate vaccines induce CD8+ T cell immune responses;

[0047] AD: gD2 peptide library stimulates CD8+ T cells in mouse spleen lymphocytes to secrete cytokines;

[0048] EH: Inactivated HSV-1 stimulates CD8+ T cells in mouse spleen lymphocytes to secrete cytokines;

[0049] The data presented in the charts are mean ± standard error (mean ± SEM). The statistical methods used to compare differences among multiple groups were one-way ANOVA and Tukey's multiple comparisons test. P < 0.05 indicates a statistical difference, and * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0050] Among them, gC1 is gC1(25-480aa), gD2 is gD2(26-333aa), and gE1 is gE1(21-419aa). Detailed Implementation

[0051] Through in-depth research, the inventors have revealed a method for preparing a herpes simplex virus mRNA vaccine, comprising: (1) providing a recombinant plasmid wherein a nucleic acid encoding a surface glycoprotein of herpes simplex virus (HSV) is introduced; wherein the herpes simplex virus surface glycoprotein is selected from: gD2, gE1, gC1, or a combination thereof; and (2) linearizing the recombinant plasmid, transcribing it in vitro into mRNA, capping it to obtain modified mRNA, and preparing an mRNA vaccine. In this invention, through a series of selections and optimizations, antigen proteins suitable for preparing mRNA vaccines were obtained, especially the combination of gD2 and gE1, and the bivalent vaccine prepared based on this has excellent efficacy. The novel mRNA vaccine of this invention can efficiently induce humoral immune responses, cellular immune responses, and T-cell immune responses, thereby effectively preventing and controlling herpes simplex virus infection, and can simultaneously cover the prevention and control of both HSV-1 and HSV-2 viruses.

[0052] As used herein, the herpes simplex viruses include HSV-1 and HSV-2.

[0053] As used in this article, "object" or "individual" or "patient" refers to any target requiring diagnosis or treatment, especially mammalian objects, particularly humans. Of particular concern are objects susceptible to or already infected with herpes simplex virus.

[0054] As used herein, “immunogenicity” or “immunogenicity” refers to the ability of a natural, recombinant, or synthetic peptide to induce a specific humoral and / or cellular immune response in a mammal. The term “antigen” as used herein refers to a peptide that elicits an immune response in a mammal, whether alone or in fusion, or in combination with an accessory molecule (such as a class I or II major histocompatibility antigen molecule).

[0055] As used herein, “immune response” includes cellular and / or humoral immune responses that are sufficient to suppress or prevent infection; or to prevent or suppress the onset of disease caused by microorganisms (especially pathogenic microorganisms).

[0056] As used herein, “operable linkage” refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences.

[0057] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between nucleic acids from different sources and host cells. For example, if the combination of nucleic acids and host cells is not typically naturally occurring, then the nucleic acids are heterologous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0058] As used herein, “containing,” “having,” or “including” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0059] As used herein, "effective amount" or "effective dose" means an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals, as used in this invention.

[0060] As used in this article, a “pharmaceuticalally acceptable” ingredient is a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio.

[0061] After screening and comparison, and considering factors such as the in vivo efficacy of HSV-1 and HSV-2 mRNA and the immunogenicity of the corresponding antigens formed, the inventors selected the HSV viral surface glycoproteins gD2, gE1, and gC1 to prepare the mRNA vaccine. The inventors also prepared truncated molecules of these glycoproteins, thereby achieving highly efficient in vitro transcription and antigen expression. In particular, the gD2-gE1 bivalent vaccine prepared using gD2 and gE1, based on highly efficient in vitro transcription and expression, also exhibits extremely excellent efficacy in inducing an in vivo immune response.

[0062] The inventors have discovered that, given the relative conservation of the gD2 molecule in HSV-1 and HSV-2, it can form a certain degree of cross-immunity between HSV-1 and HSV-2, and the gD2 molecule has abundant CD4+ T cell epitopes and neutralizing antibody epitopes; gE1 can bind to the Fc receptor of IgG, blocking antibody-dependent cellular cytotoxicity (ADCC), and the combination of the two can induce a comprehensive and efficient in vivo immune response (including humoral immune response, cellular immune response and T cell immune response), which has high protective efficacy.

[0063] In addition, gC1 can bind to complement fragment C3b, thereby affecting the activation of the complement bypass pathway, avoiding complement-mediated neutralization, and participating in viral immune escape. The bivalent mRNA vaccine (gD2-gC1) formed by the combination of gC1 and gD2 is also effective.

[0064] In a specific embodiment of the present invention, three candidate mRNA vaccines, gD2, gD2-gC1, and gD2-gE1, were compared and analyzed. After immunization of animals, high levels of humoral and cellular immune responses were detected. The bivalent mRNA vaccines, especially the gD2-gE1 mRNA vaccine, showed superior immunogenicity compared to the monovalent mRNA vaccines.

[0065] Specifically, adding gE1 to gD2 can not only induce a gE1-specific immune response and reactivate ADCC, but also unexpectedly generate higher antibody titers and cellular immune responses against HSV-1 and HSV-2.

[0066] The inventors discovered that the in vitro transcription and expression of full-length gD2, gE1, and gC1 suffers from low transcription and expression efficiency. Through experimental comparison, the inventors modified the proteins to obtain truncated gD2, gE1, and gC1 with shortened amino tails. The truncated gD2 contains the sequence from positions 26 to 333 of its full-length amino acid sequence; the truncated gE1 contains the sequence from positions 21 to 419 of its full-length amino acid sequence; and the truncated gC1 contains the sequence from positions 25 to 480 of its full-length amino acid sequence. Comparison between the truncated and full-length versions showed that the modified proteins exhibited an in vitro transcription efficiency increase of over 26%, and the expression level of the antigen protein was also significantly increased.

[0067] The mRNA described in this invention is obtained via in vitro transcription. In some embodiments, unamplified linearized plasmid DNA is used as template DNA for in vitro transcription. Alternatively, transformed competent cells can be cultured to replicate the plasmid DNA, followed by isolation and purification.

[0068] The present invention provides a recombinant construct for in vitro transcription, the recombinant construct comprising an operably linked (5'→3') region: a 5' untranslated (5'UTR) region, an immunoglobulin signal peptide encoding nucleic acid, a nucleic acid encoding a herpes simplex virus surface glycoprotein, a 3' untranslated (3'UTR) region, and polyA.

[0069] The “5’ untranslated region” (UTR) refers to the mRNA region that does not encode a polypeptide, located directly upstream (i.e., 5’) of the start codon (i.e., the first codon of the mRNA transcript translated by the ribosome).

[0070] The “3' untranslated region” (UTR) refers to the mRNA region that does not encode a polypeptide and is located directly downstream (i.e., 3') of the stop codon (i.e., the codon that indicates the termination of translation of the mRNA transcript).

[0071] A "polyadenylated tail" is located downstream of a 3' UTR containing multiple consecutive adenosine monophosphates (ATPs), such as in an mRNA region directly downstream (i.e., at the 3' end). A polyadenylated tail can contain 10 to 300 ATPs. For example, a polyadenylated tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 ATPs. In some embodiments, a polyadenylated tail contains 50 to 250 ATPs. In the context of a relevant organism (e.g., in a cell, in vivo), the poly(adenylated) tail is used to protect mRNA from enzymatic degradation, such as in the cytoplasm, and facilitates transcription termination and / or nuclear export of mRNA for translation.

[0072] mRNA vaccines can be initiated for translation into proteins (antigens or immunogens) in cells, tissues, or organisms. In exemplary embodiments, the translation occurs in vivo, but embodiments in vitro, in cultures, or outside the body are also contemplated. In exemplary embodiments, cells, tissues, or organisms are contacted with an effective amount of a composition containing an mRNA vaccine, said vaccine containing a polynucleotide having at least one translateable region encoding an antigenic polypeptide.

[0073] The present invention also provides a preferred method for preparing the mRNA vaccine, comprising: (i) dissolving lipids in anhydrous ethanol to form an organic phase; (ii) dissolving the mRNA in citrate buffer to form an aqueous phase; and (iii) thoroughly mixing the organic phase and the aqueous phase, optionally performing ultrafiltration, dialysis, centrifugation, and / or concentration adjustment (including dilution or concentration) to obtain the mRNA vaccine. Although the above method is preferred, mRNA vaccines prepared by other methods with different reagents, based on the technical solutions provided in this invention, may also be included in this invention.

[0074] The mRNA vaccine of this invention can be used to prepare pharmaceutical compositions for the prevention and treatment of herpes simplex virus infection. The composition comprises: an effective amount of the mRNA vaccine of this invention, and a pharmaceutically acceptable carrier.

[0075] The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity after administration. Suitable carriers are well known to those skilled in the art. Pharmaceutically acceptable carriers in compositions may contain liquids such as water, saline, glycerin, and sorbitol. Additionally, these carriers may contain auxiliary substances such as lubricants, flow aids, wetting agents or emulsifiers, pH buffers, and stabilizers such as albumin.

[0076] In use, a safe and effective amount of the mRNA vaccine described in this invention is administered to the recipient. This safe and effective amount is typically at least about 0.01 micrograms per kilogram of body weight, and in most cases does not exceed about 10 milligrams per kilogram of body weight. Preferably, the dose is between about 1 microgram per kilogram of body weight and about 1 milligram per kilogram of body weight. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.

[0077] The mRNA vaccine may be administered prophylactically or therapeutically as part of an active immunization process to healthy subjects or early in the incubation or active infection phase after symptom onset. In some embodiments, the amount of the mRNA vaccine provided to cells, tissues, or subjects may be an amount effective for immunoprophylaxis.

[0078] In alternative formulations, at least one adjuvant may be added to enhance the effect.

[0079] The present invention also provides a medicine box containing the mRNA vaccine or pharmaceutical composition (vaccine composition) described in this invention. Preferably, the medicine box may also include an instruction manual explaining the method of use of the recombinant virus (vaccine) or pharmaceutical composition to guide those skilled in the art in its application.

[0080] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.

[0081] Research materials and methods

[0082] 1. Plasmid

[0083] (1) Plasmid pOK12-mRNA-101PolyA: After double digestion of the pOK12 vector (GenBank: AF223639.1) with HindIII / BamHI, the following sequences were inserted sequentially: T7 promoter (sequence: TAATACGACTCACTAT AGG (SEQ ID NO:4)), 5' UTR (sequence: AAATAAGAGAGAAAAGAAGAGTAAGA AGAAATATAAGAGCCACC (SEQ ID NO:5)), 3' UTR (sequence: TAATAGGCTG GAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTC CCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGA (SEQ ID NO:6)) and polyA (sequence: AAAAA ... The sequence NO:7)) was followed by a polyclonal restriction site sequence (GCGGCCGCATTTAAATGTTTAAACCTTAACATTTAAATGTTTAAAC GCGGCCGC(SEQ ID NO:8)) to facilitate subsequent linearization of the plasmid, thus obtaining the pOK12-mRNA-101PolyA vector.

[0084] (2) Plasmids pShuttle-CMV-gD2, pShuttle-CMV-gE1, and pShuttle-CMV-gC1 were synthesized by Qingke Biotechnology Co., Ltd. The amino acid sequences encoding the gD protein of HSV-2 (GenBank: AIL27720.1), the gE protein of HSV-1 (GenBank no. YP_009137143.1), and the gC protein of HSV-1 (GenBank no. ABM52973.1) were optimized with human codons, chemically synthesized, and cloned into the pShuttle-CMV vector. Using the synthesized plasmids as templates, homologous recombination was used to clone the full-length gD2, gE1, and gC1 between the 5'UTR and 3'UTR of the pOK12-mRNA-101PolyA vector, respectively, to obtain the pOK12-mRNA-gD2-101PolyA, pOK12-mRNA-gE1-101PolyA, and pOK12-mRNA-gC1-101PolyA plasmids. In addition, the self-signal peptides of three antigens, gD2 (1-25aa), gE1 (1-20aa), and gC1 (1-24aa), were replaced with the human immunoglobulin signal peptide sequence (SP sequence: ATGGACTGGACCTGGATTCTGTTCCTCGTGGCCGCCGCTACTCGTGTGCACTC T (SEQ ID NO: 9)) to obtain pOK12-mRNA-SP-gD2-101PolyA plasmid, pOK12-mRNA-SP-gE1-101PolyA plasmid, and pOK12-mRNA-SP-gC1-101PolyA plasmid.

[0085] Subsequently, truncated proteins are also called "truncated".

[0086] (3) Construction of pOK12-mRNA-gD2(truncated)-101PolyA plasmid: Using pShuttle-CMV-gD2 plasmid as template, specific primers were used to amplify the gD2(truncated) sequence (26-333aa), and human immunoglobulin signal peptide and stop codon were added; specific primers were used to amplify the pOK12-mRNA-101PolyA vector, and the gD2(truncated) gene was cloned into the pOK12-mRNA-101PolyA vector using homologous recombination.

[0087] (4) Construction of pOK12-mRNA-gE1(truncated)-101PolyA plasmid: Using pShuttle-CMV-gE1 plasmid as template, specific primers were used to amplify the gE1(truncated) sequence (21-419aa), and human immunoglobulin signal peptide and stop codon were added; specific primers were used to amplify the pOK12-mRNA-101PolyA vector, and the gE1(truncated) gene was cloned into the pOK12-mRNA-101PolyA vector by homologous recombination.

[0088] (5) Construction of pOK12-mRNA-gC1(truncated)-101PolyA plasmid: Using pShuttle-CMV-gC1 plasmid as template, specific primers were used to amplify the gC1(truncated) sequence (25-480aa), and human immunoglobulin signal peptide and stop codon were added; specific primers were used to amplify the pOK12-mRNA-101PolyA vector, and the gC1(truncated) gene was cloned into the pOK12-mRNA-101PolyA vector by homologous recombination.

[0089] (6) The pOK12-mRNA-gD2(truncated)-101PolyA base sequence (from the T7 promoter to PolyA) is as follows (SEQ ID NO:1; the underlined part is the gD2(truncated) portion):

[0090] TAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGACTGGACCTGGATTCTGTTCCTCGTGGCCGCCGCTACTCGTGTGCACTCTGCCACC AAGTACGCCCTGGCCGATCCTA GCCTGAAGATGGCTGACCCCAACAGGTTCCGGGGGAAGAATCTGCCTGTGCTGGATCAGCTGACTGATCCCCCTGGC GTGAAGAGAGTGTACCATATCCAGCCCTCCCTGGAGGACCCCTTTCAGCCTCCTAGCATCCCCATCACCGTGTACTA CGCCGTGCTGGAGCGCGCTTGTAGAAGCGTGCTGCTGCACGCTCCCAGCGAAGCTCCTCAGATCGTGAGAGGCGCCA GCGATGAGGCTAGAAAACACACCTACAACCTGACCATCGCCTGGTATAGAATGGGCGACAACTGCGCCATCCCCATC ACAGTGATGGAATACACCGAATGCCCCTATAACAAGTCCCTGGGCGTGTGTCCCATCCGCACACAGCCTAGATGGTC CTATTATGACAGCTTCAGCGCCGTGAGCGAGGACAATCTGGGATTTCTGATGCACGCCCCAGCCTTCGAGACCGCTG GAACATACCTGCGCCTGGTGAAAATCAACGACTGGACTGAGATCACCCAGTTCATCCTGGAACATAGAGCCAGGGCC TCTTGCAAGTACGCCCTGCCTCTGAGAATCCCCCCCGCTGCTTGTCTGACCTCCAAAGCTTACCAGCAGGGCGTGAC CGTGGACTCAATCGGAATGCTGCCCAGATTCATTCCCGAAAACCAGAGAACCGTGGCCCTGTACAGCCTGAAGATTG CCGGCTGGCACGGCCCTAAGCCTCCTTACACAAGTACCCTGCTGCCCCCCGAGCTGTCTGATACAACCAACGCCACC CAGCCCGAACTGGTGCCTGAAGATCCCGAAGACAGCGCCCTGCTGGAGGATCCTGCTGGAACAGTGAGCAGCCAGAT CCCCCCTAACTGGCACATCCCCTCCATCCAGGACGTGGCTCCTCACCATGCCCCTTAATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGGATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0091] (7) The base sequence of pOK12 - mRNA - gE1(truncated) - 101PolyA (from the start of the T7 promoter to PolyA) is as follows (SEQ ID NO:2; the gE1(truncated) part is underlined):

[0092] TAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGACTGGACCTGGATTCTGTTCCTCGTGGCCGCCGCTACTCGTGTGCACTCTGCCACC GGAACCCCCAAGACCAGCTGGA GAAGAGTGAGCGTGGGCGAGGACGTGAGCCTGCTGCCTGCTCCTGGACCTACAGGAAGAGGCCCTACCCAGAAGCTG CTGTGGGCTGTGGAACCCCTGGACGGATGTGGACCACTGCACCCTTCTTGGGTGTCTCTGATGCCTCCCAAACAGGT GCCAGAAACCGTGGTGGACGCCGCTTGTATGAGAGCCCCTGTGCCTCTGGCCATGGCTTACGCTCCTCCTGCTCCTA GCGCCACTGGAGGACTGAGAACCGACTTCGTGTGGCAGGAGAGAGCCGCTGTGGTGAATAGATCCCTGGTGATCCAT GGCGTGAGAGAGACCGACTCAGGCCTGTACACCCTGAGCGTGGGAGACATTAAAGACCCCGCTAGACAGGTGGCCAG CGTGGTGCTGGTGGTGCAGCCTGCTCCTGTGCCTACACCTCCTCCTACCCCAGCTGACTACGATGAGGACGACAACG ACGAGGGCGAGGACGAAAGCCTGGCTGGAACACCTGCCTCCGGAACACCTAGACTGCCCCCTCCTCCAGCTCCTCCT AGATCTTGGCCCTCCGCTCCTGAGGTGTCTCACGTGAGAGGAGTGACAGTGAGAATGGAGACTCCTGAGGCCATCCT GTTCAGTCCCGGCGAAACCTTCAGCACCAACGTGTCCATCCACGCCATCGCCCACGACGATCAGACCTACAGCATGG ACGTGGTGTGGCTGAGATTCGACGTGCCCACCTCCTGCGCTGAGATGAGAATCTACGAGTCCTGCCTGTACCATCCC CAGCTGCCTGAGTGTCTGAGCCCTGCTGACGCTCCTTGCGCTGCTTCTACTTGGACCAGCCGGCTGGCTGTGAGGTC TTATGCCGGATGCTCCAGGACAAACCCCCCCCCTAGATGCTCCGCTGAAGCTCATATGGAACCCGTGCCCGGCCTGG CTTGGCAGGCTGCTTCTGTGAACCTGGAATTTAGAGACGCCAGCCCCCAGCACAGCGGACTGTACCTGTGTGTGGTG TACGTGAACGACCATATCCACGCCTGGGGGCACATCACCATCAGCACAGCTGCCCAGTACCGCAACGCCGTGGTGGA ACAGCCACTGCCTCAGAGAGGCGCTGACCTGGCTGAACCTACCCATCCACACGTGGGCGCTCCTCCTCATGCTCCTC CTACACACGGCGCTCTGAGA TAATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGGATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0093] (8) The pOK12-mRNA-gC1(truncated)-101PolyA base sequence (from the T7 promoter to PolyA) is as follows (SEQ ID NO:3; the underlined part is the gC1(truncated) portion):

[0094] TAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGACTGGACCTGGATTCTGTTCCTCGTGGCCGCCGCTACTCGTGTGCACTCTGCCACC GGATCTGAGACTGCTTCCACCG GGCCTACCATCACCGCTGGAGCTGTGACTAACGCTAGTGAGGCTCCTACTTCCGGCAGCCCTGGATCTGCTGCTTCT CCTGAGGTGACCCCTACTTCTACCCCCAACCCCAACAACGTGACCCAGAACAAAACCACCCCCACCGAACCCGCCAG CCCTCCTACAACACCTAAACCCACCAGCACCCCCAAAAGCCCCCCAACAAGCACCCCAGACCCCAAACCAAAAAACA ACACCACCCCCGCCAAGAGCGGCAGACCCACCAAGCCCCCCGGCCCCGTGTGGTGCGACAGAAGAGACCCCCTGGCC AGATACGGCAGCAGAGTGCAGATCAGATGCAGATTCAGAAACAGCACCAGAATGGAGTTCAGACTGCAGATCTGGAG ATACAGCATGGGCCCCAGCCCCCCCATCGCCCCCGCCCCCGACCTGGAGGAGGTGCTGACCAACATCACCGCCCCCC CCGGCGGCCTGCTGGTGTACGACAGCGCCCCCAACCTGACCGACCCCCACGTGCTGTGGGCCGAGGGCGCCGGCCCC GGCGCCGACCCCCCCCTGTACAGCGTGACCGGCCCCCTGCCCACCCAGAGACTGATCATCGGCGAGGTGACCCCCGC CACCCAGGGCATGTACTACCTGGCCTGGGGCAGAATGGACAGCCCCCACGAGTACGGCACCTGGGTGAGAGTGAGAA TGTTCAGACCCCCCAGCCTGACCCTGCAGCCCCACGCCGTGATGGAGGGCCAGCCCTTCAAGGCCACCTGCACCGCC GCCGCCTACTACCCCAGAAACCCCGTGGAGTTCGTGTGGTTCGAGGACGACAGACAGGTGTTCAACCCCGGCCAGAT CGACACCCAGACCCACGAGCACCCCGACGGCTTCACCACCGTGAGCACCGTGACCAGCGAGGCCGTGGGCGGCCAGG TGCCCCCCAGAACCTTCACCTGCCAGATGACCTGGCACAGAGACAGCGTGATGTTCAGCAGAAGAAACGCCACCGGC CTGGCCCTGGTGCTGCCCAGACCCACCATCACCATGGAGTTCGGCGTGAGACACGTGGTGTGCACCGCCGGCTGCGT GCCCGAGGGCGTGACCTTCGCCTGGTTCCTGGGCGACGACCCCAGCCCCGCCGCCAAGAGCGCCGTGACCGCCCAGG AGAGCTGCGACCACCCCGGCCTGGCCACCGTGAGAAGCACCCTGCCCATCAGCTACGACTACAGCGAGTACATCTGC AGACTGACCGGCTACCCCGCCGGCATCCCCGTGCTGGAGCACCACGGCAGCCACCAGCCCCCCCCCAGAGACCCCAC CGAGAGACAGGTGATCGAGGCCATCGAGTGGGTGGGC TAATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAAGTCTGAGGATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0095] 2. Main reagents

[0096] E. coil. DH5α competent cells: purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0097] HEK293T and Vero E6 cells: purchased from ATCC.

[0098] HSV-1: A gift from Professor Liang Xiaozhen of the Shanghai Pasteur Institute, Chinese Academy of Sciences.

[0099] HSV-2: A gift from Professor Qian Zhikang of the Shanghai Pasteur Institute, Chinese Academy of Sciences.

[0100] Anti-mouse gD (HSV-1 / 2), Anti-mouse gE (HSV-1), Anti-mouse gC (HSV-1), and other antibodies were purchased from Santa Cruz Biotechnology.

[0101] Goat anti-mouse lgG H&L (HRP): Purchased from Abcam.

[0102] Anti-CD16 / CD32, Anti-mouse IL2 PE, Anti-mouse CD44 PE eFluor610, Anti-mouse CD62L APC, Anti-mouse IFN-γ APC, Anti-mouse TNFα BV605, Anti-mouse CD8 PE-Cy7, Anti-mouse CD4 FITC, Anti-mouse CD3εPerCP-Cy5.5, Anti-mouse IL-4BV421, and Anti-mouse IL-13 PE flow cytometry antibodies were purchased from BD Biosciences.

[0103] 3. Experimental methods and procedures

[0104] (1) Linearized plasmid DNA and DNA template extraction

[0105] The plasmid DNA was linearized using PmeI restriction endonuclease, and DNA was extracted using a phenol:chloroform:isoamyl alcohol = 25:24:1 (pH>8) extraction method, maintaining an RNase-free state throughout the process.

[0106] (2) In vitro transcription and capping purification of mRNA and quality testing of mRNA

[0107] use In vitro transcription was performed using the T7 High Yield RNA Synthesis Kit, with N1-Me-Pseudo UTP sodium solution GMP-grade (100mM) as a substitute; mRNA purification was performed using Lithium Chloride Precipitation Solution (7.5M); mRNA capping was performed using Vaccinia Capping Enzyme (10U / μl) and mRNA Cap 2′-O-Methyltransferase (50U / μl).

[0108] The prepared mRNA was quality tested using an Agilent 2100 bioanalyzer.

[0109] (3) Western blot detection of in vitro mRNA expression

[0110] HEK293T cells were transfected with mRNAs expressing gD2 (truncated), gC1 (truncated), and gE1 (truncated) 24 h later. Samples were lysed using RIPA cell lysis buffer containing the protease inhibitor PIC. After complete lysis, 5× loading buffer was added, and the cells were incubated in a metal bath at 95°C to denature the proteins. An equal volume of protein extract was added to an SDS-PAGE gel for electrophoresis, and then the samples were transferred to a PVDF membrane. After transfer, the samples were blocked with 5% milk powder. The membrane was incubated overnight at 4°C with Anti-mouse gD (HSV-1 / 2), Anti-mouse gE (HSV-1), and Anti-mouse gC (HSV-1). After washing, the membrane was incubated with HRP-conjugated Goat anti-rabbit IgG H&L antibody at room temperature for 2 h, and then exposed to ECL chemiluminescence solution.

[0111] (4) mRNA vaccine preparation and mouse immunization

[0112] Four lipid components—D-Lin-MC3-DMA, DSPC, Cholesterol, and 14:0 PEG200 PE—were dissolved in anhydrous ethanol at concentrations of 25 mg / mL, 50 mg / mL, 25 mg / mL, and 25 mg / mL, respectively. The four lipids were mixed in a molar ratio of 50:10:38.5:1.5 and then added to anhydrous ethanol (RNase-free). A specific mass of mRNA was dissolved in a specific volume of citrate buffer (RNase-free, pH 4) at a mRNA:Lipids (LNP) (wt / wt) ratio of 0.05. The ethanol phase was rapidly injected into the aqueous phase at a v:v ratio of 1:3 and rapidly pipetted for 30 seconds to mix thoroughly. The mixture was then allowed to stand at room temperature for 30 minutes. After a 50-fold dilution with 1×DPBS (sterile), the mixture was centrifuged in 10 kDa ultrafiltration tubes at 4000 g horizontal rotor at 4°C to concentrate it to a final volume of approximately 600 μL. An mRNA vaccine was prepared. Mice were injected intramuscularly with the mRNA vaccine (10 μg per antigen), and booster immunizations were given 2 weeks after the initial immunization.

[0113] Preparation of gD2-gC1 mRNA vaccine: gD2 was transcribed in vitro and encapsulated with LNPs to form gD2-LNP; simultaneously, gC1 was transcribed in vitro and encapsulated with LNPs to form gC1-LNP. The resulting gD2-LNP and gC1-LNP were mixed 1:1 to obtain the gD2-gC1 mRNA bivalent vaccine.

[0114] The gD2-gE1 mRNA bivalent vaccine was prepared using the same method.

[0115] (5) Detection of binding antibodies and neutralizing antibodies in mouse serum

[0116] Peripheral blood was collected from mice every two weeks after booster immunization, and serum was obtained. ELISA was used to detect specific binding antibodies against gD2, gC1, and gE1 in mouse serum. Serum was initially diluted 1:100 and serially diluted 2-fold to 1:12800. The secondary antibody, Goat anti-mouse IgG H&L (HRP), was used at a concentration of 1:100000. Neutralizing antibodies were detected using the fixed virus-dilution serum method, with 100 TCID values ​​for HSV-1 and HSV-2. 50 / well, serum was started at 1:20 and serially diluted 2-fold to 1:1280.

[0117] (6) Detection of effector T cell immune response in mouse spleen lymphocytes

[0118] Two weeks after booster immunization, mice were euthanized, and spleens were collected for single-cell suspension preparation. 1×102 6 Cells were seeded in 96-well plates and stimulated with gD2 peptide library and inactivated HSV-1. After 8 hours, intracellular staining for cytokines or enzyme-linked immunospot (ELISpot) assays were performed. Antibodies used for flow cytometry staining included Anti-CD16 / CD32, Anti-mouse IL2 PE, Anti-mouse IFN-γ APC, Anti-mouse TNFα BV605, Anti-mouse CD8 PE-Cy7, Anti-mouse CD4 FITC, Anti-mouse CD3εPerCP-Cy5.5, and Anti-mouse IL-4 BV421, at a concentration of 1:250. Analyzing was performed using an LSR Tortessa flow cytometer after staining.

[0119] Example 1: Construction of mRNA vaccine plasmids and quality detection of in vitro transcribed mRNA

[0120] In order to better design herpes simplex virus vaccines, the inventors used surface glycoprotein gD2 of HSV-2 virus and surface glycoproteins gC1 and gE1 of HSV-1 virus as candidate immunogens for mRNA vaccines, in order to induce a better immune response and provide cross-immune protection between HSV-1 and HSV-2.

[0121] The inventors optimized each protein by replacing the signal peptides of gD2, gC1, and gE1 with the human immunoglobulin signal peptide SP. The full-length sequences of gD2, gC1, and gE1 after SP replacement were then inserted between the 5'UTR and 3'UTR of the pOK12-mRNA-101PolyA plasmid, respectively, to obtain recombinant plasmids encoding the full-length gD2, gC1, and gE1 signal peptides.

[0122] Meanwhile, the signal peptides of gD2, gC1, and gE1 were retained, and the full-length sequences of gD2, gC1, and gE1 were inserted between the 5'UTR and 3'UTR of the pOK12-mRNA-101PolyA plasmid, respectively, to obtain recombinant plasmids encoding the full-length nucleic acids of gD2, gC1, and gE1.

[0123] After linearizing the plasmids, the three antigens were transcribed in vitro using the six recombinant plasmids mentioned above as templates to prepare the corresponding mRNAs. The prepared mRNAs were transfected into HEK 293 cells, and Western blot analysis was performed to analyze the protein expression levels of full-length gD2, gC1, and gE1. The results showed that when using human immunoglobulin signal peptides, the protein expression levels of gD2, gC1, and gE1 were significantly higher than when using the signal peptides of the three antigens themselves.

[0124] Furthermore, the inventors truncated the N-terminal and C-terminal regions of gD2, gC1, and gE1, further optimizing each protein. The coding sequences of the N-terminal and C-terminal truncated proteins (i.e., gD2 (26-333aa), gE1 (21-419aa), and gC1 (25-480aa)) were inserted between the coding sequence of the human immunoglobulin signal peptide SP and the 3'UTR in the pOK12-mRNA-101PolyA plasmid, resulting in recombinant plasmids containing the coding nucleic acids for gD2 (26-333aa), gE1 (21-419aa), and gC1 (25-480aa), respectively.

[0125] After linearizing the plasmids, the three antigens were transcribed in vitro to prepare the corresponding mRNAs. The in vitro transcription efficiency of full-length gD2, gC1, gE1, and gD2 (26-333 aa), gE1 (21-419 aa), and gC1 (25-480 aa) was analyzed. The results showed that truncating the three antigens, namely gD2 (26-333 aa), gE1 (21-419 aa), and gC1 (25-480 aa), increased the in vitro transcription efficiency by more than 26% (Table 1, increases of 26%, 29%, and 32%, respectively), significantly reducing the preparation cost.

[0126] Table 1

[0127] Increased transcriptional efficiency gD2 (26-333 aa) 26％ gE1 (21-419 aa) 29％ gC1 (25-480 aa) 32％

[0128] Full-length gD2, gC1, and gE1 mRNAs obtained through in vitro transcription were transfected into HEK293T cells for protein expression. Comparison of the protein expression levels of full-length gD2, gC1, gE1, and gD2 (26-333 aa), gE1 (21-419 aa), and gC1 (25-480 aa) showed that the expression levels of gD2 (26-333 aa), gE1 (21-419 aa), and gC1 (25-480 aa) were significantly higher.

[0129] Based on the above, truncated gD2 (26-333 aa), gE1 (21-419 aa), and gC1 (25-480 aa) were used as antigens, and the human immunoglobulin signal peptide sequence was used as the secretion signal of the antigen. Figure 1 A).

[0130] The quality of mRNA prepared by in vitro transcription was tested using a bioanalyzer. For example... Figure 1 As shown in B, the prepared gD2, gC1, and gE1 truncated mRNAs are the expected sizes and have stable and uniform components.

[0131] Example 2: Validation of in vitro expression of mRNA

[0132] HEK293T cells were transfected with 5 μg mRNA encoding gC1 (25-480 aa), gD2 (26-333 aa), and gE1 (21-419 aa) using Lipofectamine 2000. After 24 h, cell supernatant and cell lysate were collected for Western blotting experiments.

[0133] After incubation with the corresponding antibody, the results are as follows: Figure 2 As shown, single bands of the same position and size as predicted can be detected in both cell culture supernatant and cell lysate.

[0134] The above results indicate that mRNA vaccines expressing gC1 (25-480 aa), gD2 (26-333 aa), and gE1 (21-419 aa) prepared by in vitro transcription can correctly express the corresponding antigens in in vitro cell lines.

[0135] Example 3: mRNA candidate vaccine induces high-level humoral immune response in mice

[0136] Using PBS as the control group, the three candidate vaccines were administered intramuscularly to 6-8 week old female Balb / c mice at a dose of 10 μg mRNA vaccine for each antigen (mRNA encapsulated in lipid nanoparticles (LNPs) before injection), with 6 mice in each group. A booster immunization was given two weeks post-immunization using the same dose and method. Figure 3 As shown in Figure A.

[0137] Peripheral blood was collected from mice every two weeks after booster immunization, serum was separated, and ELISA was performed to detect the levels of antibodies specifically binding to gD2, gE1, and gC1 proteins in the serum. Figure 3 As shown in DF.

[0138] The results show that all three candidate vaccine groups produced high levels of binding antibodies IgG, while the control group did not produce any binding antibodies. Furthermore, long-term antibody monitoring (week 14) revealed detectable binding antibodies in all three vaccine groups, with antibody titers remaining consistently high. Additionally, the gD2-specific binding antibody IgG was higher in the two bivalent vaccines than in the monovalent vaccine group.

[0139] The classic neutralizing antibody detection method of fixed virus-diluted serum was used to detect serum neutralizing antibody levels at short-term (week 6) and long-term (week 14) time points after vaccination.

[0140] The results of serum live virus neutralizing antibody results showed ( Figure 3 In the control group, none of the vaccines could neutralize the HSV virus. The monovalent mRNA vaccine gD2 group and the bivalent mRNA vaccines gD2-gC1 and gD2-gE1 could produce specific protective neutralizing antibodies against HSV-1 and HSV-2, with the gD2-gE1 group being particularly effective. Furthermore, the neutralizing antibodies induced by gD2 could not only neutralize HSV-2, but also partially cross-neutralize HSV-1.

[0141] Results regarding neutralizing antibodies against HSV-1 showed that the gD2-gE1 group had significantly higher levels than the gD2 and gD2-gC1 groups. There was no statistically significant difference in neutralizing antibodies produced by the gD2-gC1 group compared to the gD2 group.

[0142] The results of neutralizing antibody tests against HSV-2 in the three vaccine groups showed no statistically significant differences among the three groups.

[0143] In addition, neutralizing antibodies against HSV-1 and HSV-2 could also be detected three months (12 weeks) after booster immunization, and there was no statistically significant difference in the neutralizing antibody against HSV-2 compared with 4 weeks after booster immunization, suggesting that the vaccine can induce protective neutralizing antibodies against HSV for a longer period of time.

[0144] Example 4: mRNA vaccine induces T-cell immune response in mice

[0145] like Figure 4 Mice were vaccinated with an mRNA vaccine. Four weeks post-immunization, an enzyme-linked immunospot (ELIspot) assay was used to detect the secretion of gD2-specific IFN-γ by splenic lymphocytes stimulated by a gD2 peptide library. The results are as follows: Figure 4 As shown in B, all three candidate vaccines, gD2, gD2-gC1, and gD2-gE1, could induce the secretion of gD2-specific IFN-γ by mouse splenic lymphocytes, and there was a statistically significant difference compared with the control group. The gD2-gE1 group secreted the most IFN-γ.

[0146] After stimulation with the gD2 peptide library, mouse splenic lymphocytes secreted CD4+Th1 cytokines IFN-γ, TNF-α, and IL-2. Compared to the control group, all three candidate mRNA vaccines (gD2, gD2-gC1, and gD2-gE1) produced IFN-γ, with the gD2-gE1 group secreting the most, showing a significant difference compared to the gD2 and gD2-gC1 groups. The gD2-gE1 group also produced TNF-α, showing a significant difference compared to the control group. The three vaccine-treated groups showed increased IL-2 secretion. Figure 4 C).

[0147] Simultaneous vaccination can induce mice to produce the CD4+Th2 cytokine IL-4. The gD2-gE1 group showed a highly significant increase compared to the control group, and a very significant increase compared to the gD2 and gD2-gC1 groups; the gD2 and gD2-gC1 groups showed some increase compared to the control group. Figure 4 D).

[0148] The results after stimulation with inactivated HSV-1 were similar to those after stimulation with gD2 peptide library, showing that all three vaccines could effectively activate the release of CD4+Th1 and CD4+Th2 cytokines, and the gD2-gE1 group had a significant advantage in cellular immune response compared with other groups.

[0149] Analysis of CD8+ T cells generated after mRNA inoculation in mice showed that stimulation of mouse splenic lymphocytes with the gD2 peptide library effectively activated CD8+ T cells to secrete IFN-γ, with the gD2-gE1 group showing the strongest secretion. Furthermore, the gD2-gE1 group showed a statistically significant difference from the gD2 and gD2-gE1 groups. Figure 5 A); In addition, the gD2-gE1 group activated CD8+ T cells to secrete IL-4, and there was no statistically significant difference in IL-4 production between the gD2 group and the control group. Figure 5 B); The gD2 peptide library stimulated CD8+ T cells in the spleen of mice to secrete TNF-α. The gD2 group showed a statistically significant difference compared to the control group, while the other two groups showed no statistically significant difference, but the gD2 levels were increased. Figure 5 C); The gD2 peptide library stimulated mouse splenic CD8+ T cells to secrete IL-2. The gD2-gC1 group showed a statistically significant difference compared to the control group, while the other two groups did not show statistically significant differences compared to the control group. However, the gD2-gE1 group showed a significantly higher level. Figure 5 D).

[0150] After stimulation with inactivated HSV-1, mouse splenic lymphocytes produced IFN-γ, IL-4, and IL-2 in the gD2-gE1 vaccine group. Figure 5 The gD2-gC1 group secreted significantly higher levels of IFN-γ and IL-4 than the gD2 group (E, F, and H), and also significantly higher levels of IL-4 secreted than the control group and the gD2 group. There was no statistically significant difference in TNF-α production between the groups and the control group. Figure 5 G).

[0151] in conclusion

[0152] This invention constructed and prepared three herpes simplex mRNA candidate vaccines, and used a primary / booster immunization strategy combined with ELISA and flow cytometry to comprehensively evaluate the differences in immunogenicity of the candidate vaccines.

[0153] The specific contents of this invention include: ① Successfully constructing mRNA expression vectors for gD2, gC1, and gE1, and preparing mRNA using optimized conditions such as in vitro transcription, 100% N1-Me-Pseudo UTP substitution, and capping purification. By comparing the antigen's own signal peptide with the human immunoglobulin signal peptide, and the full-length antigen with the truncated antigen, it was found that the truncated antigen guided by the human immunoglobulin signal peptide had higher in vitro transcription and expression levels. Thus, the immunogen was optimized. ② Using mRNA transfection with HEK293T, Western blotting verified that the mRNA prepared by in vitro transcription had expression activity. ③ Using the ethanol injection method, lipid nanoparticles (LNPs) were prepared and encapsulated with mRNA to prepare mRNA candidate vaccines gD2, gD2-gC1, and gD2-gE1. Mice were immunized using primary / boost intramuscular immunization methods. The levels of antigen-specific binding antibodies in serum were detected by ELISA, and the levels of neutralizing antibodies in serum were detected by live virus neutralization assay. The bivalent vaccine gD2-gE1 showed particularly excellent immunogenicity. ④ Flow cytometry was used to detect and analyze the cellular immune response induced by mRNA candidate vaccines in mice. It was found that all mRNA candidate vaccines could effectively induce a strong cellular immune response in mice, and the cellular immune response produced by the gD2-gE1 group was significantly better overall.

[0154] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference.

Claims

1. A method for preparing a herpes simplex virus mRNA vaccine, comprising: (1) Provide a recombinant plasmid wherein a nucleic acid encoding a herpes simplex virus surface glycoprotein is introduced; wherein the herpes simplex virus surface glycoprotein is selected from: gD2, gE1, gC1, or a combination thereof; (2) Linearize the recombinant plasmid, transcribe it into mRNA in vitro, cap it to obtain modified mRNA, and make an mRNA vaccine.

2. The method as described in claim 1, characterized in that, The herpes simplex virus surface glycoprotein is a combination of gD2 and gE1, or a combination of gD2 and gC1; preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1.

3. The method as described in claim 1, characterized in that, The gD2, gE1, and gC1 are truncated versions of gD2, gE1, and gC1, respectively; wherein the truncated gD2 has the sequence from position 26 to 333 of its full-length amino acid sequence; the truncated gE1 has the sequence from position 21 to 419 of its full-length amino acid sequence; and the truncated gC1 has the sequence from position 25 to 480 of its full-length amino acid sequence.

4. The method according to any one of claims 1 to 3, characterized in that, The nucleic acid encoding the herpes simplex virus surface glycoprotein is introduced into the construct to form a recombinant construct, which is transcribed into the mRNA in vitro. The recombinant construct includes operably linked: a 5'UTR, an immunoglobulin signal peptide encoding nucleic acid, a herpes simplex virus surface glycoprotein encoding nucleic acid, a 3'UTR, and a polyA.

5. The method according to any one of claims 1 to 3, characterized in that, In (2), the preparation of the mRNA vaccine includes: (i) The lipid is dissolved in anhydrous ethanol to form an organic phase; (ii) Dissolve the mRNA in citrate buffer to form an aqueous phase; (iii) The organic phase and the aqueous phase are thoroughly mixed, and ultrafiltration, dialysis, centrifugation and / or concentration adjustment may be performed to obtain the mRNA vaccine.

6. A recombinant construct for in vitro transcription to generate mRNA, said recombinant construct comprising: an operably linked 5'UTR encoding an immunoglobulin signal peptide nucleic acid and an immunoglobulin signal peptide encoding a herpes simplex virus surface glycoprotein nucleic acid, and a 3'UTR, polyA; Preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1, or a combination of gD2 and gC1; preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1. Preferably, gD2, gE1, and gC1 are truncated forms of gD2, gE1, and gC1; wherein, The truncated gD2 has the sequence from position 26 to 333 of its full-length amino acid sequence; the truncated gE1 has the sequence from position 21 to 419 of its full-length amino acid sequence; and the truncated gC1 has the sequence from position 25 to 480 of its full-length amino acid sequence.

7. The application of the recombinant construct of claim 6 for in vitro transcription to generate mRNA, wherein the mRNA is used to prepare a herpes simplex virus mRNA vaccine.

8. An mRNA vaccine, which is prepared by in vitro transcription of the nucleic acid encoding a herpes simplex virus surface glycoprotein into mRNA, capping it, and then preparing the mRNA vaccine; wherein the herpes simplex virus surface glycoprotein is selected from: gD2, gE1, gC1, or a combination thereof; Preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1, or a combination of gD2 and gC1; preferably, the herpes simplex virus surface glycoprotein is a combination of gD2 and gE1. Preferably, gD2, gE1, and gC1 are truncated forms of gD2, gE1, and gC1; wherein, The truncated gD2 has the sequence from position 26 to 333 of its full-length amino acid sequence; the truncated gE1 has the sequence from position 21 to 419 of its full-length amino acid sequence; and the truncated gC1 has the sequence from position 25 to 480 of its full-length amino acid sequence.

9. The use of the mRNA vaccine according to claim 8 in the preparation of a pharmaceutical composition for inhibiting herpes simplex virus infection; Preferably, the mRNA vaccine elicits humoral immune responses, cellular immune responses, and T-cell immune responses in vivo; Preferably, the mRNA vaccine produces protective neutralizing antibodies against both herpes simplex virus 1 and herpes simplex virus 2 in vivo, and the neutralizing antibodies remain present for a long period of time.

10. A pharmaceutical composition or kit comprising the mRNA vaccine of claim 8; the kit comprising the mRNA vaccine of claim 8, or a pharmaceutical composition containing the mRNA vaccine.

Images