Plant lactobacillus for improving pancreas islet dysfunction and diabetic nephropathy and application thereof

Abstract

The invention relates to the technical field of functional probiotic screening and application, and particularly provides a strain of lactobacillus plantarum capable of improving pancreas islet dysfunction and diabetic nephropathy and application of the lactobacillus plantarum capable of improving pancreas islet dysfunction and diabetic nephropathy. The preservation number of the plant lactobacillus is CGMCC (China General Microbiological Culture Collection Center) No.31657, and the plant lactobacillus is screened from excrement of healthy infants, has excellent acid resistance and cholate resistance, is high in oxidation resistance and reducing capacity, can effectively control the rise of fasting blood-glucose level of diabetic mice and can enhance the glucose tolerance of the diabetic mice; and the protein also has the capabilities of improving pancreas islet functions and regulating insulin resistance and insulin sensitivity. The strain has a wide application prospect in preparation of drugs for relieving or treating pancreas islet dysfunction and diabetic nephropathy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of functional microorganism screening and application, and particularly relates to a plant lactobacillus and application thereof for improving pancreatic islet dysfunction and diabetic nephropathy. BACKGROUND

[0002] Diabetic nephropathy (DN) is one of the most common microvascular complications of diabetes mellitus (DM) and the main cause of end-stage renal disease. With the increasing incidence of diabetes worldwide, diabetic nephropathy has become a serious public health problem. Currently, the main treatment methods for diabetic nephropathy include controlling blood glucose, blood pressure and blood lipids, and using certain drugs to delay disease progression. However, the effects of these treatment methods are limited, and there are certain side effects. Therefore, it is of great significance to find new and more effective treatment methods.

[0003] In recent years, more and more studies have shown that the intestinal flora is closely related to the occurrence and development of diabetes and its complications. Imbalance of intestinal flora may lead to insulin resistance, inflammatory response and oxidative stress, etc., thereby accelerating the development of diabetes and its complications. Therefore, by regulating the intestinal flora, it may be possible to effectively intervene in diabetes and its complications. SUMMARY

[0004] The present application aims to provide a plant lactobacillus for improving pancreatic islet dysfunction and diabetic nephropathy (Lactobacillus plantarum W9) and application thereof, which provides a new idea for treating diabetes. Lactiplantibacillus plantarum

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions: In one aspect, the present application provides a plant lactobacillus, named Lactobacillus plantarum W9, which has been preserved in the China General Microbiological Culture Collection Center, located at No. 1, Beichen West Road, Yard 3, Beijing, China Institute of Microbiology, on August 12, 2024, with a preservation registration number of CGMCC No. 31657.

[0006] The present application also provides the application of Lactobacillus plantarum W9 in preparing products with the function of reducing blood glucose.

[0007] The product is a health product or a pharmaceutical product.

[0008] The present application also provides the application of Lactobacillus plantarum W9 in preparing a pharmaceutical product for relieving or treating pancreatic islet dysfunction.

[0009] The present application also provides the application of Lactobacillus plantarum W9 in preparing a pharmaceutical product for relieving or treating diabetic nephropathy. ​

[0010] The application also provides a use of the Lactobacillus plantarum W9 in the preparation of a medicine for treating diabetes.

[0011] The application also provides a microbial agent, wherein the microbial agent comprises the Lactobacillus plantarum W9.

[0012] The microbial agent is prepared into a capsule, a freeze-dried powder or a bacterial liquid preparation.

[0013] The application has the following beneficial effects: The Lactobacillus plantarum W9 is screened from the feces of healthy infants and has excellent acid resistance and bile salt resistance, and the survival rate of the Lactobacillus plantarum W9 is as high as about 107.3% after being treated in simulated gastrointestinal juice for 3 hours, so that the Lactobacillus plantarum W9 can effectively resist the influence of the gastrointestinal juice and is beneficial to the probiotic effect of the Lactobacillus plantarum W9 in the digestive tract.

[0014] The Lactobacillus plantarum W9 has strong antioxidant properties and reducing capacity, and the fermentation supernatant of the Lactobacillus plantarum W9 can effectively scavenge DPPH free radicals, ABTS free radicals and superoxide anion free radicals, and the scavenging rates are as high as 89.90±1.22%, 82.47±3.23% and 88.87±0.95%, respectively, and the reducing power is 81.74±1.20%.

[0015] The Lactobacillus plantarum W9 can effectively control the increase of the fasting blood glucose level of a diabetic mouse, enhance the glucose tolerance capacity of the diabetic mouse, improve the function of an islet, and regulate insulin resistance and insulin sensitivity.

[0016] The Lactobacillus plantarum W9 can significantly reduce the serum urea nitrogen and creatinine levels of a diabetic mouse, improve the kidney function of the diabetic mouse, reduce the contents of pro-inflammatory factors TNF-α, IL-1β and IL-6, increase the content of an anti-inflammatory factor IL-10, effectively improve the serum inflammation level of the diabetic mouse, and improve the oxidative stress level of the kidney of the diabetic mouse.

[0017] The Lactobacillus plantarum W9 has a wide application prospect in the preparation of medicines for relieving or treating islet dysfunction and diabetic nephropathy. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 FIG. 1 is a microscopic examination result of the Lactobacillus plantarum W9; Figure 2 FIG. 2 is a phylogenetic tree based on a 16S rDNA sequence; Figure 3 FIG. 3 is a growth curve of the Lactobacillus plantarum W9; Figure 4The acid tolerance property of Lactobacillus plantarum W9; Figure 5 The bile salt tolerance property of Lactobacillus plantarum W9; Figure 6 The effect of Lactobacillus plantarum W9 on the fasting blood glucose of diabetic mice; Figure 7 The effect of Lactobacillus plantarum W9 on the oral glucose tolerance of diabetic mice; Figure 8 The effect of Lactobacillus plantarum W9 on the area under the curve of oral glucose tolerance of diabetic mice; Figure 9 The effect of Lactobacillus plantarum W9 on the fasting insulin of diabetic mice; Figure 10 The effect of Lactobacillus plantarum W9 on the insulin tolerance of diabetic mice; Figure 11 The effect of Lactobacillus plantarum W9 on the area under the curve of insulin tolerance of diabetic mice; Figure 12 The HE staining sections of pancreatic islets of different groups of mice; Figure 13 The effect of Lactobacillus plantarum on the inflammatory factors IL-6 and IL-1β of pancreatic islets of diabetic mice; wherein A is IL-6 and B is IL-1β; Figure 14 The effect of Lactobacillus plantarum W9 on the serum urea nitrogen and creatinine levels of diabetic mice; wherein A is urea nitrogen and B is creatinine; Figure 15 The effect of Lactobacillus plantarum W9 on the serum inflammatory factor levels of diabetic mice; wherein A is tumor necrosis factor-α (TNF-α); B is interleukin-1β (IL-1β), C is interleukin-6 (IL-6), and D is interleukin-10 (IL-10); Figure 16 The effect of Lactobacillus plantarum W9 on the catalase (CAT) of the kidneys of diabetic mice; Figure 17 The HE staining sections of kidney tissues of different groups of mice. DETAILED DESCRIPTION

[0019] The present application will be further described below in conjunction with specific embodiments. The advantages and features of the present application will become more apparent as the description proceeds. However, these embodiments are only exemplary and do not constitute any limitation on the scope of protection of the present application.

[0020] Example 1: Isolation, screening and identification of the strain 1. Isolation and purification Multiple healthy infant stool samples were collected from Heilongjiang, Liaoning, Jiangsu, Jilin and other regions. The samples were placed in disposable plastic sampling devices previously added with cryoprotectant, and then quickly placed in a -80℃ refrigerator for cryopreservation.

[0021] After the stool samples were thawed at room temperature, they were gradient-diluted with sterile normal saline solution, and 10 -1 to 10 -7 dilution gradient was coated, and three parallel groups were set up. 100 μL of each was uniformly coated on MRS agar medium, and incubated at 37℃ in an inverted incubator for 48 h. Single colonies with different morphologies and colors were picked and divided into three new MRS solid culture media, and the plates were inverted and incubated at 37℃ for 48 h. The single colonies after two rounds of purification were enriched in MRS liquid medium. After the liquid medium became turbid, it was subjected to gram staining, and the morphological characteristics were observed under a microscope. Glycerol preservation was performed, and the samples were stored at -80℃.

[0022] A lactobacillus strain was isolated and purified by the above method, named W9, and the microscopic results are shown in Figure 1 .

[0023] 2. Strain identification The genomic DNA of the W9 strain was extracted using a DNA extraction kit. The 16S rDNA PCR experiment was performed using 341F and 518R universal primers. The PCR product was sent to Shanghai Sangon Company for sequencing. The sequencing results showed that the 16S rDNA sequence of the W9 strain was SEQ ID NO: 1. The sequence was compared with the data in the NCBI database to obtain the best matching species classification information, and the MEGA 5.0 software was used to construct a phylogenetic tree Figure 2 . The results showed that the W9 strain had the highest homology with Lactobacillus plantarum.

[0024] SEQ ID NO: 1 is shown below: TCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAACTCTGTTGTTAAAGAAGAACATATCTGAGAGTAACTGTTCAGGTATTGACGGTATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAAT.

[0025] The W9 strain is named Lactiplantibacillus plantarum W9, and was deposited with the China General Microbiological Culture Collection Center (CGMCC, Beijing, China) on August 12, 2024, under accession number CGMCC No. 31657.

[0026] Example 2 Probiotic properties of Lactiplantibacillus plantarum W9 1. Growth curve of Lactiplantibacillus plantarum W9 After three generations of activation, Lactiplantibacillus plantarum W9 was inoculated into MRS liquid medium at an inoculum of 2%, and incubated at 37°C for 24 h. The bacterial suspension was sampled every 2 h, and the OD value was measured and the growth curve was plotted. 600nm Figure 3 Lactiplantibacillus plantarum W9 has excellent growth performance.

[0027] 2. Evaluation of the acid tolerance of Lactiplantibacillus plantarum W9 Lactiplantibacillus plantarum W9 was inoculated into liquid MRS medium at an inoculum of 2%, and incubated at 37°C for 18 h. The culture was centrifuged at 4000 rpm / min for 10 min at 4°C. The bacterial slurry was washed twice with sterile physiological saline and resuspended to ensure that the activated strain was about 10 8 CFU / mL, then the bacterial suspension was inoculated into MRS medium with pH values of 2.0, 3.0, and 4.0 at an inoculum of 2%, and sampled at 0 h and 4 h, respectively. The samples were diluted with physiological saline to the appropriate concentration and plated on MRS solid medium, which was incubated at 37°C for 48 h, and the viable cell count and survival rate were calculated.

[0028] Survival rate (%) = A2 / A1 x 100%.

[0029] Wherein: A1 represents the viable cell count at 4 h, CFU / mL; A2 represents the viable cell count at 0 h, CFU / mL.

[0030] The results of the acid tolerance are shown in Figure 4 As the pH increases, the survival rate of Lactiplantibacillus plantarum W9 gradually increases; when the pH is 4, the survival rate of Lactiplantibacillus plantarum W9 is higher than 95%, indicating that it has excellent acid tolerance.

[0031] 2. Evaluation of the bile salt tolerance of Lactiplantibacillus plantarum W9 Lactiplantibacillus plantarum W9 was inoculated into liquid MRS medium at an inoculum of 2%, and incubated at 37°C for 18 h. The culture was centrifuged at 4000 rpm / min for 10 min at 4°C. The bacterial slurry was washed twice with sterile physiological saline and resuspended to ensure that the activated strain was about 10 8 ​The activated strain was inoculated in MRS liquid medium with bile salt concentration of 0.5%, 1.0%, and 1.5% respectively at an inoculation amount of 2%, and incubated at 37°C. Samples were taken at 0 h and 4 h. The obtained samples were diluted with normal saline to an appropriate concentration, and then spread on MRS solid medium, which was incubated at 37°C for 48 h. The viable cell count and survival rate were calculated.

[0032] Survival rate (%) = A2 / A1 x 100%.

[0033] Wherein: A1 represents the viable cell count at 4 h, CFU / mL; A2 represents the viable cell count at 0 h, CFU / mL.

[0034] The bile salt tolerance results are shown in Table 1. The survival rate of P. freudenreichii W9 after 4 h under the condition of 1.5% bile salt was as high as 96.34 ± 0.94%, indicating that it has excellent bile salt tolerance. Figure 5

[0035] 4. Evaluation of tolerance in simulated gastrointestinal tract Artificial gastric juice: potassium dihydrogen phosphate 0.24 g / L, sodium phosphate dibasic 1.44 g / L, sodium chloride 8.00 g / L, potassium chloride 0.20 g / L, pepsin 3.00 g / L, and the pH value was adjusted to 2.0.

[0036] Artificial intestinal juice: potassium dihydrogen phosphate 0.24 g / L, sodium phosphate dibasic 1.44 g / L, sodium chloride 8.00 g / L, potassium chloride 0.20 g / L, trypsin 10.00 g / L, and the pH value was adjusted to 7.5.

[0037] The bacterial suspension after three passages was shaken and centrifuged (5000 x g, 10 min, 5°C) to obtain bacterial slurry, which was washed with PBS buffer for 3 times. The obtained bacterial slurry was resuspended in artificial gastric juice or intestinal juice, and incubated at 37°C. Samples were taken at 0 h and 3 h. The obtained samples were diluted with normal saline to an appropriate concentration, and then spread on MRS solid medium, which was incubated at 37°C for 48 h. The viable cell count and survival rate were calculated.

[0038] Survival rate (%) = A2 / A1 x 100%.

[0039] Wherein: A1 represents the viable cell count at 0 h in artificial gastric juice or intestinal juice, CFU / mL; A2 represents the viable cell count after 3 h in artificial gastric juice or intestinal juice, CFU / mL.

[0040] Table 1. In vitro gastrointestinal juice tolerance characteristics of P. freudenreichii W9 Strain number Stomach juice survival rate / % Intestinal juice survival rate / % Lactiplantibacillus plantarum W9 97.38±1.45 107.30±1.07 ​As shown in Table 1, the survival ability of the plant Lactobacillus W9 in simulated gastrointestinal fluid is strong, and the survival rate is still as high as about 107.3% after 3h treatment. Thus, it is shown that the strain has strong acid and bile salt resistance, and can effectively resist the influence of gastrointestinal fluid, so as to maintain high activity after passing through the digestive tract.

[0041] Example 3 Antioxidant properties of plant Lactobacillus W9 1. DPPH free radical scavenging ability In a 96-well plate, 25 μL of sample (plant Lactobacillus W9 bacterial suspension or fermentation supernatant) and 50 μL of DPPH (40 mg of DPPH dissolved in 1000 mL of methanol) were added, and the volume was made up to 200 μL with methanol. Incubation was carried out at 37°C in the dark for 30 min, and the absorbance at 517 nm was measured by a microplate reader. The DPPH free radical scavenging rate was calculated.

[0042] Scavenging rate (%) = 100% x (1-A1 / A0).

[0043] Wherein: A1 is the absorbance of the sample, and A0 is the absorbance of the control.

[0044] The results show that the bacterial suspension and fermentation supernatant of plant Lactobacillus W9 can effectively scavenge DPPH free radicals, with scavenging rates of 30.86±0.88% and 89.90±1.22%, respectively.

[0045] 2. ABTS free radical scavenging ability In a 96-well plate, 80 μL of sample (bacterial suspension or fermentation supernatant) and 120 μL of ABTS were added, mixed well, and then incubated at room temperature for 30 min. The absorbance at 734 nm was read by a microplate reader, and the ABTS free radical scavenging rate was calculated.

[0046] Scavenging rate (%) = 100% x (1-A1 / A0).

[0047] Wherein: A1 is the absorbance of the sample, and A0 is the absorbance of the control.

[0048] The results show that the bacterial suspension and fermentation supernatant of plant Lactobacillus W9 can effectively scavenge ABTS free radicals, with scavenging rates of 26.54±1.97% and 82.47±3.23%, respectively.

[0049] 3. Superoxide anion free radical scavenging ability 0.1 mL sample (bacterial suspension or fermentation supernatant), 0.1 mL pyrogallol solution (0.05 mol / L) and 2.8 mL Tris-HCl buffer (0.05 mol / L) with pH value of 8.2 were mixed thoroughly, and reacted for 4 min at room temperature (25°C) in the dark. 1 mL hydrochloric acid (8 mol / L) was added to terminate the reaction. The OD value at 320 nm was detected by an enzyme marker. Deionized water was used instead of the sample in the blank control group, and the superoxide anion radical scavenging rate was calculated.

[0050] Scavenging rate (%) = 100% x (1-A1 / A0).

[0051] Wherein: A1 is the absorbance of the sample, and A0 is the absorbance of the control.

[0052] The results show that the bacterial suspension and fermentation supernatant of Lactobacillus plantarum W9 can effectively scavenge superoxide anion radicals, with scavenging rates of 48.48±2.52% and 88.87±0.95%, respectively.

[0053] 4. Reducing capacity Potassium ferricyanide is reduced to yellow blood salt, which reacts with Fe 3+ to generate Prussian blue. The amount of Prussian blue generated is used as an index to evaluate the reducing capacity of the strain.

[0054] 0.5 mL sample (bacterial suspension or fermentation supernatant) was mixed with 0.5 mL potassium ferricyanide (1%) and 0.5 mL PBS buffer solution (pH=6.6), shaken thoroughly, and incubated in a 50°C water bath for 20 min. It was rapidly cooled in an ice bath, 0.5 mL trichloroacetic acid (10%) was added, and it was centrifuged at 6,000 rpm for 10 min. 1 mL of the supernatant was taken, 1 mL ferric chloride (0.1%) was added, and the OD value at 700 nm was measured after standing for 10 min. Saline was used instead of the sample as the negative control group.

[0055] Reducing power (%) = 100% x (A1 / A0-1).

[0056] Wherein: A1 is the absorbance of the sample, and A0 is the absorbance of the control.

[0057] The results show that Lactobacillus plantarum W9 has good reducing capacity, with reducing powers of 34.26±0.18% and 81.74±1.20% for the bacterial suspension and fermentation supernatant, respectively.

[0058] Example 4. Application of Lactobacillus plantarum W9 in improving pancreatic islet dysfunction and diabetic nephropathy Lactobacillus plantarum W9 was inoculated into MRS liquid medium and cultured at 37°C for 24 h. After centrifugation at 5000 r / min for 10 min at 4°C, the supernatant was discarded, and the bacterial pellet was obtained. The bacterial pellet was then resuspended in sterile physiological saline. Based on its OD... 600nm Based on absorbance and plate count results, adjust the bacterial count to 1×10⁻⁶. 9 CFU / mL bacterial suspension.

[0059] Male 6-8 week old KKAy and C57BL / 6J mice were acclimatized for 1 week with free access to water and food. KKAy mice were fed a high-fat, high-protein diet, while C57BL / 6J mice were fed a normal diet.

[0060] Mice were further divided into four groups: blank control group (NC), model group (DM), positive control group (MET), and *Lactobacillus plantarum* W9 group (W9), with 8 mice in each group. The positive control group (MET) was given metformin 200 mg / kg, and the *Lactobacillus plantarum* W9 group (W9) was given 1×10 9 The mice were given a bacterial suspension of CFU, while the other two groups received an equal volume of sterile saline. All mice received the intervention once daily at the same time for 5 weeks.

[0061] 1. Fasting blood glucose level The fasting blood glucose levels of mice at week 5 were measured as follows: Figure 6 The fasting blood glucose level of mice in the model group was significantly increased. Compared with the model group, *Lactobacillus plantarum* W9 effectively controlled the rise in fasting blood glucose levels in mice. This indicates that *Lactobacillus plantarum* W9 has a preliminary ameliorative effect on diabetes.

[0062] 2. Glucose tolerance The oral glucose tolerance test (OGTT) is an important indicator of the body's ability to regulate blood glucose. One week before the end of the experiment, mice are fasted for 12 hours but allowed free access to water. Fasting blood glucose levels are measured using a glucometer via the tail vein. Mice are then administered a 20% glucose solution (2 g / kg) by gavage, and blood glucose levels are measured at 30, 60, 90, and 120 minutes. The area under the curve (AUC) is calculated based on these blood glucose values ​​to represent glucose tolerance.

[0063] Depend on Figure 7 The glucose tolerance test showed that the model group mice had poor glucose tolerance; after oral glucose administration, their blood glucose levels rose significantly and decreased slowly. Figure 8 The area under the glucose curve showed that, compared with the model group, the area under the curve of Lactobacillus plantarum W9 group was significantly reduced, indicating that Lactobacillus plantarum W9 can further reduce blood glucose levels by enhancing glucose tolerance.

[0064] 3. Fasting insulin levels and insulin tolerance Fasting insulin levels can be used to evaluate whether pancreatic function is normal. Diabetes can cause elevated fasting insulin levels, leading to abnormal insulin secretion. In week 5 of the experiment, mice in each group were fasted for 12 hours, and blood was collected by enucleation. After blood collection, the blood was allowed to stand at room temperature for 60 minutes, centrifuged at 3000 r / min for 10 minutes, and the supernatant was collected, aliquoted into centrifuge tubes, and stored at -80℃. Insulin levels in each group of mice were measured according to the kit instructions.

[0065] The results are as follows Figure 9 As shown, the fasting insulin level of mice in the model group was significantly higher than that in the blank group, while the intervention of Lactobacillus plantarum W9 could significantly reduce the fasting insulin level, and the relief effect was not significantly different from that of metformin intervention.

[0066] Insulin tolerance tests can be used to assess the degree of response of mice to insulin. After fasting for 12 h, mice in each group were injected intraperitoneally with insulin (0.65 U / kg body weight). Blood glucose levels were measured by collecting blood from the tip of the tail at 0 min, 30 min, 60 min, 90 min, and 120 min.

[0067] The results are as follows Figure 10 As shown, in the model group mice, blood glucose levels decreased after insulin injection, with slight relief after 90 minutes. In the control group mice, blood glucose levels remained stable without significant change after insulin injection. However, in mice treated with *Lactobacillus plantarum* W9, blood glucose levels decreased 30 minutes after insulin injection, then began to recover slowly, reaching near-initial levels at 120 minutes. The area under the insulin tolerance curve is shown in the figure. Figure 11 As shown, intervention with Lactobacillus plantarum W9 significantly restored insulin tolerance in diabetic mice.

[0068] The above results demonstrate that *Lactobacillus plantarum* W9 has the ability to improve pancreatic function and regulate insulin resistance and insulin sensitivity.

[0069] 4. Pancreatic islet damage status Mice were fasted for 12 hours but allowed free access to water. Blood was collected from their eyeballs, and they died from cervical dislocation. Paraffin sections of the pancreas were prepared, stained with hematoxylin and eosin (HE), and observed under a light microscope for morphological observation and photographing, followed by pathological evaluation. The specific steps were as follows: First, the pancreatic tissue was fixed in 10% neutral formaldehyde solution for 24-48 hours. Then, it was dehydrated sequentially with 70%, 80%, 90%, 95%, and 100% ethanol, followed by clearing with xylene, and then embedded in paraffin. The section thickness was generally 4-6 μm. After sectioning, the sections were dewaxed with xylene, hydrated with graded ethanol, stained with hematoxylin for 5-10 minutes, differentiated with 1% hydrochloric acid alcohol for 10-30 seconds, rinsed with running water, blued with ammonia for 1-2 minutes, stained with eosin for 1-2 minutes, and finally dehydrated with graded ethanol, cleared with xylene, and mounted with neutral resin.

[0070] From the experimental results Figure 12 It can be seen that in the normal group, pancreatic β cells are tightly packed, uniform in size, with clear nuclear chromatin and a clear cytoplasmic boundary. In the model group, pancreatic β cells are most severely damaged, with increased islet volume and number, disordered cell arrangement, and some islets rupture, atrophy, and disintegration. Compared with the model group, the pancreatic β cells in the *Lactobacillus plantarum* W9 group are neatly arranged with a clear cytoplasmic boundary. This indicates that *Lactobacillus plantarum* W9 has a certain alleviating effect on pancreatic damage in type 2 diabetic mice.

[0071] 5. Levels of pancreatic inflammatory factors Inflammatory factors can inhibit the initiation of insulin signaling pathways, leading to decreased insulin sensitivity.

[0072] like Figure 13 As shown in Figure A, compared with the control group, the level of interleukin-6 (IL-6) in the pancreatic islets of the model group mice was significantly increased. In contrast to the model group mice, the IL-6 level was significantly decreased in diabetic mice treated with *Lactobacillus plantarum* W9. Figure 13 As shown in Figure B, the level of interleukin-1β (IL-1β) in the pancreatic islets of the model group mice was significantly higher than that in the control group mice, and the intervention of Lactobacillus plantarum W9 significantly alleviated the level of IL-1β.

[0073] The above results demonstrate that Lactobacillus plantarum W9 has the ability to alleviate the levels of inflammatory factors in the pancreatic islets of diabetic mice and can improve the damage to pancreatic islet sensitivity caused by inflammatory factors.

[0074] 6. Kidney function Serum urea nitrogen and serum creatinine levels are two important indicators for evaluating kidney function, reflecting the kidney's ability to excrete metabolic waste.

[0075] Figure 14A represents the effect of *Lactobacillus plantarum* W9 on serum urea nitrogen levels in diabetic mice. The serum urea nitrogen levels in the model group were significantly higher than those in the control group. Intervention with *Lactobacillus plantarum* W9 significantly reduced serum urea nitrogen levels in diabetic mice.

[0076] Figure 14 B represents the effect of *Lactobacillus plantarum* W9 on serum creatinine levels in diabetic mice. Compared to the control group, the serum creatinine levels in the model group were significantly increased, while intervention with *Lactobacillus plantarum* W9 significantly reduced serum creatinine levels in diabetic mice. These results indicate that *Lactobacillus plantarum* W9 has a good ability to improve renal function in diabetic mice.

[0077] 7. Serum inflammatory factor levels Figure 15 A shows the effect of *Lactobacillus plantarum* W9 on serum tumor necrosis factor-α (TNF-α) in diabetic mice. Compared with the control group, the TNF-α level in the model group was significantly increased (P<0.05). After intervention with *Lactobacillus plantarum* W9, the serum TNF-α level in diabetic mice decreased significantly, and was better than that in the positive control group, indicating that *Lactobacillus plantarum* W9 has a good effect on reducing TNF-α.

[0078] Figure 15 B represents the effect of *Lactobacillus plantarum* W9 on serum interleukin-1β (IL-1β) levels in diabetic mice. Compared with the control group, the IL-1β levels in the model group were significantly increased (P<0.05). After intervention with *Lactobacillus plantarum* W9, the serum IL-1β levels in diabetic mice were second only to the positive control group, showing a significant decreasing trend.

[0079] Figure 15 C represents the effect of *Lactobacillus plantarum* W9 on serum interleukin-6 (IL-6) in diabetic mice. Compared with the control group, the IL-6 level in the model group was significantly increased (P<0.05). However, after intervention with *Lactobacillus plantarum* W9, the serum IL-6 level in diabetic mice significantly decreased and was comparable to that in the positive control group.

[0080] Figure 15 D represents the effect of *Lactobacillus plantarum* W9 on serum interleukin-10 (IL-10) in diabetic mice. Compared with the control group, the IL-10 level in the model group was significantly decreased (P<0.05). After intervention with *Lactobacillus plantarum* W9, the serum IL-10 level in diabetic mice was significantly increased, second only to the positive control group.

[0081] The above results indicate that *Lactobacillus plantarum* W9 can effectively improve serum inflammation levels in diabetic mice by significantly reducing the levels of pro-inflammatory factors TNF-α, IL-1β, and IL-6 and significantly increasing the level of anti-inflammatory factor IL-10.

[0082] 8. Kidney oxidative stress level The main function of catalase (CAT) is to catalyze the decomposition of hydrogen peroxide into water and oxygen, thus clearing hydrogen peroxide from the body and protecting cells from the toxic effects of H2O2. It is one of the key enzymes in the biological defense system, providing the body with an antioxidant defense mechanism. Figure 16 It can be seen that the CAT content in diabetic mice is significantly reduced, while the CAT content in the kidneys of the Lactobacillus plantarum W9 group is significantly increased and stronger than that in the positive control group, indicating that Lactobacillus plantarum W9 can significantly improve the oxidative stress level in the kidneys of diabetic mice.

[0083] 9. Kidney tissue damage Figure 15 HE-stained sections of the kidneys of mice in each group are shown. As shown in the figure, the glomeruli and tubules of the normal group mice have intact and clear morphology and structure, normal distribution of extracellular matrix and mesangial cells, and no inflammatory cell infiltration in the kidney region. The model group mice showed glomerular adhesions and mild focal segmental glomerulosclerosis. Glomerular hypertrophy, significant thickening and widening of the tubular basement membrane, mesangial matrix proliferation, narrowing of interstitial space, and mononuclear lymphocyte infiltration in the renal interstitium were observed. These results indicate that diabetes caused kidney damage in mice. In contrast, the glomerular and tubular morphology of diabetic mice in the positive control group and the *Lactobacillus plantarum* W9 group was significantly improved. Intervention with *Lactobacillus plantarum* W9 improved the abnormal changes in the kidneys, reduced inflammatory cell infiltration, and significantly alleviated kidney damage in diabetic mice.

Claims

1. A plant lactobacillus ( Lactiplantibacillus Plantarum ), characterized in that, The preservation number of the *Lactobacillus plantarum* is CGMCC NO. 31657.

2. The use of the *Lactobacillus plantarum* as described in claim 1 in the preparation of products with blood sugar-lowering function.

3. The application as described in claim 2, characterized in that, The product in question is a health supplement or a medicine.

4. The use of the *Lactobacillus plantarum* as described in claim 1 in the preparation of a medicament for relieving or treating pancreatic dysfunction.

5. The use of the *Lactobacillus plantarum* as described in claim 1 in the preparation of a medicine for relieving or treating diabetic nephropathy.

6. The use of the *Lactobacillus plantarum* as described in claim 1 in the preparation of a medicament for treating diabetes.

7. A microbial preparation, characterized in that, The microbial preparation comprises *Lactobacillus plantarum* as described in claim 1.

8. The microbial preparation according to claim 7, characterized in that, The microbial agent is prepared as a capsule, freeze-dried powder, or liquid preparation.

Images