Classical swine fever virus E2 protein-labeled subunit vaccine and its accompanying serological differential diagnostic kit

Abstract

This invention discloses a classical swine fever virus (CSF) E2 protein-labeled subunit vaccine and its accompanying serological diagnostic kit. This invention belongs to the field of medical preparations and relates to a CSF virus E2 protein-labeled subunit vaccine and its accompanying serological diagnostic kit. The recombinant CSF virus E2 protein is obtained by mutating the antigenic epitope of the E2 protein of the CSF virus vaccine strain LPC. The amino acid sequence of the mutant protein is SEQ ID No:1, or a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of SEQ ID No:1. The E2-labeled subunit vaccine prepared using the recombinant E2 protein exhibits excellent immunogenicity. A diagnostic kit is prepared using monoclonal antibodies against the E2 protein of the CSF virus vaccine strain LPC and the DIVA55 recognition epitope of the CSF virus E2 protein, enabling serological differentiation between pigs vaccinated with non-labeled vaccines and those infected with wild-type virus, thereby promoting the eradication of CSF.

Description

Technical Field

[0001] This invention belongs to the field of medical preparations, specifically relating to a classical swine fever virus E2 protein-labeled subunit vaccine and its supporting serological differential diagnostic kit. Background Technology

[0002] Classical swine fever (CSF) is a major animal disease in pigs caused by classical swine fever virus (CSFV), characterized by high morbidity and mortality. This disease seriously threatens the healthy development of the pig farming industry and is listed as a notifiable animal disease by the World Organisation for Animal Health (OIE) and classified as a Class II infectious disease under my country's animal health regulations. Therefore, the prevention and eradication of CSF is crucial for enhancing the core competitiveness of pig farming enterprises. Currently, there are no accompanying specific and highly sensitive differential vaccination kits for CSFV wild-type strain infection among the available CSF vaccines, posing a serious obstacle to CSF ​​eradication. Summary of the Invention

[0003] The main problem this invention aims to solve is how to differentiate between serological differential diagnosis of vaccine immunization and CSFV wild-type strain infection, thereby achieving the eradication of swine fever.

[0004] To address the above problems, this invention provides a recombinant E2 protein-labeled subunit vaccine against classical swine fever virus.

[0005] The recombinant E2 marker protein of classical swine fever virus of the present invention is obtained by mutating the DIVA55 recognition antigen epitope of the LPC E2 protein of classical swine fever virus vaccine strain.

[0006] The amino acid sequence of the E2 protein of the classical swine fever virus vaccine strain LPC is SEQ ID No:3.

[0007] Recombinant E2 marker proteins can be obtained by mutating the wild-type E2 protein at 193P, 195V, 197T, 200L, and 203Q.

[0008] Further, the amino acid sequence of the protein is SEQ ID No:1, or a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of SEQ ID No:1.

[0009] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0010] The tag proteins include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0011] Those skilled in the art can readily mutate the nucleotide sequence of the recombinant E2 protein of the present invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more of the same nucleotide sequence as the recombinant E2 protein isolated according to the present invention, provided that the recombinant E2 protein has recombination function, are derived from and equivalent to the nucleotide sequence of the present invention.

[0012] Furthermore, the encoding nucleotide sequence of the recombinant E2 protein is SEQ ID No:2.

[0013] The present invention also provides a biomaterial, which may be any of the following:

[0014] C1) An expression cassette containing the nucleic acid molecules described above;

[0015] C2) A recombinant vector containing the nucleic acid molecules described above;

[0016] C3) Recombinant microorganisms containing the nucleic acid molecules described above;

[0017] C4) Recombinant host cells containing the nucleic acid molecules described above.

[0018] The expression cassette refers to DNA capable of expressing the aforementioned protein in host cells. This DNA includes not only a promoter to initiate transcription of the target gene but also a terminator to terminate transcription. Furthermore, the expression cassette may also include an enhancer sequence. The vector may be selected from prokaryotic expression vectors (including, but not limited to, E. coli expression vectors such as BL21 series expression cells, M15 expression cells, Top10 expression cells, and Origamai series expression cells) and eukaryotic expression vectors (including, but not limited to, yeast expression vectors such as X33 cells, GS115 cells, and SMD1168 cells, insect cell expression vectors such as Sf21 cells, Sf9 cells, and Hi-5 cells, and mammalian cell expression vectors such as HET293 cells and CHO cells).

[0019] In a specific embodiment of the present invention, the recombinant vector is a vector into which the DNA fragment shown in SEQ ID No:2 is inserted into the multiple cloning site of the pcDNA3.1 vector (e.g., Eco RI and Bam The recombinant plasmid obtained after HI)

[0020] The microorganisms mentioned in this article may be yeast, bacteria, algae, or fungi. Among them, bacteria may originate from the genus *Escherichia* (…). Escherichia Erwinia ( Erwinia Agrobacterium tumefaciens ( ), Agrobacterium tumefaciens Agrobacterium Flavobacterium ( Flavobacterium Alcaligenes ( ) Alcaligenes ), Pseudomonas ( Pseudomonas ), Bacillus spp. ( Bacillus )wait.

[0021] The host cells described in this article are eukaryotic host cells. Further, the nuclear host cells may be HEK293 cells, CHO cells, yeast cells, and insect cells, etc.

[0022] In one specific embodiment, the recombinant host cell is obtained by introducing the recombinant vector into CHO cells.

[0023] This invention also provides a method for preparing recombinant E2 protein, which may include the following steps: (A1) introducing the nucleic acid molecule described above into a host cell to obtain recombinant cells; (A2) culturing the recombinant cells and obtaining recombinant E2 protein from the culture supernatant. The nucleic acid molecule may be introduced into the host cell via the recombinant vector described above.

[0024] The present invention also provides an immunogenic composition comprising a recombinant E2 protein, nucleic acid, or vector of classical swine fever virus as described above.

[0025] The above-mentioned immunogenic composition is a marker vaccine or a vaccine that distinguishes wild-type infected animals from those immunized with the vaccine (abbreviated as DIVA).

[0026] The present invention also provides a recombinant E2 protein-labeled subunit vaccine against classical swine fever virus, comprising: the recombinant E2 protein of classical swine fever virus described above, and a pharmaceutically acceptable adjuvant.

[0027] The vaccine formulation includes any one or a combination of at least two of the following: oral vaccine, intravenous vaccine, arterial vaccine, mucosal vaccine, intramuscular vaccine, subcutaneous vaccine, organ-injected vaccine, and intrathoracic / abdominal vaccine.

[0028] The "adjuvants" used in this invention may include aluminum hydroxide and aluminum phosphate, saponins such as Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, and water-in-oil-in-water emulsions. The emulsion may be particularly based on light liquid paraffin oils (European Pharmacopoeia type); isoprene-like oils, such as squalane or squalene; oils derived from the oligomerization of olefins, particularly isobutylene or decene; esters of acids or alcohols containing straight-chain alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di-(octanoate / decanoate), glyceryl tri-(octanoate / decanoate), or propylene glycol dioleate; esters of branched-chain fatty acids or alcohols, particularly isostearates. The oil is used in combination with an emulsifier to form the emulsion. The emulsifier is preferably a nonionic surfactant, particularly sorbitol esters, mannitol esters (e.g., dehydrated mannitol oleate), glycol esters, polyglycerol esters, propylene glycol esters, and optionally ethoxylated oleic acid, isostearate, castor oil oleate, or hydroxystearate, as well as polyoxypropylene-polyoxyethylene copolymer blocks.

[0029] The adjuvant may be prepared by emulsification with 563VG.

[0030] The volume ratio of the structural protein antigen to the adjuvant is 1:1.

[0031] The present invention also provides a kit for serological identification of classical swine fever virus E2 protein-labeled subunit vaccine and wild-type strain infection, the kit comprising the classical swine fever virus recombinant E2 protein described above or the vaccine described above.

[0032] The test samples for the kit can be environmental samples, blood samples (such as whole blood, plasma, serum), sputum samples, tissue samples, cell samples, fecal samples, etc., but are not limited to these.

[0033] Furthermore, the environmental samples may include feed mill environmental samples (such as feed silos, conveyor belts, workbenches, ground, etc.), aquaculture environmental samples (such as sludge, aquaculture feed, soil, feed troughs, rags used for wiping the environment, swabs, aquaculture water, air, etc.) and surrounding environmental samples (such as transport vehicles, surrounding farmland, etc.).

[0034] The kit may be a chemiluminescent immunoassay kit, enzyme-linked immunosorbent assay kit, immunoprecipitation assay kit, immunoblotting assay kit, immunochromatographic assay kit, flow cytometry assay kit, immunohistochemistry assay kit, colloidal gold immunoassay kit, or fluorescent immunoassay kit, but is not limited thereto.

[0035] Furthermore, the kit may also include reagents required for immunoassay, such as labeled antibodies or antigens, magnetic microparticles, blocking solution, diluent, washing solution, chromogenic solution, stop solution, etc., but not limited to these.

[0036] Furthermore, the kit contains the monoclonal antibody DIVA55, which specifically recognizes the conformational epitope of the classical swine fever virus E2 protein, and the recombinant E2 protein as described above.

[0037] The present invention relates to a DIVA55 protein that recognizes at least one mutation within a conformational epitope, which can lead to specific inhibition of the binding of the monoclonal antibody DIVA55 to such mutated conformational epitope.

[0038] Furthermore, the labeled antibody is a monoclonal or polyclonal antibody obtained using the E2 protein of the classical swine fever virus vaccine strain LPC as an antigen.

[0039] Furthermore, the antibody is a monoclonal antibody. Specifically, the monoclonal antibody is DIVA55.

[0040] The monoclonal antibody or its antigen-binding fragment includes a heavy chain variable region and a light chain variable region; the amino acid sequences of LCDR1, LCDR2, and LCDR3 in the light chain variable region of the antibody are as shown in positions 24-34, 50-56, and 89-97 of SEQ ID No:4, respectively, and LCDR1, LCDR2, and LCDR3 are complementarity-determining regions; the amino acid sequences of HCDR1, HCDR2, and HCDR3 in the heavy chain variable region of the antibody are as shown in positions 31-35, 50-65, and 95-102 of SEQ ID No:5, respectively, and HCDR1, HCDR2, and HCDR3 are complementarity-determining regions.

[0041] The antigen is the E2 protein of the classical swine fever virus vaccine strain LPC.

[0042] The various reagent components of the kit may be present in separate containers, or may be pre-assembled into a reagent mixture, either wholly or partially.

[0043] The components of the kit may be provided in solution form, such as an aqueous solution. When present in aqueous solution, the concentration or content of these components can be readily determined by those skilled in the art according to different needs. For example, for storage purposes, the components may be present at a higher concentration, which can be reduced to the working concentration by diluting the higher concentration solution when in operation or for use.

[0044] The kit may also contain, for example, buffers, preservatives, or protein stabilizers. The kit may also contain components necessary for detecting the detectable label, such as enzymes or substrates. The kit may also contain one or a series of control samples, which can be measured and compared to the test sample. The kit may have written instructions on or included with the kit container. The written instructions describe how to use the reagents included in the kit.

[0045] In one specific embodiment, the kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.

[0046] ELISA is used to detect antibodies in samples against a DIVA55-recognizing epitope labeled with a mutant DIVA55-recognizing epitope according to the present invention or a DIVA55-recognizing epitope of wild-type classical swine fever virus. Such detection includes the mutant DIVA55-recognizing epitope peptide of the present invention or the DIVA55-recognizing epitope peptide of wild-type classical swine fever virus.

[0047] In this invention, the sample refers to a sample of body fluids, a sample of isolated cells, or a sample from a tissue or organ. Body fluid samples can be obtained using known techniques and preferably include samples of blood, plasma, serum, or urine; more preferably, samples of blood, plasma, or serum. Tissue or organ samples can be obtained from any tissue or organ, for example, through a biopsy. Isolated cells can be obtained from body fluids, tissues, or organs using separation techniques such as centrifugation or cell sorting.

[0048] This invention also provides a method for preparing a recombinant E2 protein-labeled subunit vaccine against classical swine fever virus, the specific steps of which are as follows:

[0049] 1) The gene for recognizing the DIVA55-mutated classical swine fever virus recombinant E2 protein was inserted into the pcDNA3.1 expression vector to construct a recombinant expression vector;

[0050] 2) Transfect the above recombinant expression vector into host cells to construct a recombinant protein expression cell line;

[0051] 3) Cultivate the cell line described in step 2), collect the culture supernatant, and obtain the recombinant E2 protein of classical swine fever virus;

[0052] 4) Mix the recombinant E2 protein of classical swine fever virus with an adjuvant, emulsify, and obtain a vaccine containing a marker subunit of recombinant E2 protein of classical swine fever virus;

[0053] The nucleotide sequence encoding the recombinant E2 protein of the classical swine fever virus is SEQ ID No:2.

[0054] This invention also provides the application of the aforementioned recombinant E2 protein of classical swine fever virus in any of the following:

[0055] (B1) Prepare products for recognizing or assisting in the recognition of classical swine fever virus E2 protein;

[0056] (B2) Prepare products that can distinguish between swine fever E2-marked vaccine strains and wild-type strains;

[0057] (B3) Prepare products to identify and distinguish diseases caused by immunization with classical swine fever E2-marked vaccine strains and infection with wild-type strains.

[0058] This invention also provides the use of the aforementioned classical swine fever virus recombinant E2 protein-labeled subunit vaccine in any of the following:

[0059] (B1) Prepare products for recognizing or assisting in the recognition of the classical swine fever virus E2 protein;

[0060] (B2) Prepare products that can distinguish between swine fever E2-marked vaccine strains and wild-type strains;

[0061] (B3) Prepare products to identify and differentiate diseases caused by immunization with classical swine fever E2-marked vaccine strains and infection with wild-type strains.

[0062] Serum samples can be detected using a DIVA55-specific antibody that recognizes the epitope of the wild-type E2 protein. The test samples are from animals suspected of being infected with a wild-type classical swine fever virus strain or immunized with a vaccine containing a recombinant classical swine fever virus E2 protein labeled according to the present invention. Only serum samples infected with a wild-type classical swine fever virus strain will show a positive result for the DIVA55-specific antibody recognizing the epitope.

[0063] The E2-labeled subunit vaccine provided by this invention, due to mutations in the recombinant E2 protein amino acids 193P, 195V, 197T, 200L, and 203Q, does not produce antibodies that react with the wild-type E2 protein DIVA55 recognition epitope after immunizing pigs. In contrast, wild-type strains, live vaccines, or conventional unlabeled E2 protein subunit vaccines can produce corresponding specific antibodies. By combining the detection of DIVA55 antibodies, the identification of pigs infected with non-labeled vaccines or wild-type strains can be achieved, thereby realizing the eradication of classical swine fever. Attached Figure Description

[0064] Figure 1 PCR identification of the recombinant protein expression plasmid of classical swine fever virus E2.

[0065] Figure 2 Immunological identification of recombinant E2 protein of classical swine fever virus.

[0066] Figure 3 The results of SDS-PAGE validation of the purified monoclonal antibody DIVA55 are shown.

[0067] Figure 4The results are from Western blot experiments of monoclonal antibody DIVA55 with mutated and unmutated E2 protein of classical swine fever virus.

[0068] Figure 5 The results were used to validate the expression activity of the monoclonal antibody DIVA55 at IFA. HCLV was a classical swine fever attenuated live vaccine (strain C); SM was a virulent classical swine fever virus SM strain; WH303 was a positive control antibody for the E2 protein; and DIVA55 was a monoclonal antibody against the E2 protein.

[0069] Figure 6 Clinical scoring for testing the protective efficacy of the classical swine fever virus E2 protein-labeled subunit vaccine.

[0070] Figure 7 Viral copy number in each tissue for testing the protective efficacy of the classical swine fever virus E2 protein-labeled subunit vaccine.

[0071] Figure 8 E2 antibody levels were used to test the protective efficacy of classical swine fever virus (CSF) E2 protein-labeled subunit vaccines. A represents the changes in E2 antibody levels after two immunizations with the E2 protein-labeled subunit vaccine (Group 1) and the E2 protein subunit vaccine TWJ-E2 (Group 3), and after challenge with the JL23 strain. B represents the changes in E2 antibody levels after one immunization with strain C (Group 2) and after challenge with the JL23 strain. C represents the changes in E2 antibody levels in unimmunized pigs (Group 4) challenged with the JL23 strain and in unimmunized and unchallenged pigs (Group 5). Detailed Implementation

[0072] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0073] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0074] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0075] The pcDNA3.1 vector used in the following examples was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number A339023.

[0076] The CSFV broad-spectrum antibody WH303 used in the following examples is described in the following literature: Mi Shijiang. Identification of monoclonal antibodies and broad-spectrum monoclonal antibodies for differentiating wild-type and vaccine strains of classical swine fever virus and their antigenic epitope analysis [D]. Jilin University, 2022. The protein-tagged antibody anti-His Tag mAb used in the following examples was purchased from Solarbio, catalog number K200060M.

[0077] The CSFV SM strain, the swine fever rabbit-attenuated live vaccine (HCLV, also known as strain C), and the vaccine strain LPC strain in the following examples have been described in: Shijiang Mi, Lihua Wang, Hongwei Li, et al. Characterization of monoclonal antibodies that specifically differentiate field isolates from vaccine strains of classical swine fever virus. Frontiers in Immunology, 2022, 13, 930631. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0078] The wild-type swine fever virus strain JL23 used in the following examples is described in: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethalchallenge with 4 strains of classical swine fever virus genotype 2. VetMicrobiol. 2019;237:108403. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0079] Example 1: Preparation of recombinant classical swine fever virus E2 protein

[0080] Based on the E2 gene of classic strains and wild-type strains (such as vaccine strain C, LPC strain, and wild-type strains SM and JL23) from both domestic and international sources, this invention mutates the amino acid sequences 193P, 195V, 197T, 200L, and 203Q of the LPC E2 protein to 193V, 195K, 197V, 200P, and 203K, ultimately obtaining a nucleic acid molecule encoding the recombinant E2 protein of classical swine fever virus (nucleotide sequence SEQ ID No:2), which can express the recombinant E2 protein of classical swine fever virus, and its amino acid sequence is shown in SEQ ID No:1.

[0081] 1. Mutation of the E2 gene of classical swine fever virus and construction of eukaryotic expression vector

[0082] Based on the amino acid sequence (SEQ ID No:3) of the E2 protein of the classical swine fever virus (CSFV) vaccine strain LPC (CSFV-LPC), the amino acids 193P, 195V, 197T, 200L and 203Q of the LPC E2 protein (genomic nucleotide sequence is SEQ ID No:6) were mutated to 193V, 195K, 197V, 200P and 203K, respectively, to obtain the nucleotide sequence SEQ ID No:2. In addition to the restriction enzyme sites, the Kozak sequence 5'-GCCACC-3' and the LPC E2 signal peptide sequence 5'-ATGTCAACCACGGCATTTCTCATCTGCTTGGTAAAAGTATTAAGAGGACAGATCGTGCAAGGTGTGATATGGCTGCTATTAGTAACTGGGGCACAAGGC-3' (SEQ ID No:17) are added to the 5' end. A His tag (His tag nucleotide sequence is 5'-CATCATCACCATCACCAT-3', SEQ ID No:18) and restriction enzyme sites are added to the 3' end. Bam After HI (sequence 5'-GGATCC-3') sequence synthesis, the nucleotide sequence SEQ ID No:7 was obtained, which was confirmed by PCR amplification and agarose gel electrophoresis. The results are as follows. Figure 1 As shown.

[0083] The amplified target E2 (mutant) gene fragment was recovered using a gel extraction kit. The correctly identified target E2 gene fragment was digested with enzymes, mixed with the pcDNA3.1 vector and T4 ligase at a 3:1 molar ratio, and ligated overnight at 16°C in a metal bath. 2 μL of the ligation product was mixed with 50 μL of DH5α E. coli competent cells, transformed, and single colonies were picked and cultured. Positive colonies were identified by PCR, and sequencing confirmed the presence of the recombinant expression plasmid pcDNA3.1-E2 (mutant).

[0084] The structure of the pcDNA3.1-E2 (mutant) vector is described below: It is a vector expressed in the eukaryotic expression vector pcDNA3.1. Eco RI and Bam A recombinant vector was obtained by inserting a DNA fragment with the sequence SEQ ID No:7 between the two HI restriction sites while keeping the other sequences of the vector pcDNA3.1 unchanged.

[0085] Based on the E2 protein genome sequence (nucleotide sequence SEQ ID No:6) of the vaccine strain LPC (CSFV-LPC), a recombinant expression plasmid pcDNA3.1-E2 was obtained using the same procedure as a control. The only difference between the pcDNA3.1-E2 vector and the pcDNA3.1-E2 (mutant) vector is that the DNA molecule described in SEQ ID No:7 in the pcDNA3.1-E2 (mutant t) vector is replaced with the DNA molecule described in SEQ ID No:8.

[0086] 2. Expression and identification of the target protein

[0087] CHO cells (ATCC number: CCL-61) were stored at a density of 3-4 × 10⁻⁴ cells / year. 6 CFU / mL, in 50 mL ExpiCHO™ expression medium (purchased from Gibco) TM According to the company (product number 10743029), it was incubated overnight at 37°C in a carbon dioxide shaking incubator with 8% CO2, as per ExpiFectamine. TM The CHO Transfection Kit (purchased from Gibco™, catalog number A29129) instructions describe how to transfect CHO cells with pcDNA3.1-E2 and pcDNA3.1-E2 (mutant) recombinant plasmids, respectively: In two 15 mL centrifuge tubes, add 2 mL of pre-chilled OptiPRO™ SFM buffer to each tube. In one 15 mL tube, add 160 μg of ExpiFectamine™ CHO transfection reagent, and in the other 15 mL tube, add 50 μg of the plasmid to be transfected. Mix each tube thoroughly, then combine them and incubate at room temperature for 5 min. Add ExpiFectamine… TMThe CHO transfection reagent and the complex of the plasmid to be transfected were added to CHO cells, gently shaken to mix, and incubated at 37°C with 8% CO2 for 18 to 22 h with shaking. 12 mL of ExpiCHO™ Feed reagent and 300 μL of ExpiFectamine™ CHO Enhancer reagent were thoroughly mixed and added to the transfected CHO cells, and the cells were cultured for another 8 days. Cell samples were collected, centrifuged at 6000 rpm and 4°C for 30 min, and the culture supernatant was collected. The total protein content in the samples was determined by the Bicinchoninic Acid (BCA) method.

[0088] The expression of the above-described protein was verified by Western blot experiment, and the steps are as follows:

[0089] ① Protein treatment: Add E2 protein (mutated recombinant protein and non-mutated recombinant protein) to 4× loading buffer in proportion and boil for 10 min.

[0090] ② Protein electrophoresis: Load the processed protein (10 μL per lane) into a 10% SDS-PAGE gel and perform protein electrophoresis. The program is 55 V for 50 min and 110 V for 80 min.

[0091] ③ Transfer: Use a semi-dry transfer method to transfer the proteins after electrophoresis to an NC membrane (purchased from GE, catalog number: [list of products]).

[0092] 10600002), the program is 23 V-25 min.

[0093] ④ Blocking: Add 5 g of skim milk powder (purchased from BD, catalog number 232100) to every 100 mL of PBS, and shake thoroughly to prepare the blocking solution. Add 5 mL of blocking solution to a resealable bag and place on a shaker at room temperature to block the NC membrane for 1 h.

[0094] ⑤ Incubation with primary antibody: Anti-His Tag antibody was diluted 1:3000 with blocking buffer and incubated overnight at 4°C on a shaker.

[0095] ⑥ Incubate with secondary antibody: Wash the membrane 3 times with PBS, add Alexa Fluor 680-labeled fluorescent secondary antibody (purchased from Invitrogen, catalog number 8310-16) diluted 1:5000 with PBS, and incubate on a shaker at room temperature in the dark for 1 h.

[0096] ⑦ Scan the NC membrane: Wash the membrane three times with PBS, place it in a two-color infrared laser imaging system for scanning, and save the image.

[0097] The results are as follows Figure 2As shown, the recombinant E2 protein exhibits specific bands around 45 kDa and 90 kDa, indicating successful expression of the recombinant protein.

[0098] 3. Vaccine preparation

[0099] Expression of recombinant E2 marker protein of classical swine fever virus: CHO cells transfected with pcDNA3.1-E2 (mutant) plasmid were cultured in a bioreactor. After optimization, the dissolved oxygen concentration in the bioreactor was between 40% and 50%, the temperature was 27℃, the rotation speed was 40-120 rpm, and the cell density at expression was 2×10⁶ cells / year. 6 Cells / mL were cultured for 150 h to achieve stable expression of over 140 μg / mL, which is 20 μg higher than that obtained by conventional shake-flask culture. Cell debris was removed, and the supernatant was collected as the labeled classical swine fever virus E2 protein solution.

[0100] The classical swine fever virus E2 protein was emulsified with 563VG (Cybex, catalog number: 36025H) to prepare a vaccine: First, the 563VG oil adjuvant was sterilized (121℃, 15pa, 20 min). The protein antigen and adjuvant were mixed at a 1:1 (mass ratio) and emulsified at 5000 rpm for 10 min, stopped for 10 min, and then emulsified again at 5000 rpm for 10 min to obtain the classical swine fever virus E2 protein-labeled subunit vaccine.

[0101] Example 2: Preparation of Antibodies by Genetic Engineering

[0102] Hybridoma cells secreting DIVA55 were sent to Nanjing Detai Biotechnology Co., Ltd. for sequencing. The sequencing results are as follows:

[0103] The amino acid sequence of the heavy chain variable region of monoclonal antibody DIVA55 is shown in SEQ ID No:5, and the nucleotide sequence of the gene encoding the heavy chain variable region is shown in SEQ ID No:10; the amino acid sequence of the light chain variable region of monoclonal antibody DIVA55 is shown in SEQ ID No:4, and the nucleotide sequence of the gene encoding the light chain variable region is shown in SEQ ID No:9. Wherein:

[0104] The amino acid sequence of the CDR1 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 31-35 of SEQ ID No:5;

[0105] The amino acid sequence of the CDR2 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 50-65 of SEQ ID No:5;

[0106] The amino acid sequence of the CDR3 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 95-102 of SEQ ID No:5;

[0107] The amino acid sequence of the CDR1 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 24-34 of SEQ ID No:4;

[0108] The amino acid sequence of the CDR2 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 50-56 of SEQ ID No:4;

[0109] The amino acid sequence of the CDR3 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 89-97 of SEQ ID No:4.

[0110] 1. Construction of recombinant expression plasmids

[0111] To express the monoclonal antibody DIVA55, heavy chain expression vectors and light chain expression vectors were prepared respectively: the nucleotide sequence of the heavy chain gene of the monoclonal antibody DIVA55 was obtained by directly linking the nucleotide sequence of the heavy chain variable region coding gene (SEQ ID No:10) with the mouse-IgG2a template sequence (heavy chain constant region sequence, SEQ ID No:11); the nucleotide sequence of the light chain gene of the monoclonal antibody DIVA55 was obtained by directly linking the nucleotide sequence of the light chain variable region coding gene (SEQ ID No:9) with the mouse-kappa template sequence (light chain constant region sequence, SEQ ID No:12).

[0112] The heavy chain gene and light chain gene of the monoclonal antibody DIVA55 were cloned into the vector pcDNA3.4, respectively, to obtain the heavy chain expression vector and the light chain expression vector. The recombinant vectors pcDNA3.4-H (which can express the heavy chain) and pcDNA3.4-L (which can express the light chain) were synthesized by Nanjing Detai Biotechnology Co., Ltd.

[0113] The structure of pcDNA3.4-H is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:13 between the Xbal and BamHI restriction sites of the eukaryotic expression vector pcDNA3.4, while keeping the other sequences of the vector pcDNA3.4 unchanged. The pcDNA3.4-H vector can express the DIVA55 antibody heavy chain, and its amino acid sequence is SEQ ID No:15.

[0114] The structure of pcDNA3.4-L is described as follows: a DNA fragment with the sequence SEQ ID No:14 is inserted between the two restriction sites Xbal and BamHI of the eukaryotic expression vector pcDNA3.4. The pcDNA3.4-L vector can express the DIVA55 antibody light chain, and its amino acid sequence is SEQ ID No:16.

[0115] 2. Antibody expression

[0116] a) Freshly digested 293T cells (purchased from Cybio, catalog number HEMCL-032) were seeded into 175 cm⁻¹ cells. 2 Add 35 mL of DMEM medium (Corning, catalog number 10-013-CVRC) containing 8% FBS to the culture flask and culture the cells to a density of 90%.

[0117] b) Dilute 200 μg of vector plasmid containing light and heavy chains (100 μg each) and 200 μL of QuickShuttle-293 cell transfection reagent (Biolong, catalog number KX0110044) into 1 mL of physiological saline.

[0118] c) Combine the two solutions from step b) above and mix them well to obtain the complex.

[0119] d) Add the above complex directly to the cell culture medium in step a), and mix well by pipetting.

[0120] e) Transfer the cell plate to a 37ºC / 5% CO2 incubator for culture, and collect the culture supernatant after 3 days of culture.

[0121] 3. Antibody purification

[0122] a) Buffer preparation: Add Na2HPO4·12H2O to sterile ddH2O to make the final concentration 0.2 M, and shake thoroughly to mix.

[0123] b) Preparation of pre-elution buffer: Add 0.1 M citric acid to the buffer solution to make the volume percentage of citric acid 20%.

[0124] c) Preparation of elution buffer: Add 0.1 M citric acid to the buffer solution to make the volume percentage of citric acid 60%.

[0125] d) Sample processing: Take 30 mL of the cell expression supernatant verified in step 3), add the buffer prepared in step a) at a volume ratio of 1:1, filter with a pore size of 0.22 μm and prepare for column loading.

[0126] e) Equilibrate the column: Use a constant flow pump to slowly pass 10 mL of buffer solution through a pre-packed Protein A / G4FF column (purchased from Sangon Biotech, catalog number C600983) at a flow rate of 1 mL / min.

[0127] f) Sample loading: Use a constant flow pump to slowly pass the solution from step d) through the Protein A / G column at a flow rate of 1 mL / min.

[0128] g) Washing: Use a constant flow pump to slowly pass 10 mL of washing buffer through the Protein A / G column at a flow rate of 1 mL / min.

[0129] h) Pre-elution: Use a constant flow pump to slowly pass 10 mL of pre-elution solution through the Protein A / G column at a flow rate of 1 mL / min.

[0130] i) Elution: Use a constant flow pump to slowly pass 15 mL of eluent through the Protein A / G column at a flow rate of 1 mL / min, and aliquot the elution product into 1.5 mL centrifuge tubes.

[0131] The expression of antibodies was verified using an indirect immunofluorescence assay (IFA). The expression supernatant was used as the primary antibody, and the broad-spectrum CSFV antibody WH303 was used as a control. The antibody was compared with the wild-type CSFV strain SM and the rabbit-adapted attenuated classical swine fever vaccine strain C (HCLV) for indirect immunofluorescence assay (IFA). The specific steps are as follows:

[0132] ① Cell inoculation: Simultaneously, CSFV cytotoxicity was inoculated at 100 TCID50 / well, and PK-15 cells were added to 96-well plates and cultured at 37℃ in a 5% CO2 incubator for 72 h.

[0133] ② Cell fixation: Discard the cell culture supernatant, add 200 μL PBS to each well of a 96-well plate and wash three times, add 50 μL of 80% cold acetone stored at -20℃, and fix in a -20℃ freezer for 1 h.

[0134] ③ Primary antibody incubation: Discard the cold acetone fixative, add 200 μL of PBS to each well and wash 3 times, add 100 μL of hybridoma cell culture supernatant to each well, and incubate at 37℃ for 1 h.

[0135] ④ Secondary antibody incubation: Discard the primary antibody incubation solution, add 200 μL of PBS to each well and wash 3 times. Dilute the Alexa Fluor 488 fluorescent secondary antibody 1:500 with PBS, and add 0.01% Evans Blue and 5% FBS. Mix thoroughly and add 100 μL to each well of the cell plate. Incubate at 37°C for 1 h.

[0136] ⑤ Fluorescence observation: Discard the secondary antibody incubation solution, add 200 μL of PBS to each well and wash 3 times, then observe the reaction between serum antibody and infected cells under a fluorescence microscope.

[0137] The results are as follows Figure 5 As shown, the control antibody showed obvious green fluorescence in the reaction with cells infected with wild-type SM virus and cells infected with vaccine strain HCLV, indicating successful inoculation; the supernatant of 293T cells expressing the antibody also showed obvious green fluorescence in the reaction with cells infected with wild-type SM virus and cells infected with vaccine strain HCLV, indicating that antibody DIVA55 was successfully expressed.

[0138] 3. Validation of purified antibodies

[0139] Purified antibody DIVA55 was added to a reducing buffer containing DTT in a specific ratio and loaded for SDS-PAGE. The results are as follows. Figure 3 As shown: After treatment with reducing buffer, antibody DIVA55 showed two distinct bands at approximately 25 kDa and 50 kDa, representing the light and heavy chains, indicating that the antibody was well purified.

[0140] The purified antibody DIVA55 was subjected to Western blot experiments with mutated and non-mutated LPC E2 protein, and the results are as follows: Figure 4 As shown: when purified antibody DIVA55 reacts with non-mutant E2 protein, lane 2 shows a band at 90 kDa; however, it does not react with mutant E2 protein, and lane 3 shows no specific band.

[0141] 4. Preparation of HRP-conjugated antibody HRP-DIVA55

[0142] DIVA55 was coupled to HRP using an HRP coupling kit (Sangon Biotech, D601047):

[0143] (1) Mix 500 μL of HRP solution with 200 μL of HRP activation buffer on a shaker at room temperature for 30 min by inverting the mixture.

[0144] (2) Add 200 μL of HRP coupling buffer and let stand at room temperature for 30 min.

[0145] (3) Place 1 mg of purified DIVA55 in a dialysis bag and dialyze in 2 L of dialysis solution at room temperature for 2 h.

[0146] (4) Add 100 μL of reducing agent to the dialysis product, let stand at room temperature for 2 h, gently mix once every 30 min, dispense and store the conjugated product, and successfully obtain the conjugated antibody HRP-DIVA55.

[0147] Example 3: Validation of the classical swine fever virus E2 protein-labeled subunit vaccine

[0148] 1. Safety testing of classical swine fever virus E2 protein-labeled subunit vaccine

[0149] Ten healthy weaned piglets (Tiankang Livestock Technology Co., Ltd.) aged 4-5 weeks with negative results for both classical swine fever virus nucleic acid and antibodies were selected. Five piglets (numbered V1, V2, V3, V4, and V5) were injected intramuscularly into the neck behind the ears with 30 μg of classical swine fever virus E2 protein-labeled subunit vaccine. Five piglets (numbered C1, C2, C3, C4, and C5) were not injected as negative controls. The piglets were observed for 14 consecutive days, and rectal temperature was measured daily. Specific body temperatures are shown in Table 1. The body temperature of both the vaccine-immunized group and the control group did not exceed 40℃, and no deaths occurred. The piglets exhibited normal mental status, among other information.

[0150]

[0151] 2. Testing the protective efficacy of classical swine fever virus E2 protein-labeled subunit vaccines

[0152] Twenty-five healthy weaned piglets that were negative for both classical swine fever virus nucleic acid and antibodies were selected and divided into the following groups:

[0153] The first group (5 heads, 1-1, 1-2, 1-3, 1-4, 1-5) was immunized with the classical swine fever virus E2 protein-labeled subunit vaccine, which was administered twice via intramuscular injection in the neck, each time with an adjuvant-emulsified protein (30 μg).

[0154] The second group (5 heads, 2-1, 2-2, 2-3, 2-4, 2-5) was immunized with classical swine fever rabbit-attenuated live vaccine (C strain, passaged cell source), once by intramuscular injection in the neck, with a dose of 1 mL per head.

[0155] The third group (5 heads, 3-1, 3-2, 3-3, 3-4, 3-5) was immunized with the classical swine fever virus E2 protein subunit vaccine (TWJ-E2, purchased from Tiankang Pharmaceutical Co., Ltd., product name: Tianwenjing), which was administered twice via intramuscular injection in the neck, each time with an adjuvant-emulsified protein (30 μg).

[0156] The fourth group (5 animals, 4-1, 4-2, 4-3, 4-4, 4-5) was the non-immunized challenge group, and 1 mL of wild-type toxin was injected into the neck intramuscularly.

[0157] The fifth group (5 animals, 5-1, 5-2, 5-3, 5-4, 5-5) was a healthy control group that was not immunized or challenged with the virus and was raised in isolation under the same conditions.

[0158] The methods for obtaining the vaccine serum for the second and third groups mentioned above are described in the following literature: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019;237:108403.

[0159] Pigs were given a second immunization 21 days after the first immunization with the E2 protein-labeled subunit vaccine (Group 1) and the E2 protein subunit vaccine TWJ-E2 (Group 3). Fourteen days later, all immunized pigs were given an intramuscular injection of 1 ml of wild-type classical swine fever virus strain JL23 (containing 10... 5 The MLD strain was challenged, and strain C (group 2) was challenged 14 days after the first immunization. After challenge, the patients were observed for 24 consecutive days, with rectal temperature measured and clinical manifestations observed daily, and clinical scores were calculated.

[0160] During the challenge period, experimental pigs that were near death or had died, as well as those that were still alive at the end of the experiment, were dissected to observe the pathological conditions of tissues and organs such as tonsils, larynx, lymph nodes, kidneys, spleen, and ileum.

[0161] The results are as follows Figure 6 As shown: In groups one, two, and three—the groups immunized with the classical swine fever virus E2 protein-labeled subunit vaccine, the groups immunized with the classical swine fever rabbit-attenuated live vaccine (passaged cell source), and the groups immunized with the classical swine fever E2 subunit vaccine—no pigs exhibited clinical symptoms of classical swine fever. However, all pigs in group four (the control group) developed the disease, primarily exhibiting persistent high fever, respiratory distress, conjunctivitis, loss of appetite, lethargy, and patchy hemorrhages on the lower extremities. All affected pigs died within 14–22 days. Furthermore, healthy controls (group five) that were neither immunized nor challenged showed no clinical symptoms. After immunization and challenge, no hemorrhages or other abnormalities were observed in the challenged pigs. In contrast, the control group (group four) showed hemorrhages or petechiae on the tonsils, larynx, lymph nodes, and kidneys; splenic marginal infarction; button-like ulcers on the ileocecal valve; and enlarged lymph nodes with a marbled appearance of red and white stripes on the cut surface.

[0162] Virus copy number of each organization as follows Figure 7 As shown, the viral load in each tissue of the first, second, and third groups was significantly lower than that in the fourth group (non-immunized challenge group), and was basically the same as that in the healthy control group (non-immunized and non-challenged).

[0163] The results of E2 antibody detection in each group are as follows: Figure 8As shown in AC: The E2 antibody detection results of the first and third groups, namely the experimental groups immunized with the classical swine fever virus E2 protein-labeled subunit vaccine and the TWJ-E2 vaccine respectively, are as follows: Figure 8 As shown in Figure A, the E2 antibody level generally showed a continuous upward trend after immunization, with a slight decline during days 1-12 after challenge; the E2 antibody detection results of the second group, namely the experimental group immunized with the classical swine fever rabbit-attenuated live vaccine, are as follows. Figure 8 As shown in Figure B, the E2 antibody levels remained elevated, slightly lower than in groups one and three after challenge; while the E2 antibody test results in group four (non-immunized and challenged) and group five (non-immunized and non-challenged healthy control group) after challenge were as follows: Figure 8 As shown in C, it remains at a low level.

[0164] The above results demonstrate that the classical swine fever virus E2 protein-labeled subunit vaccine, classical swine fever rabbit-attenuated live vaccine strain C, and classical swine fever E2 subunit vaccine of the present invention provide comparable protection for pigs. Mutation of the E2 protein does not substantially alter its overall immunogenicity.

[0165] Example 4: Application of monoclonal antibody DIVA55 in immunization with classical swine fever virus E2 protein-labeled subunit vaccine and serological identification of wild-type strain infection.

[0166] This embodiment utilizes the monoclonal antibody DIVA55 to establish a blocking ELISA method for identifying and distinguishing between classical swine fever virus E2 protein-labeled subunit vaccine immunization and wild-type strain infection. The specific operation method is as follows:

[0167] (1) The CSFV LPC strain E2 protein (i.e., the CSFV-E2 protein in Example 1) was coated in the microplate at a concentration of 0.1 μg / mL. After coating, the coating solution was discarded and the plate was sealed in a vacuum.

[0168] (2) Add 50 μL of sample diluent to each well of the coated plate, and then add 50 μL of classical swine fever virus infection sample (numbered 1-5, serum obtained from challenge with classical swine fever wild strain AH1), E2 protein labeled subunit vaccine immunization sample (numbered 6-10, serum obtained from challenge with classical swine fever virus E2 protein labeled subunit vaccine), classical swine fever antibody negative control (classical swine fever antibody negative serum), classical swine fever antibody positive control (serum obtained from challenge with classical swine fever wild strain GD23), and set up duplicate wells for negative control and positive control. Incubate at 37ºC for 1 h.

[0169] The preparation methods of the serum described in positive samples 1-5 and the negative and positive control sera for classical swine fever antibodies in positive samples 6-10 are described in the following literature: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019;237:108403.

[0170] (3) After discarding the liquid in each well, wash the wells of the plate with 300 μL of washing solution 5 times. After the last wash, pat the washing solution in the wells dry.

[0171] (4) Add 100 μL of HRP-DIVA55 conjugate antibody diluted 1:5000 to each well of the plate and incubate at 37°C for 1 h.

[0172] (5) Repeat step (3).

[0173] (6) Add 50 μL of TMB colorimetric solution to each well and incubate at room temperature in the dark for 10 min.

[0174] (7) Add 50 μL of stop solution to each well to terminate the reaction, and measure the OD using an enzyme-linked immunosorbent assay (ELISA) reader. 450 Value, calculate the blocking rate, the calculation formula is (negative serum OD) 450 -Sample OD 450 ) / Negative serum OD 450 ×100%.

[0175] The results are shown in Table 2: the blocking rate was 95.12% for wild-type virus-infected serum and 3.25% for vaccine-immunized serum. This indicates that the blocking ELISA method based on monoclonal antibody DIVA55 can clearly distinguish between classical swine fever E2 protein marker subunit vaccine immunization and wild-type virus infection. Monoclonal antibody DIVA55 can be used for the development and preparation of blocking ELISA kits for serological differential diagnosis of classical swine fever immunization and infection.

[0176]

[0177] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A recombinant E2 protein of classical swine fever virus, characterized in that, The protein was obtained by mutating the antigenic epitope recognized by DIVA55 of the LPC E2 protein of the classical swine fever virus vaccine strain; the amino acid sequence of the protein is SEQ ID No:

1.

2. A recombinant E2 protein of classical swine fever virus, characterized in that, The protein is obtained by mutating the antigenic epitope recognized by DIVA55 of the LPC E2 protein of the classical swine fever virus vaccine strain; the amino acid sequence of the protein is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of SEQ ID No:

1.

3. The protein according to claim 1, characterized in that, The nucleotide sequence encoding the protein is SEQ ID No:

2.

4. A biomaterial, characterized in that, The biomaterial is any one of the following: C1) An expression cassette containing a nucleic acid molecule encoding the recombinant E2 protein of the classical swine fever virus as described in claim 1; C2) A recombinant vector containing a nucleic acid molecule encoding the recombinant E2 protein of the classical swine fever virus as described in claim 1; C3) A recombinant microorganism containing a nucleic acid molecule encoding the recombinant E2 protein of the classical swine fever virus as described in claim 1; C4) A recombinant host cell containing a nucleic acid molecule encoding the recombinant E2 protein of the classical swine fever virus as described in claim 1; The nucleotide sequence of the nucleic acid molecule is SEQ ID No:

2.

5. A recombinant E2 protein-labeled subunit vaccine against classical swine fever virus, characterized in that, include: The recombinant E2 protein of classical swine fever virus as described in claim 1 or 2, and a pharmaceutically acceptable adjuvant.

6. A method for preparing a recombinant E2 protein-labeled subunit vaccine against classical swine fever virus, characterized in that, The specific steps are as follows: 1) Nucleotides encoding the recombinant E2 protein of classical swine fever virus were inserted into the pcDNA3.1 expression vector to construct a recombinant expression vector; 2) Transfect the above recombinant expression vector into host cells to construct a recombinant protein expression cell line; 3) Cultivate the cell line described in step 2), collect the culture supernatant, and obtain the recombinant E2 protein of classical swine fever virus; 4) Mix the recombinant E2 protein of classical swine fever virus with an adjuvant, emulsify, and obtain a vaccine containing a marker subunit of recombinant E2 protein of classical swine fever virus; The nucleotide sequence encoding the recombinant E2 protein of classical swine fever virus is SEQ ID No:

2.

7. A kit for serological identification of classical swine fever virus E2 protein-labeled subunit vaccine immunization or wild-type strain infection, characterized in that, The kit contains a DIVA55 monoclonal antibody that specifically recognizes the E2 protein of classical swine fever virus and the E2 protein of the classical swine fever virus vaccine strain LPC. The amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No:5; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No:

4.

8. The use of the recombinant E2 protein of classical swine fever virus according to claim 1 or 2 in any of the following: (B1) Prepare products for recognizing or assisting in the recognition of classical swine fever virus E2 protein; (B2) Prepare products that can distinguish between swine fever E2-marked vaccine strains and wild-type strains; (B3) Prepare products to identify and differentiate diseases caused by immunization with classical swine fever E2-marked vaccine strains and infection with wild-type strains.

9. The use of the recombinant E2 protein-labeled subunit vaccine of classical swine fever virus according to claim 5 in any of the following: (B1) Prepare products for recognizing or assisting in the recognition of classical swine fever virus E2 protein; (B2) Prepare products to identify and differentiate between immunization with classical swine fever E2 protein-labeled vaccine strains and infection with wild-type strains; (B3) Prepare products to identify and distinguish diseases caused by immunization with classical swine fever E2 protein-labeled vaccine strains and infection with wild-type strains.

Images