A high-activity promoter sequence sl26 and application thereof in gene editing system

By designing a highly active promoter SL26 from a non-viral source and constructing (SL26)10 and (SL26)20 using a tandem repeat strategy, the off-target effects and promoter silencing problems of the CRISPR/Cas9 system were solved, achieving efficient and controllable gene editing results.

CN121022826BActive Publication Date: 2026-07-07GUANGDONG PHARMA UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511102581.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-07
Publication Date
2026-07-07
Estimated Expiration
2045-08-07

AI Technical Summary

Technical Problem

Existing CRISPR/Cas9 gene editing systems suffer from off-target effects in activity regulation, leading to inaccurate gene editing and safety risks. Furthermore, viral promoters, such as CMV promoters, may trigger immune responses or silencing, making it difficult to achieve sustained and efficient expression in mammalian cells.

Method used

A highly active promoter sequence SL26 from a non-viral source was designed, and (SL26)10 and (SL26)20 were constructed using a tandem repeat strategy to regulate the expression of the Cas9 nuclease. Combined with the CRISPR/Cas9 system, this improves the efficiency and safety of gene editing.

Benefits of technology

It achieves efficient and controllable gene editing, reduces off-target effects, and has promoter activity comparable to CMV promoters, making it suitable for gene editing systems and improving the accuracy and safety of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005537355770000082
    Figure BDA0005537355770000082
  • Figure BDA0005537355770000091
    Figure BDA0005537355770000091
  • Figure BDA0005537355770000092
    Figure BDA0005537355770000092
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses a high-activity promoter sequence SL26 and application thereof in a gene editing system. The high-activity promoter sequence (denoted as SL26) is derived from a haggfish genome. A gene editing system based on the SL26 sequence is designed by taking the advantages of the small size and tandem repeat of the SL26 sequence. The expression of Cas9 nuclease is precisely regulated at the promoter level, so that the gene editing efficiency is adjustable and controllable, the off-target effect of the CRISPR / Cas9 system is improved, and the controllability and safety of the gene editor are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a highly active promoter sequence SL26 and its application in gene editing systems. Background Technology

[0002] Gene editing is a genetic engineering technology that allows for targeted "editing" of specific DNA fragments within a gene. The CRISPR / Cas9 system, currently the most widely used gene editing tool, is favored for its high efficiency and precision, and its potential to edit multiple sites simultaneously. However, when using gene editing plasmids, excessively high activity can lead to overexpression and accumulation of Cas9 protein within the cell, enhancing off-target effects (OTEs) of the CRISPR-Cas9 system. Conversely, low activity means it cannot effectively drive the expression of Cas9 protein or gRNA, failing to achieve the desired editing effect. Therefore, precise regulation of gene editing activity is crucial. By improving the performance and controllability of gene editors, off-target effects can be reduced, ensuring the precision and safety of gene editing.

[0003] Promoters, as crucial cis-elements in gene expression regulation, have always been a research hotspot both domestically and internationally. Selecting a suitable promoter is key to constructing expression plasmids and achieving efficient and persistent expression of exogenous genes. Some promoters, due to their unique advantages, are widely used in the field of gene editing. Human cytomegalovirus (CMV) promoters are widely used to drive the stable and efficient expression of exogenous genes in host cells due to their high transcriptional activity. For example, Nahmad AD et al. used the CMV promoter to drive SaCas9 expression and combined it with sgRNA driven by the U6 promoter to achieve efficient editing of immunoglobulin gene sites in mouse endogenous B cells. However, CMV promoters also have some drawbacks. While viral promoters are generally more effective than mammalian promoters in driving gene expression in mammalian cells, they do not exhibit good activity in sustained transgenic expression. For example, in human embryonic stem cells (HESC) and induced pluripotent stem cells (HiPS), CMV promoters may be silenced over time, resulting in no protein expression. Furthermore, since CMV promoters are derived from viruses, they may trigger immune responses or affect the safety of gene editing. Therefore, a strong promoter that is not virally derived, widely expressed, and unaffected by silencing mechanisms is the preferred candidate for gene expression regulation.

[0004] Due to limitations in application, some natural promoters are no longer sufficient to meet the needs of various application scenarios. Currently, promoter research has evolved from the discovery and functional elucidation of natural promoter sequences to the redesign of promoters. Significant progress has been made in promoter engineering: (1) Constructing heterozygous promoters is one of the earliest strategies used in promoter engineering. Two or more different promoter elements are fused and assembled to form a new promoter, thereby improving the shortcomings of the original promoter and obtaining new promoter regulatory characteristics. (2) By randomly mutating promoters using saturation mutagenesis or error-prone PCR techniques, promoter libraries with a wide range of strength can be constructed. (3) Promoter engineering research is often combined with the optimization of transcription factor binding sites. The activity of promoters is optimized by arranging and composing transcription factor binding motifs. (4) Most natural promoters function in a single-copy state, making it difficult to achieve efficient transcription. Tandem arrangement of promoters or their core sequences can enhance gene expression. Summary of the Invention

[0005] The first aspect of the present invention is to provide a promoter sequence.

[0006] A second aspect of the present invention is to provide a biomaterial.

[0007] The third aspect of this invention aims to provide the application of the promoter sequence of the first aspect of this invention or the biological material of the second aspect of this invention in gene editing or the preparation of gene-edited products.

[0008] The fourth aspect of this invention aims to provide a CRISPR / Cas gene editing system.

[0009] The fifth aspect of this invention aims to provide the application of the CRISPR / Cas gene editing system of the fourth aspect of this invention in gene editing or the preparation of gene-edited products.

[0010] The sixth aspect of this invention aims to provide a product.

[0011] The seventh aspect of this invention aims to provide a gene editing method.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] In a first aspect, the present invention provides a promoter sequence comprising any one of 1) to 5): 1) a nucleotide sequence as shown in SEQ ID NO:1; 2) a nucleotide sequence comprising at least one tandem repeat of the nucleotide sequence shown in SEQ ID NO:1 and exhibiting promoter activity; 3) a nucleotide sequence of 1) or 2) having one or more nucleotides substituted, deleted, and / or added, and exhibiting promoter activity; 4) a nucleotide sequence that hybridizes to the nucleotide sequence of 1) or 2) under stringent conditions and exhibits promoter activity; 5) a nucleotide sequence having more than 85% homology (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology) with any of 1) to 4) and exhibiting promoter activity.

[0014] In some embodiments of the present invention, the nucleotide sequence of the promoter sequence comprises at least two tandem repeats of the nucleotide sequence shown in SEQ ID NO:1.

[0015] In some embodiments of the present invention, the at least two tandem repeats of the nucleotide sequence shown in SEQ ID NO:1 may be separated by a random base sequence.

[0016] In some embodiments of the present invention, the nucleotide sequences of the promoter sequence are as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:8, and SEQ ID NO:9.

[0017] In some embodiments of the invention, the promoter sequence is operatively linked to the transgene and, when introduced into supporting cells, can induce transgene expression (or target gene expression).

[0018] The terms "promoter" and "promoter sequence" are used interchangeably and refer to a DNA sequence that controls the expression of a coding sequence or functional RNA. Generally, the coding sequence is located at the 3' end of the promoter sequence. Promoters can be entirely derived from natural genes, can consist of different factors derived from different promoters found in nature, or can contain synthetic DNA fragments.

[0019] The promoter sequences provided by this invention can be used to construct modular, editable, and adjustable promoter systems through a tandem arrangement strategy.

[0020] A second aspect of the present invention provides a biological material, said biological material being at least one of A1) to A10): A1) an expression cassette containing the promoter sequence of the first aspect of the present invention; A2) a recombinant vector containing the promoter sequence of the first aspect of the present invention; A3) a recombinant vector containing the expression cassette of A1); A4) a recombinant microorganism containing the promoter sequence of the first aspect of the present invention; A5) a recombinant microorganism containing the expression cassette of A1); A6) a recombinant microorganism containing the recombinant vector of A2); A7) a recombinant microorganism containing the recombinant vector of A3); A8) a recombinant cell containing the expression cassette of A1); A9) a recombinant cell containing the recombinant vector of A2); and A10) a recombinant cell containing the recombinant vector of A3).

[0021] In some embodiments of the present invention, the expression cassette further comprises a target gene, which is a nucleotide sequence capable of encoding a protein or polypeptide.

[0022] In some embodiments of the present invention, the target gene may be a nucleotide encoding a fluorescent protein (such as GFP fluorescent protein, luciferase), or a functional protein.

[0023] In some embodiments of the present invention, the expression box further includes a control element.

[0024] In some embodiments of the present invention, the recombinant vector is selected from any one of plasmid vectors, phage particles, viral vectors, cell vectors, bacteriophages, phages, F phages, and artificial chromosomes.

[0025] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, such as the pUC series, pET series, pX458 series, etc.

[0026] In some embodiments of the present invention, the viral vector may be at least one of the following viruses: lentiviral vector, adenovirus vector, baculovirus vector, retrovirus vector, poxvirus vector, Sendai virus vector, and herpes simplex virus vector.

[0027] In some embodiments of the present invention, the cells are cell lines capable of viral replication and stable inheritance, including but not limited to HeLa-S3, HEK-293, HEK-293T, HEK-293FT, A549, and Sf9 cells. Further, the cells are HEK 293 or HEK-293T cells.

[0028] In some embodiments of the present invention, the cells include engineered cell lines such as CHO, CHO-K1, and CHO-GS, and lymphocyte lines such as T cells, NK cells, and CIK cells.

[0029] The promoter sequences provided by this invention have high promoter activity, wherein the (SL26)20 promoter (SEQ ID NO:2) has higher activity than (SL26)10 (SEQ ID NO:2) and is comparable to the CMV promoter. Biological materials constructed based on this promoter (such as gene editing plasmids p(SL26)10 and p(SL26)20) can achieve high gene editing efficiency and low off-target effects.

[0030] A third aspect of the present invention provides the application of the promoter sequence of the first aspect of the present invention and the biomaterial of the second aspect of the present invention in gene editing or the preparation of gene-edited products.

[0031] In some embodiments of the present invention, the gene editing includes gene knockout, knock-in, and / or replacement.

[0032] In some preferred embodiments of the present invention, the product includes reagents and reagent kits.

[0033] A fourth aspect of the present invention provides a CRISPR / Cas gene editing system comprising the promoter sequence of the first aspect of the present invention and the biological material of the second aspect of the present invention.

[0034] In some embodiments of the present invention, the CRISPR / Cas gene editing system further comprises sgRNA targeting the target gene and Cas protein.

[0035] In some embodiments of the present invention, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, and Cas14, including any recombinant variants thereof, and particularly selected from Cas9, including any recombinant variants thereof.

[0036] A fifth aspect of the present invention provides the application of the CRISPR / Cas gene editing system of the fourth aspect of the present invention in gene editing or the preparation of gene-edited products.

[0037] In some embodiments of the present invention, the product includes reagents or kits.

[0038] In some embodiments of the present invention, the gene editing includes gene knockout, knock-in, and / or replacement.

[0039] A sixth aspect of the present invention provides a product comprising the CRISPR / Cas gene editing system of the fourth aspect of the present invention.

[0040] A seventh aspect of the present invention provides a gene editing method comprising the steps of using the CRISPR / Cas gene editing system of the fourth aspect of the present invention or the product of the sixth aspect of the present invention.

[0041] In some embodiments of the present invention, the gene editing method includes introducing (e.g., transforming, integrating, transfecting) the CRISPR / Cas gene editing system into the target, so that the CRISPR / Cas gene editing system is expressed in the target, thereby achieving the editing of the target gene.

[0042] The beneficial effects of this invention are:

[0043] The highly active promoter sequence (denoted as SL26) provided by this invention is derived from the amphioxus genome. Taking advantage of its short sequence and tandem repeatability, a gene editing system based on the SL26 sequence was designed. The expression of Cas9 nuclease is precisely regulated at the promoter level, making the gene editing efficiency adjustable and controllable, improving the off-target effects of the CRISPR / Cas9 system, and enhancing the controllability and safety of the gene editor.

[0044] Based on the tandem repeat strategy, non-viral high promoter activity sequences (SL26)10 and (SL26)20 were constructed. Their gene transcription initiation activity is comparable to that of CMV promoters. They can be applied to gene editing systems to regulate gene editing efficiency and improve off-target effects (the off-target effects of CRISPR / Cas9 systems initiated by (SL26)10 and (SL26)20 are lower than those of CRISPR / Cas9 systems initiated by CMV), thus enriching the means of regulating gene editing activity. Attached Figure Description

[0045] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0046] Figure 1 The diagrams show the construction of p(SL26)10 and p(SL26)20 plasmids. A shows the construction of the p(SL26)10 plasmid, and B shows the construction of the p(SL26)20 plasmid.

[0047] Figure 2 The diagram shows the construction process of the p(SL26)10 plasmid. In Figure A, the electrophoresis image of the pUC57-(SL26)10 vector PCR product is shown. In the figure, M: DL 2000bp DNA marker; 0: negative group; 1-3: amplification products of primers F1 and R1. Figure B shows the electrophoresis image of the pX458 vector restriction enzyme digestion product. In the figure, M: DL 1kb DNA marker; 1: undigested pX458 plasmid; 2: pX458 plasmid digested with XbaI and AgeI. Figure C shows the p(SL26)10 plasmid map.

[0048] Figure 3 This section describes the construction process of the p(SL26)20 plasmid. A shows the electrophoresis diagram of the pUC57-(SL26)10 vector PCR product, where M: DL 2000bp DNA marker; 0: negative group; 1: amplification product of primers F2 and R2. B shows the electrophoresis diagram of the p(SL26)10 vector restriction enzyme digestion product, where M: DL 1kb DNA marker; 1: undigested p(SL26)10 plasmid; 2: p(SL26)10 plasmid digested with XbaI and KpnI. C shows the p(SL26)20 plasmid map.

[0049] Figure 4 This image shows the EGFP expression initiated by the p(SL26)10, p(SL26)20, and pX458 plasmids under an inverted fluorescence microscope. The blank control group consists of untransfected plasmids. Scale bar: 100 μm.

[0050] Figure 5 The efficiency of EGFP expression initiated by the SL26 sequence was statistically analyzed by flow cytometry. The bar chart represents the mean of three independent replicates, and the error bars represent the standard error (SEM). n=6.

[0051] Figure 6 This is a representative flow cytometry plot showing the EGFP expression efficiency of the SL26 promoter sequence. The blank control is the untransfected plasmid control group.

[0052] Figure 7 EGFP expression was initiated with different tandem copies of the SL26 sequence. In Figure A, EGFP expression was observed under an inverted fluorescence microscope. The blank control group consisted of untransfected plasmid. Scale bar: 100 μm. Figure B shows EGFP expression as detected by flow cytometry.

[0053] Figure 8 This diagram illustrates the design of gRNAs and the construction of gRNA expression plasmids. In diagram A, two gRNAs are designed targeting PDCD-1: gRNA#1 is located in the exon 1 region, and gRNA#2 is located in the exon 2 region. Diagram B shows the construction of the gRNA expression plasmid.

[0054] Figure 9 This image shows the expression of EGFP by six different gRNA expression plasmids under an inverted fluorescence microscope. The blank control is the untransfected plasmid control group. Scale bar: 100 μm.

[0055] Figure 10The efficiency of EGFP expression by gRNA expression plasmid was statistically analyzed by flow cytometry. The bar chart represents the mean of three independent replicates, and the error bars represent the standard error (SEM). n=6.

[0056] Figure 11 This is a representative flow cytometry plot of EGFP expressed by a gRNA expression plasmid. The blank control is the untransfected plasmid control group.

[0057] Figure 12 Electrophoresis diagram of HEK 293T genome extraction. In the diagram, M: DL 1kb DNA marker; 0: Genome of cells not transfected with HEK293T; 1: Transfected with pX458-g#1 group; 2: Transfected with p(SL26)10-g#1 group; 3: Transfected with p(SL26)20-g#1 group; 4: Transfected with pX458-g#2 group; 5: Transfected with p(SL26)10-g#2 group; 6: Transfected with p(SL26)20-g#2 group.

[0058] Figure 13 Electrophoresis images of the T7EI digestion products are shown. In A, primers F3 and R3 amplify the target gene fragment corresponding to gRNA#1. In the image, M: DL 2000bp DNA marker; 1: pX458-g#1 transfected group; 2: p(SL26)10-g#1 transfected group; 3: p(SL26)20-g#1 transfected group; 0: untransfected group. In B, primers F4 and R4 amplify the target gene fragment corresponding to gRNA#2. In the image, M: DL 2000bp DNA marker; 1: pX458-g#2 transfected group; 2: p(SL26)10-g#2 transfected group; 3: p(SL26)20-g#2 transfected group; 0: untransfected group. In C, the PCR fragment of the target gene corresponding to gRNA#1 digested with T7EI is shown. D represents the PCR fragment of the target gene corresponding to T7EI digestion of gRNA#2. In the figure, mutant PCR: PCR amplification product of the genome that has undergone gene editing; wild-type PCR: PCR amplification product of the genome that has not undergone gene editing.

[0059] Figure 14 This image shows the sequence alignment of alleles at the target site in HEK 293T cells after transfection with the gRNA expression plasmid. In the figures, A represents the group transfected with pX458-g#1, B with p(SL26)10-g#1, C with p(SL26)20-g#1, D with pX458-g#2, E with p(SL26)10-g#2, and F with p(SL26)20-g#2. In the figure, red boxes indicate base deletions, blue boxes indicate base insertions, small horizontal lines indicate base substitutions, and dashed lines indicate predicted cleavage sites.

[0060] Figure 15 Efficiency of gene editing of target genes by gene editing systems initiated by CMV, (SL26)10 and (SL26)20.

[0061] Figure 16 The distribution of indel lengths at the target locus in HEK 293T cells after transfection with the gRNA expression plasmid is shown. Group A represents the pX458-g#1 transfection group. Group B represents the p(SL26)10-g#1 transfection group. Group C represents the p(SL26)20-g#1 transfection group. Group D represents the pX458-g#2 transfection group. Group E represents the p(SL26)10-g#2 transfection group. Group F represents the p(SL26)20-g#2 transfection group. In the figure, red indicates base deletion, green indicates base insertion, orange indicates base substitution, and dark blue indicates no mutation.

[0062] Figure 17 The image shows the frequency distribution of the indel allele at the target site in HEK 293T cells after transfection with the gRNA expression plasmid. A represents the group transfected with pX458-g#1. B represents the group transfected with p(SL26)10-g#1. C represents the group transfected with p(SL26)20-g#1. D represents the group transfected with pX458-g#2. E represents the group transfected with p(SL26)10-g#2. F represents the group transfected with p(SL26)20-g#2. In the figure, red indicates a base deletion at the site, green indicates a base insertion, orange indicates a base substitution, and the dashed line represents the predicted cleavage site.

[0063] Figure 18 This study detects the off-target site corresponding to gRNA#2 in the HEK 293T cell genome. In the figures, A represents the first-round PCR amplification product of the upstream and downstream primers for the off-target site. B represents the second-round PCR amplification product of the upstream primer and ODN-R for the off-target site. C represents the second-round PCR amplification product of the downstream primer and ODN-R for the off-target site. In the figure, M: DL 2000bp DNA marker; 1: PCR product of the predicted off-1 site; 2: PCR product of the predicted off-2 site; 3: PCR product of the predicted off-3 site; 4: PCR product of the predicted off-4 site; 5: PCR product of the predicted off-5 site; on: PCR product of the PDCD-1 target.

[0064] Figure 19 Sequence alignment of the off-2 allele at the gRNA#2 expression plasmid in HEK 293T cells. Group A represents the pX458-g#2 transfection group. Group B represents the p(SL26)10-g#2 transfection group. Group C represents the p(SL26)20-g#2 transfection group.

[0065] Figure 20The distribution of indel lengths for the off-2 allele in HEK 293T cells after transfection with the gRNA#2 expression plasmid. Group A represents the pX458-g#2 transfection group; Group B represents the p(SL26)10-g#2 transfection group; and Group C represents the p(SL26)20-g#2 transfection group.

[0066] Figure 21 The indel frequency distribution of the off-2 allele in HEK 293T cells after transfection with the gRNA#2 expression plasmid is shown. Group A represents the pX458-g#2 transfection group. Group B represents the p(SL26)10-g#2 transfection group. Group C represents the p(SL26)20-g#2 transfection group. Detailed Implementation

[0067] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0068] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0069] CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated protein 9): Clustered regularly interspaced short palindromic repeats and their associated protein 9. gRNA (guide RNA): Guide RNA, the RNA sequence in the CRISPR system responsible for recognizing and guiding the Cas9 nuclease to a specific site in the genome for cleavage. OTEs (Off-target effects): Off-target effects, the phenomenon where, during CRISPR / Cas9 gene editing, the Cas9 nuclease, guided by gRNA, accidentally cleaves a non-target site similar to the target DNA sequence, resulting in unintended genome editing. CMV (Cytomegalovirus): Cytomegalovirus. NGS (Next Generation Sequencing): Next-generation sequencing technology, also known as high-throughput sequencing.

[0070] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0071] Example 1: Origin and Design of SL26

[0072] This embodiment provides a promoter active sequence from a non-viral (amphioxus genome) source and names it SL26 (SEQ ID NO:1). Based on the SL26 sequence, the inventors constructed and invented two novel highly active promoter sequences with different copy numbers using a promoter tandem repeat strategy, denoted as (SL26)10 (SEQ ID NO:2) and (SL26)20 (SEQ ID NO:3).

[0073] The nucleotide sequence of SL26 is: 5'-ATTTCCCATGAAACATTGCGCGTCGC-3' (SEQ ID NO:1).

[0074] Nucleotide sequence of (SL26)10: 5'-TCTAGAGCCAGTGAATTCATCGATAGGTACCATTTCCCATGAAACATTGCGCGTCGCATTTCC CATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCC CATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCGAGCTCTTACGCGTGCTAGCACCGGT-3'(SEQ ID NO:2).

[0075] The nucleotide sequence of (SL26)20 is: 5'-TCTAGACCGAATTCATCGATAGGTAGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATG-3' (SEQ ID NO:3).

[0076] Example 2: Construction of highly active promoter plasmids p(SL26)10 and p(SL26)20

[0077] In this embodiment, the CMV promoter sequence in the pX458 vector was replaced with (SL26)10 and (SL26)20 sequences using molecular cloning technology to construct plasmids p(SL26)10 and p(SL26)20.

[0078] I. Experimental Reagents

[0079] XbaI, AgeI, and KpnI restriction endonucleases were purchased from New England Biolabs; PrimeSTAR Max high-fidelity PCR enzyme was purchased from TAKARA; and T4 DNA Ligase reagent was purchased from TAKARA.

[0080] II. Experimental Methods

[0081] This experiment used a tandem repeat strategy to obtain 10 tandem copies of the SL26 sequence, namely the (SL26)10 promoter sequence. This sequence was cloned into the pUC57 vector (i.e., the pUC57-(SL26)10 plasmid) using whole-genome synthesis as the source of the (SL26)10 fragment. Then, the CMV promoter in the pX458 vector was completely cut out and replaced with (SL26)10 to construct the p(SL26)10 plasmid (see...). Figure 1 (A). Based on this plasmid, the copy number of the SL26 sequence was further increased to reach 20 tandem repeats, constructing the p(SL26)20 plasmid (see...). Figure 1 (B) The specific experimental steps are as follows:

[0082] 1. Construct the p(SL26)10 plasmid.

[0083] 1) Using pUC57-(SL26)10 plasmid as a template, a pair of PCR amplification primers targeting the (SL26)10 sequence were designed and PCR amplification was performed. The primer sequences are as follows: F1: 5′-TCTAGAGCCAGTGAATTCATCGATAGGTACC-3′ (SEQ ID NO:4); R1: 5′-ACCGGTGCTAGCACGCGTAAGAG-3′ (SEQ ID NO:5). The PCR amplification system was: 25 μL RimeSTAR Max Premix (2X), 1 μL pUC57-(SL26)10 (10 ng), 1 μL F1 (10 μM), 1 μL R1 (10 μM), and ddH2O to a final volume of 50 μL. The PCR amplification program was: pre-denaturation: 98℃ for 3 min; denaturation: 98℃ for 10 s, annealing: 55℃ for 5 s, extension: 72℃ for 30 s, 30 cycles; final extension: 72℃ for 1 min. Primers F1 and R1 amplified a DNA band of 317 bp in size (see...). Figure 2 (A) is in line with expectations.

[0084] 2) The PCR product and pX458 vector were double-digested using restriction endonucleases XbaI and AgeI. The digestion system was: 1 μg DNA, 1 μL XbaI, 1 μL AgeI, 5 μL NE Buffer, and ddH2O to a final volume of 50 μL. The digestion system was incubated overnight at 37°C. Two DNA bands were obtained after digestion of the pX458 vector, with sizes of 8478 bp and 810 bp, as expected. The 8478 bp fragment was recovered. Figure 2 (B)

[0085] 3) Ligate the digested long fragment and PCR product using T4 DNA Ligase. The ligation system consisted of: 0.06 pmol PCR product, 0.02 pmol long fragment, 1 μL T4 DNA Ligase, 2 μL T4 DNA Ligase Buffer, and ddH2O to a final volume of 20 μL. Incubate the ligation system overnight at 4°C.

[0086] 4) The ligation product was transformed into DH5α competent cells, and single colonies were selected and sequenced. Sequencing results showed that the p(SL26)10 plasmid was successfully constructed. Figure 2 In step C), the bacterial culture was mixed with 50% glycerol at a 1:1 ratio and then frozen at -80℃ to obtain the p(SL26)10 plasmid. The transformation process is as follows: A 100 μL tube of DH5α competent cells was removed from -80℃ and quickly placed on ice for 5 min until the bacterial block thawed. 10 μL of ligation product was added to the competent cells, and the mixture was gently stirred by tapping the bottom of the EP tube (avoiding pipette agitation). The mixture was then incubated on ice for 30 min. A heat shock was performed at 42℃ for 45 s, followed by immediate return to ice and incubation for 2 min. 1 mL of antibiotic-free sterile LB liquid medium was added to a centrifuge tube, mixed, and then incubated at 37℃, 220 rpm for 60 min. The cells were collected by centrifugation at 5000 rpm for 1 min. 100 μL of the supernatant was gently resuspended by pipetting and spread onto LB solid medium containing Amp antibiotic. The plates were incubated upside down at 37℃ overnight (12–16 h). Pick a single colony and add it to 1 mL of LB liquid medium containing Amp antibiotic. Incubate at 37°C and 220 rpm for 3–5 h until the bacterial culture becomes turbid. Then send the culture for sequencing.

[0087] 2. Constructing the p(SL26)20 plasmid

[0088] 1) Using pUC57-(SL26)10 plasmid as a template, PCR primers targeting the (SL26)10 sequence were designed and PCR amplification was performed. The primer sequences are as follows: F2: 5′-GCTCTAGACCGAATTCATCGATAGGTAGCATTTCCC-3′ (SEQ ID NO: 6); R2: 5′-ATGGTACCGGCTCGAGCCCGGGCTAGCACGCGTAAGA-3′ (SEQ ID NO: 7). The PCR amplification system was the same as above, and the PCR amplification program was as follows: pre-denaturation: 98℃ for 3 min; annealing: 98℃ for 10 s; annealing + extension: 68℃ for 30 s, 30 cycles; final extension: 72℃ for 1 min. Primers F2 and R2 amplified one DNA band, 330 bp in size (see...). Figure 3 (A) is in line with expectations.

[0089] 2) The PCR product and p(SL26)10 vector were double-digested using restriction endonucleases XbaI and KpnI. The digestion system consisted of 1 μg DNA, 1 μL XbaI, 1 μL KpnI, 5 μL NE Buffer, and ddH2O to a final volume of 50 μL. The digestion system was incubated overnight at 37°C. Digestion of the p(SL26)10 vector yielded two DNA bands of 8760 bp and 29 bp, as expected. The 8760 bp fragment was recovered (see [link to original text]). Figure 3 (B)

[0090] 3) Ligate the digested long fragment and PCR product using T4 DNA Ligase. The ligation system consisted of: 0.06 pmol PCR product, 0.02 pmol long fragment, 1 μL T4 DNA Ligase, 2 μL T4 DNA Ligase Buffer, and ddH2O to a final volume of 20 μL. Incubate the ligation system overnight at 4°C.

[0091] 4) The ligation product was transformed (using the same method as for p(SL26)10 plasmid construction) into DH5α competent cells, and single colonies were selected and sequenced. Sequencing results showed that p(SL26)20 plasmid was successfully constructed. Figure 3 The p(SL26)20 plasmid structure was obtained by mixing the bacterial culture with 50% glycerol at a 1:1 ratio and then freezing it at -80℃ for preservation.

[0092] Example 3: Verification of promoter activity of (SL26)10 and (SL26)20 sequences

[0093] In this embodiment, p(SL26)10 plasmid, p(SL26)20 plasmid and pX458 plasmid were transfected into HEK 293T cells, respectively. The expression of green fluorescent protein (EGFP) in the cells was detected by fluorescence microscopy and flow cytometry, and the initiation activity of (SL26)10, (SL26)20 and CMV on EGFP was investigated and compared.

[0094] I. Experimental Reagents

[0095] The transfection reagent kit was purchased from PolyPlus.

[0096] II. Experimental Methods

[0097] 1. Plasmid transfection of HEK 293T cells.

[0098] 1) Digest and resuspend healthy HEK 293T cells that have grown for at least three passages, and seed them at a density of approximately 80,000–150,000 cells per well in 12-well plates containing 1 mL of cell growth medium (90% DMEM + 10% FBS). 2) When the cell density reaches 60%–80%, change the medium and then prepare the transfection solution. (Add 75 μL of...) Dilute 0.8 μg of DNA in buffer, vortex for 10 s, and then briefly centrifuge. Add 1.6 μL of the mixture to the above solution. Prepare the reagents (initial ratio 1:1), vortex for 1 second, and then centrifuge briefly. Let stand at room temperature for 10 minutes to obtain the transfection solution. Add all of the prepared transfection solution to 1 mL of cell growth medium (90% DMEM + 10% FBS), incubate for 4 hours, then change the medium and continue incubation for another 24–48 hours to complete the plasmid transfection of HEK 293T cells.

[0099] 2. Detect the promoter activity of (SL26)10 and (SL26)20 sequences.

[0100] 1) After transfecting HEK 293T cells with the plasmid, the expression of EGFP in the cells was observed using an inverted fluorescence microscope. Figure 4 2) Cell pellet was collected using trypsin digestion, and then the cells were resuspended in 400 μL of PBS. Flow cytometry was used to detect intracellular EGFP expression. Figure 5 and Figure 6 ).

[0101] III. Experimental Results

[0102] After transfecting HEK 293T cells with plasmids p(SL26)10, p(SL26)20, and pX458, inverted fluorescence microscopy images showed that the SL26 sequence could initiate EGFP expression and had the activity of initiating gene transcription. Figure 4 Flow cytometry results showed that the (SL26)20 promoter activity was significantly higher than that of (SL26)10, and the efficiency of (SL26)20 in initiating EGFP expression was comparable to that of the CMV promoter. Figure 5 and Figure 6 ).

[0103] The inventors hypothesized that by altering the copy number of the SL26 sequence, the intensity of gene expression could be precisely and flexibly regulated. Therefore, promoter sequences containing 1, 3, and 6 tandem copies of SL26 (nucleotide sequences shown in SEQ ID NO:8 to SEQ ID NO:10, respectively) were designed and constructed into the pX458 vector (with the CMV promoter removed), named p(SL26)1, p(SL26)3, and p(SL26)6, respectively (construction process as in Example 2). The functions of these three plasmids were then validated to investigate the expression activity of EGFP initiated by the short tandem SL26 sequences (SL26)1, (SL26)3, and (SL26)6. Inverted fluorescence microscopy and flow cytometry results showed that as the copy number of the (SL26) sequence increased, the expression activity of the corresponding plasmids in initiating EGFP gene expression also increased. Figure 7 Therefore, by adjusting the copy number of the SL26 sequence, it is possible to precisely regulate the gene expression activity it initiates.

[0104] The nucleotide sequence of (SL26)1 is: 5'-ATTTCCCATGAAACATTGCGCGTCGC-3' (SEQ ID NO:1).

[0105] Nucleotide sequence of (SL26)3: 5'-TGAATTCATCGATAGGTACCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATT GCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCGAGCTCTTACGCGTGCTAGC-3' (SEQ ID NO: 8).

[0106] The nucleotide sequence of (SL26)6: 5'-ATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGA AACATTGCGCGTCGCGAGCTCTTACGCGTGCTAGCACCGGTTTCATCGATAGGTACCATTTCCCA TGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGCATTTCCCATGAAACATTGCGCGTCGC-3' (SEQ ID NO:9).

[0107] Example 4: Detection of gene editing efficiency of p(SL26)10-gRNA and p(SL26)20-gRNA plasmids

[0108] In this embodiment, two gRNAs were designed targeting the PDCD-1 gene site. These two gRNAs were inserted into the p(SL26)10, p(SL26)20, and pX458 vectors, respectively, to construct gene editing plasmids expressing the gRNAs. The editing efficiency of the gene editing systems initiated by (SL26)10 and (SL26)20 was investigated using T7EI restriction enzyme digestion and next-generation sequencing (NGS).

[0109] I. Experimental Reagents

[0110] BbsI restriction endonuclease was purchased from New England Biolabs; T4 PNK kit was purchased from Beyotime Biotechnology; MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 was purchased from TaKaRa; T7 Endonuclease I reagent was purchased from New England Biolabs; and 2×Phanta UniFi Master Mix (Dye plus) reagent was purchased from Vazyme.

[0111] II. Experimental Methods

[0112] 1. Construct gRNA expression plasmids.

[0113] 1) In this embodiment, the PDCD-1 site was selected as the editing target, and two gRNAs were designed and synthesized, namely gRNA#1 and gRNA#2. Figure 8(A) The nucleotide sequence of gRNA#1 is: 5'-CGACTGGCCAGGGCGCCTGT-3', SEQ ID NO:10; the nucleotide sequence of gRNA#2 is: 5'-AGGGCCCGGCGCAATGACAG-3', SEQ ID NO:11. 2) p(SL26)10, p(SL26)20 and pX458 were digested with BbSI. The digestion system was: 1 μg DNA, 1 μL BbsI, 5 μL NE Buffer, and ddH2O to a final volume of 50 μL. The digestion system was incubated overnight in a 37°C water bath, and the long fragments were recovered. 3) The two complementary gRNA sequences were annealed and phosphorylated to form a double-stranded gRNA fragment. The annealing phosphorylation system consisted of: 1 μL gRNA Sequence F (10 μM), 1 μL gRNA Sequence R (10 μM), 2.5 μL T4 PNK buffer (10X), 1 μL T4 PNK, and ddH2O to a final volume of 25 μL. The annealing phosphorylation program was: terminal phosphorylation: 37℃ for 30 min; gradient annealing: 95℃ for 5 min, 90℃ for 1 min, 85℃~25℃-5℃ / 1 min. 4) Ligation of the digested vector product with the annealed phosphorylated gRNA duplex. The ligation system consisted of: 0.06 pmol gRNA duplex, 0.02 pmol digested vector, 1 μL T4 DNA Ligase, 2 μL T4 DNA Ligase Buffer, and ddH2O to a final volume of 20 μL. The ligation system was incubated overnight at 4℃, and the ligation product was transformed (using the same method as p(SL26)10 plasmid construction) into DH5α competent cells. This yields gene-editing plasmids p(SL26)10-g#1, p(SL26)20-g#1, and pX458-g#1, as well as p(SL26)10-g#2, p(SL26)20-g#2, and pX458-g#2 capable of expressing gRNA (see schematic diagram of the construction of each gRNA expression plasmid). Figure 8 (B)

[0114] 2. Detect the transfection efficiency of gRNA expression plasmids.

[0115] use The above six plasmids were transfected into HEK 293T cells using the transfection reagent kit and cultured at 37℃ and 5% CO2 for 48 h. The expression of EGFP in the cells after transfection was observed using an inverted fluorescence microscope. Figure 9 Subsequently, flow cytometry was used to detect the expression of EGFP in the cells. Figure 10 and Figure 11 ).

[0116] 3. Extract genomic DNA from HEK 293T cells.

[0117] Transfected cells were digested with trypsin, and genomic DNA was extracted using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0. The extracted genomic DNA was identified by 1% agarose gel electrophoresis. Figure 12 ).

[0118] 4. T7EI restriction enzyme digestion assay to detect gene editing effect.

[0119] 1) Using extracted cellular genomic DNA as a template, forward primers F3 and F4 were designed approximately 200 bp upstream of the gRNA#1 and gRNA#2 target sites, and reverse primers R3 and R4 were designed approximately 500 bp downstream, respectively, and PCR amplification was performed. The designed and synthesized primers are as follows: F3: 5′-AGCACTGCCTCTGTCACTCT-3′ (SEQ ID NO:12); R3: 5′-CCCGTCATTCTACAGAAACACGC-3′ (SEQ ID NO:13); F4: 5′-GCAGCTTCTCCAACACATCG-3′ (SEQ ID NO:14); R4: 5′-CAACCACCAGGGTTTGGAACT-3′ (SEQ ID NO:15). The PCR amplification system was as follows: 25 μL PhantaUniFi Master Mix (2X), 1 μL gDNA (10 ng), 1 μL F2 / F3 (10 μM), 1 μL R2 / R3 (10 μM), and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: pre-denaturation: 95℃ for 3 min; denaturation: 94℃ for 10 s, annealing: 65℃ for 5 s, extension at 72℃ for 30 s, 5 cycles; denaturation: 94℃ for 10 s, annealing: 60℃ for 5 s, extension at 72℃ for 30 s, 8 cycles; denaturation: 94℃ for 10 s, annealing: 55℃ for 5 s, extension at 72℃ for 30 s, 10 cycles; denaturation: 94℃ for 10 s, annealing: 50℃ for 5 s, extension at 72℃ for 30 s, 12 cycles; final extension: 72℃ for 1 min. Primers F3 and R3 amplified one DNA band, 611 bp in size. Figure 13 (A) is as expected. Primers F4 and R4 amplified one DNA band, 621 bp in size (see...). Figure 13 (B) is in line with expectations.

[0120] 2) Anneal the two PCR amplification products to form hybrid DNA double strands. The annealing system was: 1 μL PCR product (200 ng), 2 μL NEBuffer 2 (10X), and ddH2O to a final volume of 19 μL. The annealing program was: 95℃ for 5 min, 90℃ for 1 min, and 85℃~25℃-5℃ / 1 min.

[0121] 3) Add 1 μL of the T7EI digestion annealing product to the above annealing system and incubate at 37°C for 15 min. Then add 1 μL of Proteinase K to digest T7EI to terminate the digestion reaction.

[0122] 4) Identification of T7EI digestion products by 2% agarose gel electrophoresis (see...) Figure 13 (C and D in the middle).

[0123] 5. Analysis of high-throughput sequencing and gene editing at target sites.

[0124] Two rounds of PCR primers were designed according to the Illumina Adapter Sequences rules (see Table 1). First, a first-round PCR primer was designed targeting the target gene sequence, followed by a second-round PCR primer. The upstream primer for the second-round PCR was a universal primer, while the downstream primer contained different barcodes. The first-round PCR amplification system was: 25 μL Phanta UniFi MasterMix (2X), 1 μL gDNA (10 ng), 1 μL on-g#1F / on-g#2F (10 μM), 1 μL on-g#1R / on-g#2R (10 μM), and ddH2O added to a final volume of 50 μL. The first-round PCR amplification procedure was the same as in "4. T7EI restriction enzyme digestion experiment to detect gene editing effect". The second-round PCR amplification system consisted of: 25 μL Phanta UniFi Master Mix (2X), 1 μL of first-round PCR product (10 ng), 1 μL F (10 μM), 1 μL R (10 μM), and ddH2O to a final volume of 50 μL. The second-round PCR amplification program was as follows: pre-denaturation: 95℃ for 3 min; denaturation: 94℃ for 10 s, annealing: 60℃ for 5 s, extension: 72℃ for 30 s, 30 cycles; final extension: 72℃ for 1 min. Based on high-throughput sequencing results, the merged sequences were aligned with reference sequences using the software CRISPResso2 (https: / / github.com / pinellolab / crispresso2) to quantify the types and frequencies of gene insertions, mutations, and deletions, and to analyze genome editing (see [link to CRISPResso2](https: / / github.com / pinellolab / crispresso2)). Figures 14-17 ).

[0125] Table 1 Primers used for preparing sequencing libraries

[0126]

[0127] The second round of PCR

[0128]

[0129] III. Experimental Results

[0130] like Figures 9-11 As shown, fluorescence imaging and flow cytometry analysis results indicate that the (SL26)20 promoter in the gRNA expression plasmid also possesses transcriptional activity comparable to the CMV promoter, similar to the experimental results in Example 3. Figure 13 As shown, the p(SL26)10-gRNA and p(SL26)20-gRNA plasmids can perform gene editing functions; that is, the SL26 promoter sequence can initiate the CRISPR / Cas9 system to express the Cas9 protein to cut the target gene. Figure 14 and Figure 15 As shown, by comparing the identified alleles around the PDCD-1gRNA#1 cleavage site with the reference allele, the editing efficiencies of the p(SL26)10-g#1, p(SL26)20-g#1, and pX458-g#1 plasmids at the target site were 28.85%, 17.94%, and 27.77%, respectively. To reduce the impact of transfection efficiency on editing efficiency, the inventors normalized and corrected the editing efficiency based on the transfection efficiency, defining it as the actual editing efficiency. The calculation formula is as follows:

[0131]

[0132] Therefore, the actual editing efficiencies of p(SL26)10-g#1, p(SL26)20-g#1, and pX458-g#1 were 49.48%, 47.46%, and 50.58%, respectively. For the PDCD-1gRNA#2 cleavage site, the editing efficiencies of p(SL26)10-g#2, p(SL26)20-g#2, and pX458-g#2 were 18.81%, 12.99%, and 23.63%, respectively, with actual editing efficiencies of 39.10%, 40.09%, and 47.35%. This demonstrates that the editing efficiency of gene editing plasmids initiated by the SL26 sequence is comparable to, or even higher than, that of gene editing plasmids initiated by CMV. The high-frequency indel types occurring when p(SL26)10-gRNA and p(SL26)20-gRNA plasmids edit the target site are also similar to those observed with the pX458-gRNA plasmid. These results demonstrate that gene editing systems initiated by the SL26 sequence possess highly efficient gene editing activity.

[0133] like Figure 16 and Figure 17 As shown, the length and frequency distribution of gene insertions, deletions, and substitutions caused by editing the target site with p(SL26)20-gRNA plasmid are similar to those of gene editing with pX458-gRNA plasmid, while the length and frequency of indels generated by editing the target site with p(SL26)10-gRNA plasmid are lower.

[0134] Example 5 analyzes the off-target effects of p(SL26)10-g#2 and p(SL26)20-g#2-mediated gene editing.

[0135] In this embodiment, five predicted off-target sites with high scores were selected from the Guide Design Resources website (http: / / zlab.bio / guide-design-resources), and then the actual off-target sites were screened according to the Guide-seq technology principle. A library was constructed for the actual off-target sites, and the off-target effects of the gene editing systems initiated by (SL26)10 and (SL26)20 were detected by NGS.

[0136] I. Experimental Methods

[0137] 1. Guide-seq technology detects off-target sites.

[0138] The above results show that the gene editing efficiency mediated by plasmids p(SL26)20-g#2 and pX458-g#2 is significantly different than that mediated by p(SL26)20-g#1 and pX458-g#1. In other words, compared to the gRNA#1 expression plasmid, the gene editing effect initiated by (SL26)20 under the guidance of gRNA#2 is significantly higher than that of CMV. Therefore, the inventors selected the target site corresponding to gRNA#2 for subsequent off-target effect verification. Five predicted off-target sites with high scores corresponding to gRNA#2 were screened using the Guide Design Resources website (Table 2). Based on the Guide-seq principle, a dsODNtag fragment containing gRNA#2 and its PAM sequence at both ends was synthesized, with the sequence 5'-GTTTAATTGAGTTGTCATATGTTAATAACGGTAT-3' (SEQ ID NO:33). This tag sequence was constructed into a T vector and named ODN-T. pX458-g#2 and ODN-T plasmid were co-transfected into HEK 293T cells. The gRNA bound to the Cas9 protein to form molecular "scissors" that cut the DNA, causing the dsODN tag to bind to the cleavage site, thus serving as a label. Then, two rounds of PCR primers were designed. The first round of PCR primers were designed upstream and downstream of each predicted off-target site. The second round of PCR amplified the DNA fragment with the dsODN tag, and the amplification was carried out in two directions: positive strand amplification and negative strand amplification (Table 3).

[0139] Table 2. Potential off-target site sequences and locations

[0140]

[0141] Note: In Table 2, bold text represents Substitutions, italics represent Insertions, and "-" represents Deletions.

[0142] Table 3 Primers used for potential off-target sites and target detection

[0143]

[0144] Experimental results show that off-2 is the site where the off-target effect is most significant. Figure 18 ).

[0145] 2. Analysis of high-throughput sequencing and off-target site editing.

[0146] Off-target libraries were constructed at the off-2 site (Table 1), and high-throughput sequencing was used to detect off-target effects of gene editing initiated by (SL26)10 and (SL26)20. Figures 19-21 ).

[0147] II. Experimental Results

[0148] like Figure 18 As shown, the frequencies of gene editing mediated by pX458-g#2, p(SL26)10-g#2, and p(SL26)20-g#2 plasmids occurring at the off-2 site were 6.83%, 3.59%, and 3.55%, respectively. Figures 19-21 The results showed that the frequency of indels in pX458-g#2-mediated gene editing was higher than that in p(SL26)10-g#2 and p(SL26)20-g#2, indicating that gene editing initiated by the SL26 sequence can improve the off-target effects of the CRISPR / Cas9 system. Therefore, gene editing initiated by the SL26 sequence has better safety and application potential compared to the CMV promoter.

[0149] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A promoter sequence, characterized in that, The nucleotide sequence of the promoter sequence is any one of 1) to 2): 1) The nucleotide sequence shown in SEQ ID NO:1; 2) A nucleotide sequence comprising at least one tandem repeat of the nucleotide sequence shown in SEQ ID NO:1 and exhibiting promoter activity.

2. The promoter sequence of claim 1, wherein, The nucleotide sequence of the promoter sequence is shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:8 or SEQ ID NO:

9.

3. A biomaterial, characterized by, The biomaterial is at least one of A1) to A10): A1) An expression cassette containing the promoter sequence of claim 1; A2) A recombinant vector containing the promoter sequence of claim 1; A3) A recombinant vector containing the expression cassette described in A1); A4) Recombinant microorganisms containing the promoter sequence of claim 1; A5) Recombinant microorganisms containing the expression cassette described in A1); A6) Recombinant microorganisms containing the recombinant vector described in A2); A7) Recombinant microorganisms containing the recombinant vector described in A3); A8) Recombinant cells containing the expression cassette described in A1); A9) Recombinant cells containing the recombinant vector described in A2); A10) Recombinant cells containing the recombinant vector described in A3).

4. The biomaterial of claim 3, wherein, The expression cassette also contains a target gene, which is a nucleotide sequence capable of encoding a protein or polypeptide.

5. The biomaterial of claim 3, wherein, The vector is selected from any one of plasmid vectors, viral vectors, cell vectors, viscera, F viscera, and artificial chromosomes.

6. The use of the promoter sequence of claim 1 or 2, or the biomaterial of any one of claims 3-5, in gene editing or the preparation of gene-edited products.

7. A CRISPR / Cas gene editing system comprising the promoter sequence of claim 1 or 2 and the biological material of any one of claims 3-5.

8. The CRISPR / Cas gene editing system of claim 7, wherein, The CRISPR / Cas gene editing system also includes sgRNA targeting the target gene and Cas protein.

9. The use of the CRISPR / Cas gene editing system according to claim 7 or 8 in gene editing or the preparation of gene-edited products.

10. A product comprising the CRISPR / Cas gene editing system of claim 7 or 8.

11. A gene editing method comprising the steps of using the CRISPR / Cas gene editing system of claim 7 or 8 or the product of claim 10.

12. The method of genetic editing of claim 11, wherein, The gene editing method includes introducing the CRISPR / Cas gene editing system into the target material, causing the CRISPR / Cas gene editing system to be expressed in the target material, thereby achieving the editing of the target gene.

Citation Information

Patent Citations

  • ProtoRAG transposon system and application thereof

    CN106086070A

  • Corn RNA polymerase III identification promoter and application thereof

    CN106701754A