Application of miRNA-532-5p in Parkinson's disease treatment and prognosis target drugs

Abstract

The invention provides an application of miRNA-532-5p (micro Ribonucleic Acid-532-5p) in a Parkinson's disease treatment and prognosis target drug. In the invention, firstly, it is verified that after overexpression of miRNA-532-5p, the athletic ability of mice is obviously recovered, and the TH content of striatum and nigra is obviously increased compared with that of MPTP group mice; secondly, after the miRNA-532-5p is over-expressed, the mRNA level of an inflammatory factor is obviously reduced, and the mRNA level of an anti-inflammatory factor is obviously increased; and finally, after the miRNA-532-5p is over-expressed, the content of serum inflammatory factors is obviously reduced, and the content of anti-inflammatory factors is obviously increased. In conclusion, the miRNA-532-5p simulant can enhance the function of the miRNA-532-5p, so that the neuroinflammation is relieved, the condition of the Parkinson's disease is relieved, and a new strategy is provided for clinical treatment of the Parkinson's disease.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of medicine, in particular to the application of miRNA-532-5p in the treatment and prognosis of Parkinson's disease. BACKGROUND

[0002] Parkinson's disease (PD) is the second most common neurodegenerative disease, and its clinical manifestations include resting tremor, muscle rigidity, bradykinesia and postural gait disorder. From the pathological point of view, the characteristic changes of PD are concentrated in the substantia nigra pars compacta (SNpc), which is manifested as the degeneration and death of dopaminergic neurons (DA neurons), the significant reduction of dopamine (DA) content in the striatum and the formation of Lewy bodies (LBs). The incidence of PD in the population aged 65-69 is about 0.5%-1%, and the incidence in the population aged 80 and above rises to 1%-3%. The pathogenesis of PD is very complex, and it is currently believed to be related to mitochondrial dysfunction, oxidative stress, synaptic dysfunction, cellular excitotoxicity, autophagy, apoptosis and neuroinflammation.

[0003] It is necessary to provide a drug that helps the treatment and prognosis of Parkinson's disease. SUMMARY

[0004] To solve the above technical problems, the present application provides the application of miRNA-532-5p in the treatment and prognosis of Parkinson's disease.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] The present application provides the application of miRNA-532-5p as a prognosis target for Parkinson's disease.

[0007] The present application also provides the application of miRNA-532-5p in the treatment of Parkinson's disease.

[0008] The present application also provides the application of miRNA-532-5p in the treatment of Parkinson's disease.

[0009] Further, the sequence of the miRNA-532-5p mimic is shown in SEQ ID NO: 1, which is CAUGCCUUGAGUGUAGGACCGU.

[0010] Further, the miRNA-532-5p mimic is an adeno-associated virus overexpressing miRNA-532-5p.

[0011] Further, the miRNA-532-5p mimic is an adeno-associated virus overexpressing miRNA-532-5p, and the adeno-associated virus is constructed by extracting a microRNA expression sequence with a length of 200-280 bp from a genome, the microRNA expression sequence comprising a pre-miRNA structure, and inserting the microRNA expression sequence into a tripartite promoter on an AAV transfer plasmid vector for expression.

[0012] Further, the miRNA-532-5p mimic is used to increase the content of tyrosine hydroxylase in the substantia nigra.

[0013] Further, the miRNA-532-5p mimic is used to increase the content of tyrosine hydroxylase in the striatum.

[0014] Further, the miRNA-532-5p mimic is used to reduce the mRNA level of an inflammatory factor.

[0015] Further, the miRNA-532-5p mimic is used to increase the mRNA level of an anti-inflammatory factor.

[0016] Compared with the prior art, the technical solution provided by the application has at least the following beneficial effects:

[0017] The application provides an application of miRNA-532-5p to a Parkinson's disease treatment and prognosis target. In the application, firstly, it is verified that the movement ability of a mouse overexpressing miRNA-532-5p is obviously recovered, and the TH content in the striatum and the substantia nigra of the mouse is obviously increased compared with that of a MPTP group mouse; secondly, after overexpression of miRNA-532-5p, the mRNA level of an inflammatory factor is obviously decreased, and the mRNA level of an anti-inflammatory factor is obviously increased; finally, after overexpression of miRNA-532-5p, the content of a serum inflammatory factor is obviously decreased, and the content of an anti-inflammatory factor is obviously increased. In summary, the miRNA-532-5p mimic can enhance the function of miRNA-532-5p, thereby reducing neural inflammation and relieving the condition of Parkinson's disease, and providing a new strategy for clinical treatment of Parkinson's disease. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The mouse behavior change in Example 1 of the application;

[0019] Figure 2 The mouse substantia nigra tyrosine hydroxylase (TH) expression level detection in Example 1 of the application;

[0020] Figure 3 For the detection of the expression level of tyrosine hydroxylase in the striatum of mice in Example 1 of the present application;

[0021] Figure 4 For the detection of the mRNA expression level of inflammatory factors and anti-inflammatory factors in the midbrain tissue of mice in Example 2 of the present application;

[0022] Figure 5 For the detection of the protein expression level of inflammatory factors and anti-inflammatory factors in the midbrain tissue of mice in Example 2 of the present application;

[0023] Figure 6 For the detection of the content of inflammatory factors and anti-inflammatory factors in the serum of mice in Example 2 of the present application. DETAILED DESCRIPTION

[0024] miRNA is a class of endogenous non-coding RNA (ncRNA) with a length of about 20-24 nucleotides, which has important functions in cell differentiation, development, cell cycle regulation and apoptosis, and plays an important epigenetic role in many diseases, regulates post-transcriptional gene expression, induces translation inhibition or degradation of mRNA (messenger RNA). miRNA is first transcribed by RNA polymerase II (RNA polymerase II, RNA Pol II), and then capped, spliced and polyadenylated to form the primary transcript of miRNA (Primary miRNA, pri-miRNA). In the nucleus, pri-miRNA is cleaved by the III-type RNA cleavage enzyme Drosha and the double-stranded RNA binding protein DGCR8 complex to form a precursor miRNA (Precursor miRNA, pre-miRNA) with a hairpin structure with a length of about 70-100 nucleotides. Under the action of the nuclear export protein Exportin-5, pre-miRNA is transported to the cytoplasm, and then further cleaved by another RNase III family enzyme Dicer and the TRBP (TAR RNA-binding protein) complex into double-stranded RNA in the cytoplasm; the double-stranded miRNA is unwound by an unwinding enzyme into a single short RNA chain called mature miRNA, which is then loaded onto AGO2 (Argonaute-2) to form an RNA-induced silencing complex (RNA-induced silencing complex, RISC), which incorporates the RISC into the 3'-untranslated region (3'-untranslated region, 3'-UTR) of the target mRNA, resulting in mRNA cleavage (if the homology is high) or inhibition of translation.

[0025] In the present application, the inventors construct a PD mouse model using the neurotoxin MPTP (1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine), prepare an miRNA-532-5p adeno-associated virus, and reduce neuroinflammation and relieve the symptoms of Parkinson's disease by stereotactic injection of the adeno-associated virus into the brain, thereby providing a new strategy for the clinical treatment of Parkinson's disease.

[0026] The present application will be described in detail below with reference to specific embodiments.

[0027] The miRNA-532-5p mimic described in the present application is an adeno-associated virus overexpressing miRNA-532-5p, i.e., AAV-miR-532-5p.

[0028] Preparation of AAV-miR-532-5p: Construct a plasmid, transfect the plasmid into HEK293 cells, culture for 48-72 hours, collect the cells and lyse them to release the virus, purify the virus, concentrate the virus and determine the titer.

[0029] Primers used for constructing the plasmid:

[0030] Primer 1(+)

[0031] The sequence is shown in SEQ ID NO: 2, specifically: CAGATCTCGAGCTCAAGTAGGCATTGGGAATAAAAAGAAAAG

[0032] Primer 2(-)

[0033] The sequence is shown in SEQ ID NO: 3, specifically: GGTTGATTATCGATAAGCTTACCAGCTACATGAAACTGATGG

[0034] Example 1: Construction and identification of a PD mouse model

[0035] MPTP constructs a PD mouse model:

[0036] The mice were divided into 4 groups: control group, MPTP group, MPTP+AAV-miR-532-5p negative control (NC) group, MPTP+AAV-miR-532-5p mimics group. The control group and MPTP group of mice were stereotactically injected with normal saline, and the MPTP+AAV-miR-532-5p NC group and MPTP+AAV-miR-532-5p mimics group of mice were stereotactically injected with AAV-miR-532-5p NC and AAV-miR-532-5p mimics. Two weeks after injection, the MPTP group, MPTP+AAV-miR-532-5p NC group and MPTP+AAV-miR-532-5p mimics group were injected intraperitoneally with MPTP 25 mg / kg; the control group was injected intraperitoneally with an equal amount of normal saline, once every 3.5 days, for a total of 5 weeks. On the 3rd day after the end of injection, the modeling was detected by animal behavior and immunohistochemical staining.

[0037] The detection content includes:

[0038] (1) Open field test to detect changes in mouse behavior

[0039] After the modeling was completed, a 3-day training was performed, and the mice were placed in the center of the open field to allow them to move spontaneously. The time was recorded and photographed for 10 minutes, and the training was performed once a day. It was necessary to keep the surrounding environment quiet, and the next batch of mice was wiped with 75% alcohol to eliminate the interference of odors on the mice. On the 4th day, the formal experiment began, and the mice were placed in the center of the open field to allow them to move spontaneously. The time was recorded and photographed for 10 minutes, and the mouse's 10-minute movement trajectory was analyzed using Shanghai Jiliang animal behavior software. It was necessary to keep the surrounding environment quiet, and the next batch of mice was wiped with 75% alcohol to eliminate the interference of odors on the mice. The total movement distance, central area movement distance, and average moving speed of the mice were calculated to evaluate the movement ability of the mice.

[0040] (2) Rotarod test to detect changes in mouse behavior

[0041] After the modeling was completed, a 3-day training was performed, and the mice were placed on the rotarod apparatus. The rotarod apparatus was set to a fixed speed of 4 rpm for a duration of 5 minutes, and the training was performed 3 times a day. The next batch of mice was wiped with 75% alcohol to eliminate the interference of odors on the mice. On the 4th day, the formal experiment began, and the mice were placed on the rotarod apparatus. The rotarod apparatus was uniformly accelerated from 4 rpm to 40 rpm in 5 minutes, and the time the mouse stayed on the rotarod apparatus was recorded and the data was recorded. The next batch of mice was wiped with 75% alcohol to eliminate the interference of odors on the mice. The data was statistically analyzed to evaluate the movement coordination ability of the mice.

[0042] (3) Pole climbing test to detect changes in mouse behavior

[0043] The pole climbing device is a long wooden pole with a ball, the ball is 3 cm in diameter, the wooden pole is 50 cm long, the surface is wrapped with gauze to increase friction, and it is vertically fixed on a foam board. After modeling, a 3-day training is carried out, the mice are placed at the top of the wooden pole with their heads down to induce them to naturally climb down the pole, 3 times a day. When replacing the mice, the pole is wiped with 75% alcohol to eliminate the interference of odor on the mice. On the 4th day, the formal experiment begins, the mice are placed at the top of the wooden pole with their heads down to induce them to naturally climb down the pole, the time required for the mice to climb from the top of the pole to the landing of the hind limbs is recorded and the data is recorded, when replacing the mice, the pole is wiped with 75% alcohol to eliminate the interference of odor on the mice, and the data is statistically analyzed to evaluate the motor coordination ability of the mice.

[0044] (4) Suspension test to detect changes in mouse behavior

[0045] A 30 cm long stainless steel wire is fixed on a foam box, and the height of the wire from the bottom of the box is 30 cm. After modeling, a 3-day training is carried out, the mouse forelimbs are suspended on the stainless steel wire, 3 times a day, with at least 10 minutes interval. When replacing the mice, the stainless steel wire and the box are wiped with 75% alcohol to eliminate the interference of odor on the mice. On the 4th day, the formal experiment begins, the mouse forelimbs are suspended on the stainless steel wire, the falling time of each mouse is recorded, when replacing the mice, the stainless steel wire and the box are wiped with 75% alcohol to eliminate the interference of odor on the mice, and the data is statistically analyzed to evaluate the limb movement ability of the mice.

[0046] (5) Immunohistochemical detection of changes in dopamine neurons in striatum and substantia nigra tyrosine hydroxylase

[0047] After the tissue is fixed, dehydrated and embedded, it is sliced in a freezing microtome, with a thickness of 8 μm, baked at 65 °C for 2 hours and then stored in a -80 °C refrigerator for standby. The slice is taken out from the ultra-low temperature refrigerator at -80 °C, equilibrated at room temperature for 30 minutes, and then placed in an antigen repair box. The slice is immersed in a phosphate buffered saline solution (PBST solution) containing Tween-20 and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. The slice is immersed in 1x citric acid tissue antigen repair solution and water-bathed at 95 °C for 15 minutes. The slice is naturally cooled to room temperature. The slice is immersed in PBST solution and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. The slice is broken by a membrane permeation solution for 30 minutes. The slice is immersed in PBST solution and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. 3% H2O2 is added dropwise and incubated at room temperature for 10 minutes. The slice is immersed in PBST solution and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. The slice is wiped dry with filter paper, and an immunohistochemical pen is used to draw a circle around the brain slice. 5% bovine serum albumin (BSA) is added dropwise into a wet box, and the wet box is placed in a 37 °C incubator for 1 hour of blocking. The blocking solution is discarded, and the first antibody is added dropwise and incubated at 4 °C overnight. The next day, the wet box is taken out of the refrigerator and equilibrated at room temperature for 30 minutes. The slice is immersed in PBST solution and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. The second antibody is added dropwise and incubated in a 37 °C incubator for 1 hour. The slice is immersed in PBST solution and shaken horizontally at 40 rpm for 3 times, each for 5 minutes. The prepared Diaminobenzidine (DAB) color developing solution is added dropwise. The slice is rinsed with running water for 5 minutes. The slice is stained with hematoxylin for 10 seconds and rinsed with running water for 5 minutes. The tissue sample is sequentially subjected to gradient ethanol dehydration and transparent treatment, immersed in 75% ethanol for 1 minute, 85% ethanol for 1 minute, then immersed in anhydrous ethanol for 1 minute twice, and finally transparentized in xylene solution for 1 minute twice. Neutral balsam is added dropwise in a fume hood to mount the slice. The slice is observed under a microscope and the image is taken.

[0048] Results:

[0049] The experimental results are shown in Figure 1 , Figure 2 and Figure 3 . After modeling, the motor ability of the MPTP group of mice decreased significantly, and the TH content of the striatum and substantia nigra decreased significantly. After overexpression of miRNA-532-5p, the motor ability of the mice recovered significantly, and the TH content of the striatum and substantia nigra increased significantly compared with the MPTP group of mice.

[0050] Example 2: Detection of inflammatory factor and anti-inflammatory factor content in PD mice

[0051] (1) RT-qPCR detection of inflammatory factor and anti-inflammatory factor mRNA level in mouse midbrain tissue

[0052] The centrifuge was pre-cooled to 4°C, 3 small steel balls were placed in the centrifuge tube containing brain tissue, and 500 μL of TRIzol total RNA extraction reagent (Trizol) was added. The grinder was pre-cooled and the parameters were set (run for 60 seconds, pause for 5 seconds, frequency 60 Hz, cycle 5 times), and the grinding was started. After grinding, centrifuge at 12000 rpm for 30 seconds, and transfer the supernatant to a new 1.5 mL centrifuge tube, and stand at room temperature for 5 minutes. Add 200 μL of chloroform to each tube, tightly cap the centrifuge tube, and shake vigorously for 15 seconds (note that the pressure accumulation caused by the evaporation of organic solvents may cause the tube cap to pop open), and stand at room temperature for 5 minutes after the solution forms a uniform emulsion. Place the sample tube in the pre-cooled centrifuge and centrifuge at 12000g for 15 minutes. After centrifugation, the sample presents three-phase stratification: the upper colorless aqueous phase (containing RNA), the middle white layer (containing DNA), and the lower organic phase (containing chloroform and protein). Carefully transfer the upper aqueous phase to a new centrifuge tube using a pipette, taking care not to suck in the middle white layer. Add the same volume of isopropanol as the RNA to the supernatant, and centrifuge at 12000g for 10 minutes after standing at room temperature for 10 minutes. Discard the supernatant and slowly add 1 mL of 75% ethanol, gently invert the tube wall, and note that the precipitate remains intact. Centrifuge at 12000g for 5 minutes again, and completely remove the ethanol solution. Dry the precipitate at room temperature for 2-5 minutes (avoid heating or centrifugal drying), add an appropriate amount of DEPC-treated and high-temperature high-pressure sterilized ultrapure water (Diethyl Pyrocarbonate-treated Water, DEPC water) to dissolve the RNA precipitate, and if necessary, gently blow to aid dissolution. When the RNA precipitate is completely dissolved and transparent, measure the RNA concentration with a multifunctional enzyme marker. Then prepare the reverse transcription and real-time fluorescent quantitative PCR system according to the kit instructions, and detect the mRNA levels of inflammatory factors and anti-inflammatory factors.

[0053] Results:

[0054] The experimental results are shown in Figure 4 After modeling, the mRNA levels of inflammatory factors in the MPTP group of mice were significantly increased, and the mRNA levels of anti-inflammatory factors were significantly decreased; after overexpression of miRNA-532-5p, the mRNA levels of inflammatory factors were significantly decreased, and the mRNA levels of anti-inflammatory factors were significantly increased.

[0055] (2) WB detection of inflammatory factor and anti-inflammatory factor protein levels in mouse midbrain tissue

[0056] The refrigerated centrifuge was pre-cooled to 4°C, the weight of the tissue was measured, and the required amount of lysis buffer was prepared. The ratio of radioimmunoprecipitation assay lysis buffer (RIPA lysis buffer), phenylmethanesulfonyl fluoride (PMSF), and phosphatase inhibitor was 100:1:1. The grinder was pre-cooled, 3 small steel balls were placed in the centrifuge tube containing the brain tissue, and an appropriate amount of lysis buffer was added. The grinder was set to the parameters (run for 60 seconds, pause for 5 seconds, frequency 60 Hz, cycle 5 times), and the grinding was started. After grinding, the supernatant was centrifuged, the protein concentration was determined, and the sample volume for the subsequent experiment was determined.

[0057] The remaining protein sample was mixed with 5xLoading buffer at a volume ratio of 4:1, and denatured at 100°C for 10 minutes. The glass plate was thoroughly cleaned with dishwashing liquid and rinsed with ultrapure water. The thin and thick plates were fixed on the gel making frame, and ultrapure water was added to the two plates to check for leaks. The leak detection time was 5-10 minutes. After ensuring that there was no leakage, the ultrapure water was discarded, and the gel making frame was inverted and the excess water was absorbed with filter paper. 8mL of lower gel solution and 8mL of lower gel buffer were added to a 50mL centrifuge tube, and 2mL of upper gel solution and 2mL of upper gel buffer were added to another 50mL centrifuge tube. 160μL of modified coagulant was added to the centrifuge tube containing the lower gel, and after thorough shaking, the lower gel solution was slowly injected into the vertical glass plate. The liquid surface reached 2 / 3 of the height of the glass plate, and then 500μL of anhydrous ethanol was slowly added along the inner wall of the glass plate to seal the liquid, and the gel surface was flat. The gel making frame was placed at room temperature for 20 minutes until the lower gel completely solidified. The anhydrous ethanol was discarded, 40μL of modified coagulant was added to the centrifuge tube containing the upper gel, and after thorough shaking, the upper gel was injected onto the upper edge of the lower gel. The electrophoresis comb was inserted gently to avoid air bubbles, and the upper gel was allowed to solidify at room temperature for 20 minutes.

[0058] After the preparation of the polyacrylamide gel electrophoresis (PAGE) gel is completed, electrophoresis can be started. Assemble the PAGE gel in the electrophoresis tank, add the prepared 1x electrophoresis buffer to the inner tank, slowly pull out the electrophoresis comb to avoid damaging the gel lane, blow the lane with a gun head to remove possible gel filaments, sample in order, add protein marker and different groups of protein samples in turn, sample gently to avoid protein overflow and cause errors. After sampling, add an appropriate amount of 1x electrophoresis buffer to the outer tank, set the electrophoresis parameters (constant voltage 80V, 30min; 120V, 90min), terminate the electrophoresis when the bromophenol blue runs to the bottom of the gel, and the whole process takes about 1-1.5 hours. After electrophoresis, remove the gel, rinse the surface with ultrapure water, and temporarily place it in 1x electrotransfer buffer. Cut a suitable size of polyvinylidene difluoride (PVDF) membrane and soak it in methanol to activate it. According to the experimental requirements, retain the target area gel and cut off the excess part of the gel. Assemble the transfer sandwich in the following order: sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad, build a "sandwich" type transfer structure, and use a glass rod or roller to carefully remove air bubbles between layers to ensure close contact between layers. Install the transfer sandwich correctly in the transfer tank, with the gel side facing the cathode and the PVDF membrane side facing the anode. Add pre-cooled 1x electrotransfer buffer to immerse the transfer sandwich. Set the transfer parameters to a constant current of 200mA, and adjust the transfer time according to the target protein molecular weight (usually 60-120 minutes). After transfer is complete, remove the PVDF membrane, cut the band according to the target protein molecular weight range indicated by the pre-stained protein marker, and select 5% skimmed milk powder or BSA as blocking solution, block at room temperature for 90 minutes. After blocking, add the appropriately diluted primary antibody working solution, incubate at 4°C on a shaker (50rpm) for 12-16 hours. Recover the primary antibody solution, wash the band with 1x TBST solution, and rinse for 3 times, 10 minutes each time, then add the secondary antibody and incubate at room temperature for 60 minutes. Wash the band with TBST for 3 times, 10 minutes each time. Mix Clarity Western ECL luminescent solution A and B in a light-proof tube at a volume ratio of 1:1, evenly drop on the target band area, and use a chemiluminescence imaging system to collect the signal. Use Image J image analysis software to analyze the gray value of the target band, and the obtained data is used for subsequent statistical processing. PMSF is a serine protease inhibitor.

[0059] Results:

[0060] The experimental results are as follows Figure 5As shown, the content of pro-inflammatory proteins in the MPTP group was significantly increased, and the content of anti-inflammatory proteins was significantly decreased after modeling; the content of pro-inflammatory proteins was significantly decreased, and the content of anti-inflammatory proteins was significantly increased after overexpression of miRNA-532-5p.

[0061] (3) ELISA detection of the content of inflammatory factors and anti-inflammatory factors in the serum of mice

[0062] The whole blood of the eyeball of the mouse was taken and left at room temperature for 20 minutes, centrifuged at 3000 rpm for 10 minutes, and then the serum sample was taken for detection or stored in a -80°C ultra-low temperature refrigerator after being divided into small portions to avoid the influence of repeated freezing and thawing of the sample on the detection effect. All reagents and samples need to be equilibrated to room temperature. The freeze-dried standard was briefly centrifuged (2000 rpm, 30 seconds) before use, and then dissolved in ultrapure water according to the product instructions. After being mixed gently and vortexed, it was left to stand for 10 minutes, and then mixed thoroughly again before dilution. Prepare 1x washing buffer, 1x detection buffer and detection antibody working solution according to the instructions. Prepare the sample standard curve, mix 230 μL of concentrated standard with an equal volume of standard diluent as the highest concentration point of the standard curve, and use the dilution method to add 230 μL of diluent in turn. Mix thoroughly after each dilution, and use the standard diluent as the zero concentration control. According to the concentration gradient, add 100 μL of diluted standard to the standard well, and add 100 μL of standard diluent to the blank control well. Add 80 μL of detection buffer and 20 μL of sample to each well of the sample well. Add samples continuously without interruption, and complete the process within 15 minutes. Standard wells, sample wells and blank wells should all be set in duplicate to reduce experimental error. Seal the enzyme-labeled plate with a sealing film, and place it on a horizontal shaker (60 rpm) at room temperature for 2 hours to ensure that the solution is mixed thoroughly and does not overflow. Discard the liquid in the wells, add 300 μL of washing buffer to each well, and discard after standing for 1 minute. Repeat the washing 6 times, and each time the enzyme-labeled plate is inverted on the absorbent paper to dry. Add 100 μL of detection antibody working solution to each well except the blank well, replace the new sealing film, and incubate on the shaker (60 rpm) at room temperature for 45 minutes. Discard the liquid in the wells, add 300 μL of washing buffer to each well, and discard after standing for 1 minute. Repeat the washing 6 times, and each time the enzyme-labeled plate is inverted on the absorbent paper to dry. Add 100 μL of color developing substrate 3,3',5,5'-tetramethylbenzidine (TMB) to each well, and incubate at room temperature for 30 minutes in the dark. Observe the color depth in the wells every 10 minutes, and terminate early if the color change is obvious, or extend the time if the color change is not obvious. Add 100 μL of stop solution to each well, and the solution changes from blue to yellow. Within 30 minutes after the termination of the reaction, use an enzyme-labeled instrument to detect at 450 nm and 630 nm.

[0063] Results:

[0064] The experimental results are shown in Table 1. Figure 6 As shown in Table 1, the content of serum inflammatory factors in the MPTP group was significantly increased, and the content of anti-inflammatory factors was significantly decreased after modeling; the content of serum inflammatory factors was significantly decreased, and the content of anti-inflammatory factors was significantly increased after overexpression of miRNA-532-5p.

[0065] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are included in the protection scope of the present application.

[0066] Those skilled in the art can understand that the above embodiments are specific embodiments for implementing the present application, and in actual application, various changes can be made in form and details without departing from the spirit and scope of the present application. Any person skilled in the art can make changes and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be limited by the scope defined in the claims.

Claims

1. Application of miRNA-532-5p as a prognostic target for Parkinson's disease.

2. Application of miRNA-532-5p in Parkinson's disease treatment drugs.

3. Application of miRNA-532-5p mimics in Parkinson's disease treatment drugs.

4. The application according to claim 3, characterized in that, The sequence of the miRNA-532-5p mimic is shown in SEQ ID NO: 1, specifically: CAUGCCUUGAGUGUAGGACCGU.

5. The application according to claim 3, characterized in that, The miRNA-532-5p mimic is an adeno-associated virus overexpressing miRNA-532-5p.

6. The application according to claim 5, characterized in that, The miRNA-532-5p mimic is an adeno-associated virus overexpressing miRNA-532-5p. The adeno-associated virus is constructed by extracting the expression sequence of microRNA from the genome, which is 200-280 bp in length. The expression sequence of microRNA contains a pre-miRNA structure. The expression sequence of microRNA is inserted into the type III promoter of the AAV transfer plasmid vector for expression.

7. The application according to claim 3, characterized in that, The miRNA-532-5p mimic is used to increase the content of substantia nigra tyrosine hydroxylase.

8. The application according to claim 3, characterized in that, The miRNA-532-5p mimic is used to increase the content of striatal tyrosine hydroxylase.

9. The application according to claim 3, characterized in that, The miRNA-532-5p mimic is used to reduce the level of inflammatory cytokine mRNA.

10. The application according to claim 3, characterized in that, The miRNA-532-5p mimic is used to increase the level of anti-inflammatory factor mRNA.

Images