Primer group for specifically detecting amylooosperms in aquatic animals and application of primer group in preparation of detection kit

Abstract

The invention discloses a primer group for specifically detecting amylooosperm whipstock in aquatic animals and application of the primer group in preparation of a detection kit. The primer group comprises a forward primer AO-M1-F and a reverse primer AO-M1-F, wherein the sequence of the forward primer AO-M1-F is as shown in SEQ ID NO: 1; the sequence of the reverse primer AO-M1-R is as shown in SEQ ID NO: 2; the sequence of the fluorescent probe AO-M1-P is as shown in SEQ ID NO: 3; the 5'end of the fluorescent probe is marked with a fluorophore, and the 3 'end is marked with a quenching group. The primer probe group has the advantages that the primer probe group capable of specifically detecting the amylooosperm vortex whip is designed on the basis of the 18S rRNA sequence of the amylooosperm vortex whip as a target, and the detection sensitivity of the primer probe group to plasmids containing the 18S rRNA sequence of the amylooosperm vortex whip reaches 2.28 * 100 copies / microliter. The real-time fluorescent PCR reaction system disclosed by the invention has relatively strong specificity and repeatability, and can provide an effective technical means for farmers to detect and monitor the amyloovum verbena disease in the aquatic animal breeding process.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of aquatic animal pathogen detection products, and particularly relates to an Amyloodinium ocellatum detection product. BACKGROUND

[0002] Amyloodinium ocellatum belongs to the Amyloodinium ocellatum of the Sarcomastigophora of the Mastigophora of the Phytomastigophora of the Dinoflagellida of the Blastodinidae of the Amyloodinium, and is a pathogen of the Amyloodinium ocellatum disease. The Amyloodinium ocellatum disease is caused by the parasitism of the Amyloodinium ocellatum on the body surface of marine fish, and is prone to outbreak in densely cultured areas with water temperature higher than 20 DEG C and low water exchange, and has a high mortality rate.

[0003] Quantitative Real-time PCR is a method of adding a fluorescent dye or a fluorescent probe to the conventional PCR technology, using fluorescence signal accumulation to monitor the whole PCR process in real time, and quantitatively analyzing unknown concentration templates through a standard curve. As an internationally recognized standard method for nucleic acid molecule quantification, the Quantitative Real-time PCR is a preferred method for rapidly detecting gene expression levels. Compared with the conventional PCR, the Quantitative Real-time PCR realizes the leap from qualitative to quantitative, and has the characteristics of higher sensitivity, stronger specificity, better repeatability and higher automation degree.

[0004] If a suitable Amyloodinium ocellatum detection product based on the Quantitative Real-time PCR technology can be developed for the on-site aquaculture, it will help the aquaculture farmers to detect and monitor the Amyloodinium ocellatum disease in the aquaculture process. SUMMARY

[0005] The present application aims to provide a primer group for specifically detecting the Amyloodinium ocellatum in aquatic animals and application thereof in the preparation of a detection kit, so as to solve the problem of lack of detection and monitoring products for the Amyloodinium ocellatum disease in the aquaculture process in the prior art.

[0006] In order to achieve the above-mentioned purpose, the present application adopts the following technical scheme:

[0007] The primer group for specifically detecting the Amyloodinium ocellatum in aquatic animals comprises:

[0008] a forward primer AO-M1-F, the sequence of which is shown in SEQ ID NO: 1;

[0009] a reverse primer AO-M1-R, the sequence of which is shown in SEQ ID NO: 2;

[0010] a fluorescent probe AO-M1-P, the sequence of which is shown as SEQ ID NO: 3;

[0011] The fluorescent probe is labeled with a fluorescent group at the 5' end and a quenching group at the 3'.

[0012] The fluorescent group is FAM, and the quenching group is MGB.

[0013] The application also provides a use of a primer set for specifically detecting O. oculata in aquatic animals in the preparation of a detection kit.

[0014] Further, the kit contains a PCR reaction premix, a positive control reference, a negative control reference and / or ddH2O.

[0015] The application also provides a real-time fluorescent PCR reaction system using the primer set for specifically detecting O. oculata in aquatic animals, which comprises 2x PCR reaction premix 12.5 μL, 10 μM forward primer AO-M1-F 1 μL, 10 μM reverse primer AO-M1-R 1 μL, 10 μM fluorescent probe AO-M1-P 0.5 μL, DNA template 5 μL and ddH2O 5 μL.

[0016] Further, the PCR reaction premix comprises Tris-HCl (pH 8.3-8.8) 50 mM, 50 mM, 5 mM, dNTPs 200 µM, Taq DNA Polymerase 0.1 U / µL, BSA / glycerol 0.5 mg / mL / 10% v / v, surfactant 0.1%.

[0017] The application has the advantages that based on the 18S rRNA sequence of O. oculata as a target, a primer probe set capable of specifically detecting O. oculata is designed, and the detection sensitivity of the primer probe set to a plasmid containing the 18S rRNA sequence of O. oculata reaches 2.28x10 0 copies / μL. The real-time fluorescent PCR reaction system of the application has strong specificity and repeatability, and can provide an effective technical means for detecting and monitoring O. oculata disease in the process of aquatic animal breeding for breeders. BRIEF DESCRIPTION OF DRAWINGS

[0018] The accompanying drawings, which are included to provide a further understanding of the application and constitute a part of this application, illustrate embodiments of the application and together with the description serve to explain the application, and in which:

[0019] Figure 1 is a graph of the results of the performance experiment of the primer probe set of Example 1;

[0020] Figure 2 is a graph of the results of the specificity experiment of Example 2;

[0021] Figure 3 is a graph of the results of the sensitivity experiment of Example 3;

[0022] Figure 4 is a graph of the results of the negative stability experiment of Example 4;

[0023] Figure 5 is a graph of the results of the detection of E. aeducola in actual samples of Example 5. DETAILED DESCRIPTION

[0024] The present application will be described in detail below with reference to the accompanying drawings and specific embodiments, which are used to explain the present application but not to limit the present application.

[0025] Example 1 Design of Detection Primer Set for E. aeducola

[0026] 1. Experimental Methods

[0027] 1.1. Design of Primers

[0028] The whole genome sequence of E. aeducola was searched from Genbank, and 2 sets of specific primers and probes were designed by BLAST analysis and comparison, with 18S rRNA sequence as the target gene, according to the principles of real-time fluorescent PCR primer probe design, and using Primer Express primer design software.

[0029] E. aeducola primer probe set AO-M1:

[0030] Forward primer AO-M1-F: 5'-TCGGCTTGGGCATCTTCTC-3' (SEQ ID NO: 1);

[0031] Reverse primer AO-M1-R: 5'-ATCCCGCCCCACACAAT-3' (SEQ ID NO: 2);

[0032] Fluorescent probe AO-M1-P: 5'-AAGAACGTCTTCTGCACTT-3' (SEQ ID NO: 3);

[0033] The 5' end of the fluorescent probe AO-M1-P was labeled with the fluorescent group FAM, and the 3' end was labeled with the quenching group MGB.

[0034] E. aeducola primer probe set AO-M2:

[0035] Forward primer AO-M2-F: 5'- TGCGGTTAAAAAGCTCGTAGTTG -3' (SEQ ID NO: 4);

[0036] Reverse primer AO-M2-R: 5'- CCCAAGCCGAACCAGATG-3' (SEQ ID NO: 5);

[0037] Fluorescent probe AO-M2-P: 5'- TCTGCCGGAGACGACCGGTCC -3' (SEQ ID NO: 6);

[0038] The 5' end of the fluorescent probe AO-M2-P is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group MGB.

[0039] 1.2 Construction of positive plasmid

[0040] The 18S rRNA sequence of Eutreptiella sp. was connected with pUC57 vector to construct the positive plasmid of Eutreptiella sp.

[0041] 1.3 Real-time fluorescent PCR reaction

[0042] The real-time fluorescent PCR reaction system is shown in Table 1, and the total volume of the system is 25 μL.

[0043] Table 1 Real-time fluorescent PCR reaction system

[0044] The 2x reaction premix contains: Tris-HCl (pH 8.3-8.8) 50 mM, 50 mM, 5 mM, dNTPs 200 µM, Taq DNA Polymerase 0.1 U / µL, BSA / glycerol 0.5 mg / mL / 10% v / v, surfactant 0.1%.

[0045] The reaction program is: decontamination program 50 ℃ 5 min, 1 cycle; Hoiding Stage program 95 ℃ 5 min, 1 cycle; Cycling Stage 95 ℃ 15 s, 60 ℃ 30 s, 40 cycles, collect fluorescence signal at 60 ℃ 30 s, and observe the reaction results by using a fluorescent PCR instrument.

[0046] 1.4 Performance test of primer probe set

[0047] Using the positive plasmid of *Eriocaulon ovarum* as a DNA template, and with primer and probe sets AO-M1 and AO-M2 respectively as primer and probe sets, real-time fluorescent PCR reaction systems were constructed, and the performance of the two primer and probe sets was tested.

[0048] 1.5 Result Interpretation Method

[0049] If the Ct value of the test sample is ≥40 or there is no Ct value, and the curve is a straight line or a slightly sloping line with no "S"-shaped amplification curve, it can be determined that the sample does not contain Eyespot Amygdalina or the content is below the detection limit; if the Ct value of the test sample is <40 and the curve is an "S"-shaped amplification curve, it can be determined that the sample contains Eyespot Amygdalina.

[0050] 6. Results

[0051] The results are as follows Figure 1 As shown, both primer-probe sets were able to amplify the sample. Primer set AO-M1 had a smaller Ct value and better reproducibility, with no nonspecific amplification in negative results. Primer-probe set AO-M1 was therefore determined to be the optimal primer-probe set. The following experiments used primer-probe set AO-M1 as the primer-probe set for real-time fluorescent PCR.

[0052] Example 2 Specificity Experiment

[0053] 1. Experimental Methods

[0054] DNA was extracted from samples containing Ichthyophthirius multifiliis, Cryptocaryon irritans, Coccidia guci, Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Streptococcus agalactiae, and Streptococcus dolphinus. The purity and concentration of the DNA were determined using a full-wavelength micro spectrophotometer and stored at -20°C for later use.

[0055] Using primer and probe set AO-M1 as the primer set (refer to Table 1), a real-time fluorescent PCR reaction system was constructed to perform fluorescent PCR reactions on the DNA of each of the above pathogens. The positive control was the positive plasmid constructed in Example 1, and the negative control was ddH2O.

[0056] 2. Experimental Results

[0057] like Figure 2 As shown, no amplified fluorescent signals were detected in the DNA samples of aquatic animal diseases such as Ichthyophthirius multifiliis, Cryptocaryon irritans, Coccidia guciformis, Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Streptococcus agalactiae, and Streptococcus dolphinus, indicating that the established real-time fluorescent PCR reaction system has good specificity.

[0058] Example 3 Sensitivity and Repeatability Experiments

[0059] 1. Experimental Methods

[0060] The DNA concentration of the positive plasmid constructed in Example 1 at a concentration of 100 ng / μL was converted to copy number, yielding a DNA copy number of 2.28 × 10⁻⁶. 10 Copies / μL. Diluted serially with TE buffer in 10-fold increments to obtain 2.28 × 10⁻⁶ copies / μL. 9 copies / μL, 2.28×10 8 copies / μL, 2.28×10 7 copies / μL, 2.28×10 6 copies / μL, 2.28×10 5 copies / μL, 2.28×10 4 copies / μL, 2.28×10 3 copies / μL, 2.28×10 2 copies / μL, 2.28×10 1 copies / μL, 2.28×10 0 copies / μL, 2.28×10 -1 Plasmids with a copy / μL concentration of 2.28 × 10⁻⁶ were selected. 5 copies / μL, 2.28×10 4 copies / μL, 2.28×10 3 copies / μL, 2.28×10 2 copies / μL, 2.28×10 1 copies / μL, 2.28×10 0 copies / μL, 2.28×10 -1 Positive plasmids at concentrations of copies / μL were prepared. Three replicates were set up for each concentration of positive plasmid. A real-time fluorescence PCR reaction system was constructed using primer and probe set AO-M1 as references (see Table 1) to detect these concentrations of positive plasmids.

[0061] 2. Experimental Results

[0062] The results are as follows Figure 3 The display shows 2.28 × 10 5 copies / μL, 2.28×10 4 copies / μL, 2.28×10 3 copies / μL, 2.28×10 2 copies / μL, 2.28×10 1 copies / μL, 2.28×10 0 copies / μL, 2.28×10 -1Real-time fluorescence PCR using positive plasmids at a concentration of copies / μL as templates showed typical amplification curves, and the detection sensitivity of this method for positive plasmids reached 2.28 × 10⁻⁶. 0 Copies / μL. As shown in Table 2, the results of three-parallel experiments for each of the seven dilution gradients showed that the coefficient of variation ranged from 0.05% to 0.97%, indicating that the established real-time fluorescence PCR reaction system has good reproducibility.

[0063] Table 2. Repeatability experiments of primer and probe sets for *Evodia iridis*.

[0064] Example 4 Negative Stability Test

[0065] I. Experimental Methods

[0066] Using ddH2O as a negative control, the real-time fluorescence PCR reaction was repeated 20 times, with an additional 3 positive control references, to perform a negative stability experiment.

[0067] II. Experimental Results

[0068] The results are as follows Figure 4 The results showed that the established real-time fluorescence PCR reaction system had good negative stability and no non-specific amplification occurred.

[0069] Example 5: Detection of Eyespot Amyloliquefaciens in Actual Samples

[0070] I. Experimental Methods

[0071] DNA was extracted from 24 actual samples. A real-time fluorescence PCR reaction system was constructed using primer probe set AO-M1 as the primer set (see Table 1) to detect whether these actual samples were infected with Eyedroplet Amygdaloides.

[0072] II. Experimental Results

[0073] The results are as follows Figure 5 As shown in the figure, the DNA of 3 actual samples tested positive for *Amygdaloidea eyespotae*; the DNA of 21 actual samples tested negative for *Amygdaloidea eyespotae*.

[0074] The technical solutions provided by the embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the embodiments of the present invention. The descriptions of the embodiments above are only for helping to understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the embodiments of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. A primer set for the specific detection of *Eriocheir iridocornus* in aquatic animals, characterized in that, include: The forward primer AO-M1-F has the sequence shown in SEQ ID NO: 1; The reverse primer AO-M1-R has the sequence shown in SEQ ID NO: 2; The fluorescent probe AO-M1-P has the sequence shown in SEQ ID NO: 3; The fluorescent probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

2. The primer set for specific detection of *Eurya squarrosa* oviduct in aquatic animals according to claim 1, characterized in that, The fluorescent group is FAM, and the quenching group is MGB.

3. Application of a primer set for the specific detection of Eyespot Amyloliquefaciens in aquatic animals in the preparation of a detection kit.

4. The application of the primer set for specifically detecting *Eriocheir iridocornus* in aquatic animals according to claim 3 in the preparation of a detection kit, characterized in that... The kit contains PCR reaction premix, positive control reference, negative control reference and / or ddH2O.

5. A real-time fluorescent PCR reaction system using the primer set for the specific detection of *Eriocheir iridocornus* in aquatic animals as described in claim 1, characterized in that... The mixture includes 12.5 μL of 2×PCR reaction premix, 1 μL of 10 μM forward primer AO-M1-F, 1 μL of 10 μM reverse primer AO-M1-R, 0.5 μL of 10 μM fluorescent probe AO-M1-P, 5 μL of DNA template, and 5 μL of ddH2O.

6. The real-time fluorescent PCR reaction system for the specific detection of Eyespot Amygdaloides egg case in aquatic animals according to claim 5, characterized in that, The PCR reaction premix contains 50 mM Tris-HCl at pH 8.3–8.

8. 50 mM, 5 mM, dNTPs 200 µM, Taq DNA Polymerase 0.1 U / µL, BSA / glycerol 0.5 mg / mL / 10% v / v, surfactant 0.1%.

Images