Xanthophyll-producing engineering bacterium and application thereof

Abstract

According to the present invention, GGS, HMGR, ERG20, IDI and other precursor geranyl geranyl pyrophosphate (GGPP) synthesis genes and codon-optimized carB and carRP-E78K genes are expressed in Yarrowia lipolytica Po1f to obtain lycopene-producing bacteria, and codon-optimized lycopene cyclase gene OluLCY, carotene hydroxylase genes LUT5 and LUT1, and P450 reductase gene ATR2 are expressed on the basis, such that the lycopene-producing bacteria can be produced, and further performing mutation breeding to finally obtain the lutein high-yield strain MC249. Therefore, the invention provides the genetically engineered bacterium for producing xanthophyll, the construction method of the genetically engineered bacterium, and the Yarrowia lipolytica MC249. The MC249 and the genetically engineered bacterium are more economical and efficient in fermentation process, a new technical scheme is provided for efficient and green manufacturing of xanthophyll, and industrial production of xanthophyll is facilitated.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, specifically relating to a lutein-producing engineered bacterium and its applications. Background Technology

[0002] Lutein, also known as plant lutein, is scientifically named 3,3'-dihydroxy-β,ε-carotene, with the molecular formula C2. 40 H 56 O2, with a relative molecular mass of 568.87, is a yellow-orange oxygen-containing carotenoid, abundant in the petals, leaves, stems, and some algae of higher plants. As a natural pigment, lutein possesses not only excellent coloring ability but also strong antioxidant properties, effectively reducing cell damage caused by free radicals. Based on photochemiluminescence assays, lutein's antioxidant activity is 10 times that of β-carotene and 15 times that of lycopene. Lutein has various important physiological functions in humans and animals. For example, it is an important component of macular pigment in the retina and one of the essential carotenoids for humans. Lutein supplementation can be used to prevent and treat vision loss and blindness caused by age-related macular degeneration. Furthermore, lutein also improves cognition, enhances immunity, inhibits the occurrence of cardiovascular and cerebrovascular diseases and tumors, and improves the quality of livestock and aquatic products. It is widely used in medicine, health products, food, cosmetics, and animal feed.

[0003] Due to the asymmetry of lutein's stereostructure, its chemical synthesis is difficult. Currently, commercially available lutein is mainly extracted from marigold petals. However, marigold growth is affected by season, climate, and region, resulting in poor production continuity; cultivation requires significant land and human resources; the lutein content in marigolds is low, the extraction process is cumbersome, and the use of large amounts of organic reagents leads to low efficiency. Bio-fermentation technology offers numerous advantages, including less environmental pollution, no occupation of arable land, short production cycles, and continuous production. Obtaining superior lutein-producing bacteria is crucial for achieving efficient lutein fermentation production, but currently, high-yield, high-quality lutein-producing bacteria are still lacking. Summary of the Invention

[0004] To overcome the shortcomings of the existing technology, this application employs genetic engineering methods to study the *Yarrowia lipolytica* Po1f (genotypes: MatA,leu2-270,ura3-302,xpr2-322,Leu-,Ura-,Suc+,ΔAEP,ΔAXP) (Madzak C. *Yarrowia lipolytica* Strains and Their Biotechnological Applications: How Natural Biodiversity and Metabolic Engineering Could Contribute to Cell Factories Improvement). Journal In *Fungi. 2021; 7(7): 548.*, lycopene-producing bacteria were obtained by expressing the precursor geraniyl geraniyl pyrophosphate (GGPP) synthesis genes of *Yerovia lipophila* GGS, HMGR, ERG20, and IDI, as well as the codon-optimized carB and carRP-E78K genes from *Mucor*. Further, the codon-optimized lycopene cyclase gene O from *Ostreococcus lucimarinus* was expressed. luLCY converted lycopene into α-carotene and expressed the carotene hydroxylase gene LUT5 and the P450 reductase gene ATR2 from Arabidopsis thaliana to convert α-carotene into lutein, thus obtaining a lutein-producing genetically engineered bacterium. Through further mutagenesis breeding, a high-lutein-producing strain MC249 was finally obtained, which is deposited at the China General Microbiological Culture Collection Center on April 15, 2024, with the accession number CGMCCNO.30340.

[0005] The first aspect of this application provides a genetically engineered bacterium that produces lutein, wherein the genetically engineered bacterium is a lycopene-producing bacterium, the lycopene-producing bacterium being *Yerovia lipophila*, and the genetically engineered bacterium contains the lycopene cyclase gene OlulCY, the carotene hydroxylase genes LUT5 and LUT1, and the P450 reductase gene ATR2.

[0006] The second aspect of this application provides a Yarrowia lipolytica MC249, with accession number CGMCC NO.30340.

[0007] The third aspect of this application provides a method for constructing a genetically engineered bacterium that produces lutein, using Yarrowia lipolytica Po1f as the starting strain. The starting strain expresses a precursor GGPP synthesis gene, a carB gene, a carRP gene, an OluLCY gene, a carotene hydroxylase gene, and an ATR2 gene. The precursor GGPP synthesis gene includes the GGS gene, the HMGR gene, the ERG20 gene, and the IDI gene. The carotene hydroxylase gene includes LUT5 and LUT1. The protein encoded by the carRP gene has an E78K mutation.

[0008] The fourth aspect of this application provides the use of the genetically engineered bacteria for producing lutein described in the first aspect above, or the Yarrowia lipolytica MC249 described in the second aspect above, in the production of lutein.

[0009] The fifth aspect of this application provides a method for producing lutein, which involves inoculating the genetically engineered lutein-producing bacteria of the first aspect or the Yarrowia lipolytica MC249 of the second aspect into a fermentation medium and obtaining lutein through fermentation culture.

[0010] The beneficial effects of this application are as follows:

[0011] This application uses *Yarrowia lipolytica* Po1f as the starting strain and, through genetic engineering and mutagenesis breeding, screened and selected a high-yield lutein strain MC249. Its lutein yield through fermentation in a fermenter can reach over 1.65 g / L, making it an excellent lutein-producing bacterium. This application can provide a high-yield strain for the large-scale industrial production of lutein, as well as genetic engineering methods for constructing such strains. It offers a new approach to achieving a green and efficient lutein manufacturing process, which is beneficial for the industrial production of lutein. Attached Figure Description

[0012] Figure 1 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA1-BRPM.

[0013] Figure 2 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA2-HGL.

[0014] Figure 3 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA3-BRPM.

[0015] Figure 4 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA4-BRPM.

[0016] Figure 5 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA5-HG.

[0017] Figure 6 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA6-E20I.

[0018] Figure 7 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA7-LCY.

[0019] Figure 8 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA8-LUT.

[0020] Figure 9 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA9-ATR2.

[0021] Figure 10 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA10-LCY.

[0022] Figure 11 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA11-LUT.

[0023] Figure 12 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA12-LUT.

[0024] Figure 13 This is a diagram showing the assembly sequence of each functional module in plasmid pMD-HA13-ATR2. Detailed Implementation

[0025] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0026] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0027] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0028] The present application is further illustrated below by means of examples, but these examples do not limit the scope of the application. Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature. The instruments and reagents used in the embodiments of this application can all be obtained through conventional means.

[0029] This application employs genetic engineering methods to express geraniol-geraniol pyrophosphate (GGPP) synthesis genes (GGS, HMGR, ERG20, IDI, etc.) from *Yarrowia lipolytica* Po1f, along with codon-optimized carB and carRP-E78K genes from *Mucor*, to obtain a lycopene-producing strain. Furthermore, codon-optimized genes from *Ostreococcus* are then expressed on this basis. The lycopene cyclase gene OluLCY from *Lucimarinus* converts lycopene into α-carotene. The expression of the carotene hydroxylase gene LUT5 and the P450 reductase gene ATR2 from *Arabidopsis thaliana* converts α-carotene into lutein, resulting in a lutein-producing genetically engineered bacterium. Further mutagenesis breeding yielded the high-lutein-producing strain MC249, which is deposited at the China General Microbiological Culture Collection Center on April 15, 2024, with accession number CGMCC NO.30340.

[0030] First, this application provides a genetically engineered bacterium that produces lutein. The bacterium uses a lycopene-producing bacterium (Yerovia lipophila) as the starting strain. This lycopene-producing bacterium contains the lycopene cyclase gene OlulCY, the carotene hydroxylase gene, and the P450 reductase gene ATR2. It is constructed using genetic engineering methods, specifically by expressing multiple copies of the lycopene cyclase gene OlulCY, multiple copies of the carotene hydroxylase gene, and multiple copies of the P450 reductase gene ATR2 in the lycopene-producing bacterium.

[0031] In some embodiments of this application, the carotenoid hydroxylase genes include LUT5 and LUT1. The LUT5 gene encodes carotenoid hydroxylase CYP97A3, which participates in the hydroxylation of the β ring of carotenoids; the LUT1 gene encodes a cytochrome P450 monooxygenase CYP97C1, which participates in the hydroxylation of the ε ring of carotenoids.

[0032] In some embodiments of this application, the carotene hydroxylase genes LUT5 and LUT1 are derived from Arabidopsis thaliana.

[0033] In some embodiments of this application, the nucleotide sequence encoding the N-terminal 28 amino acid residues of the carrot hydroxylase gene LUT5 is removed, and the nucleotide sequence encoding the N-terminal 36 amino acid residues of the carotene hydroxylase gene LUT1 is removed. LUT5 and LUT1 undergo codon optimization to obtain gene sequences more suitable for expression in *Yerovia lipophila*. Codon optimization can employ conventional codon optimization strategies and methods found in the prior art. For example, selecting codons that are frequently used in the host cell, avoiding rare codons, and ensuring a relative balance in the use of various codons within the gene.

[0034] In some embodiments of this application, the codon-optimized carrot hydroxylase gene LUT5 contains the nucleotide sequence shown in SEQ ID No. 10.

[0035] SEQ ID No. 10:

[0036]

[0037] In some embodiments of this application, the codon-optimized carrot hydroxylase gene LUT1 contains the nucleotide sequence shown in SEQ ID No. 9.

[0038] SEQ ID No. 9:

[0039]

[0040] In some embodiments of this application, the lycopene cyclase gene is OlulCY. The lycopene cyclase gene OlulCY encodes a bifunctional enzyme with lycopene β-cyclase and ε-cyclase activities, responsible for converting lycopene into α-carotene.

[0041] In some embodiments of this application, the lycopene cyclase gene OlulCY is derived from Ostreococcus lucimarinus.

[0042] In some embodiments of this application, the lycopene cyclase gene OlulCY is codon-optimized to obtain a gene sequence more suitable for expression in *Yerovia lipophila*. The codon optimization can employ conventional codon optimization strategies and methods in the prior art, such as selecting codons that are frequently used in the host cell, avoiding rare codons, and ensuring a relative balance in the use of various codons in the gene.

[0043] In some embodiments of this application, the codon-optimized lycopene cyclase gene OlulCY contains the nucleotide sequence shown in SEQ ID No. 8.

[0044] SEQ ID No. 8:

[0045]

[0046] In some embodiments of this application, the P450 reductase gene is ATR2. The P450 reductase gene ATR2 encodes NADPH-cytochrome P450 reductase, an important hydroxylase cofactor that provides essential electrons to cytochrome P450 enzymes to support their catalytic activity.

[0047] In some embodiments of this application, the P450 reductase gene ATR2 is derived from Arabidopsis thaliana.

[0048] In some embodiments of this application, the nucleotide sequence encoding the N-terminal 44 amino acid residue transport peptide of the P450 reductase gene ATR2 is removed and codon optimized to obtain a gene sequence more suitable for expression in *Yerovia lipophila*. The codon optimization can employ conventional codon optimization strategies and methods in the prior art, such as selecting codons that are frequently used in the host cell, avoiding rare codons, and ensuring a relative balance in the use of various codons in the gene.

[0049] In some embodiments of this application, the codon-optimized P450 reductase gene ATR2 contains the nucleotide sequence shown in SEQ ID No. 11.

[0050] SEQ ID No. 11:

[0051]

[0052] The term "copy number" refers to the number of times a gene or a DNA sequence appears in the genome of an individual.

[0053] In some embodiments of this application, the copy number of the lycopene cyclase OluLCY gene is two or more, for example, 2, 3, 4, 5, 6, 7, etc. In one embodiment of this application, the copy number of the lycopene cyclase OluLCY gene is 2. Specifically, the OluLCY gene is the OluLCY gene from Ostreococcus lucimarinus introduced into the chromosome of Yersinia lipophila via a plasmid.

[0054] In some embodiments of this application, the copy number of the carotene hydroxylase LUT5 and LUT1 genes is three or more, for example, 3, 4, 5, 6, 7, 8, etc. In one embodiment of this application, the copy number of the carotene hydroxylase LUT5 and LUT1 genes is 3. Specifically, the LUT5 and LUT1 genes are LUT5 and LUT1 genes from Arabidopsis thaliana introduced into the chromosome of Yersinia lipophila via plasmid.

[0055] In some embodiments of this application, the copy number of the P450 reductase ATR2 gene is two or more, for example, 2, 3, 4, 5, 6, 7, etc. In one embodiment of this application, the copy number of the P450 reductase ATR2 gene is 2. Specifically, the ATR2 gene is the ATR2 gene from Arabidopsis thaliana introduced into the chromosome of Yersinia lipophila via plasmid.

[0056] In a specific embodiment of this application, the lycopene-producing bacteria can be lycopene-producing bacteria constructed through genetic engineering. Specifically, it can be a lycopene-producing bacteria constructed through genetic engineering using Yersinia lipolytica Po1f as the starting strain.

[0057] In some embodiments of this application, the lycopene-producing bacteria is constructed using *Yerovia lipophila* Po1f as the starting strain, and contains multiple copies of the precursor GGPP synthase gene, as well as multiple copies of the carB and carRP genes.

[0058] In some embodiments of this application, the precursor GGPP synthase genes include the GGS gene, HMGR gene, ERG20 gene, and IDI gene, all of which are derived from *Yerovia lipolytica*. Specifically, the GGS gene encodes GGPP synthase, the HMGR gene encodes 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase, the ERG20 gene encodes farnesyl pyrophosphate synthase, and the IDI gene encodes isopentenyl pyrophosphate isomerase; all are key genes for the synthesis of GGPP precursors of terpenoids such as lycopene and β-carotene.

[0059] In some embodiments of this application, the GGS gene comprises a nucleotide sequence as shown in SEQ ID No. 5.

[0060] SEQ ID No. 5:

[0061] atggattataacagcgcggatttcaaggagatatggggcaaggccgccgacaccgcgctgctgggaccgtacaactacctcgccaacaaccggggccacaacatcagagaacacttgatcgcagcgttcggagcggttatcaaggtggacaagagcgatctcgagaccatttcgcacatcaccaagattttgcataactcgtcgctgcttgttgatgacgtggaagacaactcgatgctccgacgaggcctgccggcagcccattgtctgtttggagtcccccaaaccatcaactccgccaactacatgtactttgtggctctgcaggaggtgctcaagctcaagtcttatgatgccgtctccattttcaccgaggaaatgatcaacttgcatagaggtcagggtatggatctctactggagagaaacactcacttgcccctcggaagacgagtatctggagatggtggtgcacaagaccggtggactgtttcggctggctctgagacttatgctgtcggtggcatcgaaacaggaggaccatgaaaagatcaactttgatctcacacaccttaccgacacactgggagtcatttaccagattctggatgattacctcaacctgcagtccacggaattgaccgagaacaagggattctgcgaagatatcagcgaaggaaagttttcgtttccgctgattcacagcatacgcaccaacccggataaccacgagattctcaacattctcaaacagcgaacaagcgacgcttcactcaaaaagtacgccgtggactacatgagaacagaaaccaagagtttcgactactgcctcaagaggatacaggccatgtcactcaaggcaagttcgtacattgatgatctagcagcagctggccacgatgtctccaagctacgagccattttgcattattttgtgtccacctctgactgtgaggagagaaagtactttgaggatgcgcagtga

[0062] In some embodiments of this application, the HMGR gene comprises a nucleotide sequence as shown in SEQ ID No. 4.

[0063] SEQ ID No.4:

[0064]

[0065] In some embodiments of this application, the ERG20 gene comprises a nucleotide sequence as shown in SEQ ID No. 6.

[0066] SEQ ID No. 6:

[0067]

[0068] In certain embodiments of the present application, the IDI gene comprises the nucleotide sequence shown in SEQ ID No.7.

[0069] SEQ ID No.7:

[0070] atgacgacgtcttacagcgacaaaatcaagagtatcagcgtgagctctgtggctcagcagtttcctgaggtggcgccgattgcggacgtgtccaaggctagccggcccagcacggagtcgtcggactcgtcggccaagctatttgatggccacgacgaggagcagatcaagctgatggacgagatctgtgtggtgctggactgggacgacaagccgattggcggcgcgtccaaaaagtgctgtcatctgatggacaacatcaacgacggactggtgcatcgggccttttccgtgttcatgttcaacgaccgcggtgagctgcttctgcagcagcgggcggcggaaaaaatcacctttgccaacatgtggaccaacacgtgctgctcgcatcctctggcggtgcccagcgagatgggcgggctggatctggagtcccggatccagggcgccaaaaacgccgcggtccggaagcttgagcacgagctgggaatcgaccccaaggccgttccggcagacaagttccatttcctcacccggatccactacgccgcgccctcctcgggcccctggggcgagcacgagattgactacattctgtttgtccggggcgaccccgagctcaaggtggtggccaacgaggtccgcgataccgtgtgggtgtcgcagcagggactcaaggacatgatggccgatcccaagctggttttcaccccttggttccggctcatttgtgagcaggcgctgtttccctggtgggaccagttggacaatctgcccgcgggcgatgacgagattcggcggtggatcaagtag

[0071] In some embodiments of this application, both carB and carRP are derived from Mucor.

[0072] In some embodiments of this application, the carB gene encodes phytoene dehydrogenase, which is responsible for converting phytoene into lycopene. The carRP gene is mutated so that the 78th amino acid residue of the protein encoded by the carRP gene is replaced with lysine (i.e., the E78K mutation), named the carRP-E78K gene. The wild-type carRP gene encodes a bifunctional enzyme with lycopene cyclase and phytoene synthase activities, capable of converting GGPP into phytoene and lycopene into β-carotene. The E78K mutation blocks β-carotene cyclase activity, preventing the lycopene produced during fermentation from cyclizing into β-carotene, thus eliminating the need to add inhibitors such as imidazole or pyridine to suppress lycopene cyclization during fermentation.

[0073] In some embodiments of this application, the carB and carRP-E78K genes undergo codon optimization to obtain gene sequences more suitable for expression in *Yerovia lipophila*. This codon optimization can employ conventional codon optimization strategies and methods found in the prior art. For example, selecting codons that are frequently used in the host cell, avoiding rare codons, and ensuring a relative balance in the use of various codons within the gene.

[0074] In some embodiments of this application, the codon-optimized carB gene contains the nucleotide sequence shown in SEQ ID No. 1.

[0075] SEQ ID No. 1:

[0076]

[0077] In some embodiments of this application, the codon-optimized carRP-E78K gene contains the nucleotide sequence shown in SEQ ID No. 2.

[0078] SEQ ID No. 2:

[0079]

[0080] In some embodiments of this application, the copy number of the GGS and HMGR genes is three or more. Specifically, the copy number of the GGS and HMGR genes can be 3, 4, 5, 6, 7, or more. In one embodiment of this application, the copy number of the GGS and HMGR genes is 3, one of which is the GGS and HMGR genes naturally present in *Yerovia lipolytica* Po1f, and the other two are the GGS and HMGR genes introduced into the *Yerovia lipolytica* chromosome via plasmid.

[0081] In some embodiments of this application, the copy number of the ERG20 and IDI genes is two or more. Specifically, the copy number of the ERG20 and IDI genes can be 2, 3, 4, 5, 6, or more. In one embodiment of this application, the copy number of the ERG20 and IDI genes is 2. Specifically, one of them is the ERG20 and IDI genes naturally present in the *Yerovia lipolytica* Po1f, and the other is the ERG20 and IDI genes introduced into the *Yerovia lipolytica* chromosome via plasmid.

[0082] In some embodiments of this application, the copy number of the carB and carRP-E78K genes is three or more. Specifically, the copy number of the carB and carRP-E78K genes can be 3, 4, 5, 6, 7, or more. In one embodiment of this application, the copy number of the carB and carRP-E78K genes is 3. Specifically, the carB and carRP-E78K genes are the carB and carRP-E78K genes from *Mucor* species introduced into the chromosome of *Yerovia lipophila* via plasmids.

[0083] In addition, this application also provides a Yarrowia lipolytica MC249, which was deposited at the China General Microbiological Culture Collection Center on April 15, 2024, with accession number CGMCC NO.30340, and deposit address: No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0084] The Yarrowia lipolytica MC249 strain is a high-yielding strain obtained through genetic engineering, ultraviolet mutagenesis, and screening. Its lutein production yield during fermentation is above 1.65 g / L.

[0085] The lutein production yield was obtained under the following conditions: MC249 was streaked onto YPD plates and cultured at 28°C for 3 days. A portion was then inoculated into a shake flask containing YPD seed culture medium and cultured at 28°C and 220 rpm for 24 hours with shaking. Then, the seed culture was transferred to a fermenter at an inoculation rate of 10% (v / v). The fermentation conditions were: fermentation temperature 28°C, aeration rate of 1:1 (v / v), stirring speed of 500-900 rpm, and glucose (500 g / L, the remainder water) added at a flow rate of 10 mL / h starting at 20 h. The fermentation time was 160 h. The fermentation medium consisted of 40 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 4 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder water.

[0086] Specifically, the HPLC method refers to Lee HS, Castle WS, Coates G A. High-performance liquid chromatography for the characterization of carotenoids in the newsweet orange (Earlygold) grown in Florida, USA. Journal of Chromatography A. 2001; 913 (1-2): 371.

[0087] In a specific embodiment of this application, the Yarrowia lipolytica MC249 contains a precursor geraniol pyrophosphate synthesis gene, a carB gene, a carRP gene, an OluLCY gene, a carotene hydroxylase gene, and an ATR2 gene. The precursor geraniol pyrophosphate synthesis gene includes the GGS gene, the HMGR gene, the ERG20 gene, and the IDI gene. The carotene hydroxylase gene includes LUT5 and LUT1. The protein encoded by the carRP gene has an E78K mutation.

[0088] The lutein-producing genetically engineered bacteria mentioned above were constructed using genetic engineering methods. Therefore, this application can also provide a method for constructing a lutein-producing genetically engineered bacteria, using Yarrowia lipolytica Po1f as the starting strain, in which the precursor GGPP synthesis gene, carB gene, carRP-E78K gene, OluLCY gene, carotene hydroxylase gene, and ATR2 gene are expressed.

[0089] The precursor GGPP synthesis genes include the GGS gene, HMGR gene, ERG20 gene, and IDI gene; the carotene hydroxylase genes include LUT5 and LUT1; and the protein encoded by the carRP gene has an E78K mutation.

[0090] Those skilled in the art will understand that a target gene can be expressed in a host cell if the correct expression cassette is available. Therefore, there are no restrictions on the methods used to express the target gene in a host cell. Examples include homologous recombination integration, artificial chromosome expression, gene gun or particle bombardment, mRNA expression, viral vector expression, plasmid expression, CRISPR-Cas9 and other gene editing technologies, transposon-mediated expression, etc. A correct expression cassette, in genetic engineering, refers to an ordered set of genetic elements that work together to ensure the effective expression of the target gene in the host cell. Examples include promoters, terminators, and selection marker genes. Promoters can be TEFIN, TEF, etc., and terminators can be PEXT, PRLT, LIPT, PRCT, etc.

[0091] In this application, homologous recombination can be used to integrate the target gene into the chromosome of the starting strain through homologous arms connected to both ends of the target gene. Homologous arms refer to DNA fragments containing homologous sequences of the host cell genome constructed on both sides of the target gene.

[0092] In some embodiments of this application, the construction method includes the following steps:

[0093] S1) Insert the homologous arm, the retrievable selection marker HBU, the carB gene, and the carRP-E78K gene into the pMD19-Tsimple vector to obtain the pMD-HA1-BRPM plasmid, pMD-HA3-BRPM plasmid, and pMD-HA4-BRPM plasmid.

[0094] S2) The homologous arm, HMGR gene, GGS gene, and LEU gene were inserted into the pMD19-T simple vector to obtain the pMD-HA2-HGL plasmid.

[0095] S3) Insert the homologous arm, the retrievable selection marker HBU, the HMGR gene, and the GGS gene into the pMD19-T simple vector to obtain the pMD-HA5-HG plasmid.

[0096] S4) Insert the homologous arm, the retrievable selection marker HBU, the ERG20 gene, and the IDI gene into the pMD19-T simple vector to obtain the pMD-HA6-E20I plasmid.

[0097] S5) Insert the homologous arm, the retrievable selection marker HBU, and the oluLCY gene into the pMD19-T simple vector to obtain the pMD-HA7-LCY plasmid and the pMD-HA10-LCY plasmid.

[0098] S6) Insert the homologous arm, the retrievable selection marker HBU, the LUT1 gene, and the LUT5 gene into the pMD19-T simple vector to obtain the pMD-HA8-LUT plasmid, pMD-HA11-LUT plasmid, and pMD-HA12-LUT plasmid.

[0099] S7) Insert the homologous arm, the retrievable selection marker HBU, and the ATR2 gene into the pMD19-T simple vector to obtain the pMD-HA9-ATR2 plasmid and the pMD-HA13-ATR2 plasmid.

[0100] S8) The plasmids obtained in S1) to S7) were transferred into *Yerovia lipophila* Po1f, and lutein-producing bacteria were screened.

[0101] In some embodiments of this application, step S1) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU, the TEF-carB-MIGT module with promoter and terminator, and the EXP-carRP-E78K-PEXT module into the pMD19-Tsimple vector to obtain the pMD-HA1-BRPM, pMD-HA3-BRPM, and pMD-HA4-BRPM plasmids.

[0102] In some embodiments of this application, step S2) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the TEF-HMGR-PRCT module, EXP-GGS-PRLT module, and LEU module with promoters and terminators into the pMD19-Tsimple vector to obtain the pMD-HA2-HGL plasmid.

[0103] In some embodiments of this application, step S3) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU, the TEF-HMGR-PRCT module with promoter and terminator, and the EXP-GGS-PRLT module into the pMD19-Tsimple vector to obtain the pMD-HA5-HG plasmid.

[0104] In some embodiments of this application, step S4) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU, the TEF-ERG20-MIGT module with promoter and terminator, and the EXP-IDI-LIPT module into the pMD19-Tsimple vector to obtain the pMD-HA6-E20I plasmid.

[0105] In some embodiments of this application, step S5) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU and the TEFIN-oluLCY-PRCT module with promoter and terminator into the pMD19-Tsimple vector to obtain pMD-HA7-LCY plasmid and pMD-HA10-LCY plasmid.

[0106] In some embodiments of this application, step S6) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU, the TEFIN-LUT1-PRCT module with promoter and terminator, and the EXP-LUT5-PRLT module into the pMD19-Tsimple vector to obtain pMD-HA8-LUT plasmid, pMD-HA11-LUT plasmid, and pMD-HA12-LUT plasmid.

[0107] In some embodiments of this application, step S7) specifically involves inserting the homologous arm sequence into the pMD19-Tsimple vector, and then inserting the retrievable screening marker HBU and the TEFIN-ATR2-PRCT modulus with promoter and terminator into the pMD19-Tsimple vector to obtain the pMD-HA9-ATR2 plasmid and the pMD-HA13-ATR2 plasmid.

[0108] In some embodiments of this application, step S8) specifically involves first linearizing the plasmids obtained in steps S1) to S4) and then transferring them into *Yarrowia lipolytica* Po1f to screen for lycopene-producing bacteria. Then, the plasmids obtained in steps S5) to S7) are linearized and transferred into the aforementioned lycopene-producing bacteria to screen for lutein-producing genetically engineered bacteria.

[0109] In some embodiments of this application, the method of transforming plasmids into Yarrowialipolytica Po1f can employ conventional methods in the prior art, such as LiAc / PEG transformation, electroporation transformation, protoplast transformation, PEG1000 transformation, direct transformation, etc.

[0110] In some embodiments of this application, a retrievable selection marker HBU is used for screening. The retrievable selection marker HBU contains the URA3 gene and a homologous arm, and is inserted into a plasmid via HindIII-EcoRI digestion. The URA3 gene encodes an enzyme involved in uracil synthesis; in a uracil-free medium, only cells containing the URA3 gene can grow. After screening is complete, URA3 is removed from the genome via homologous arm recombination. Successful removal of the URA3 gene can be confirmed by screening in a medium containing FOA (5-fluoroorotic acid); only cells with the URA3 gene removed can grow on FOA-containing medium. The nucleotide sequence of the retrievable selection marker HBU is shown in SEQ ID No. 3.

[0111] SEQ ID No. 3:

[0112]

[0113] In some embodiments of this application, a LEU selection marker is also used for screening. The LEU gene encodes a key enzyme involved in leucine biosynthesis. In a leucine-free culture medium, only cells containing the LEU gene can grow. Therefore, cells can be screened by whether they can grow in a leucine-free culture medium. The nucleotide sequence of the LEU selection marker is available in GeneBank accession number M37309.

[0114] In some embodiments of this application, screening can be performed using appropriate culture media that match these genes in the prior art, based on the retrievable screening marker HBU and the screening marker LEU used in this application. The screening process is not limited, as long as mutant strains successfully transformed with plasmids can be screened through these genes. For example, strains successfully transformed with plasmids carrying the LEU marker can be screened by culturing in a leucine-free medium; strains successfully transformed with plasmids carrying the URA3 gene and the retrievable screening marker can be screened by culturing in a uracil-free selective medium, and the URA3 gene can be removed from the genome through homologous recombination of homologous arms at both ends of the URA3 gene, and strains with URA3 removed can be screened using YPD+FOA medium.

[0115] In the specific embodiments of this application, the method used for plasmid linearization can be SwaI enzyme digestion.

[0116] This application obtained a high-yield strain of lutein through genetic engineering and ultraviolet mutagenesis. Therefore, this application also provides the application of the above-mentioned genetically engineered strain that produces lutein, or the above-mentioned Yarrowia lipolytica MC249, in the production of lutein.

[0117] This application also provides a method for producing lutein, which involves inoculating the above-mentioned lutein-producing genetically engineered bacteria or the above-mentioned Yarrowia lipolytica MC249 into a fermentation medium and fermenting to obtain lutein. The method for producing lutein can employ shake-flask fermentation or fermenter fermentation.

[0118] In some embodiments of this application, the above-mentioned bacteria can be inoculated into shake flasks for fermentation. The fermentation culture medium includes a carbon source and a nitrogen source. The carbon source is selected from one or more of glucose, soybean oil, glycerol, ethanol, sucrose, lactose, sorbitol, maltose, starch, xylose, galactose, and acetate. The nitrogen source is selected from one or more of yeast extract, peptone, ammonium chloride, ammonium sulfate, urea, sodium nitrate, ammonium nitrate, soybean meal, corn steep liquor, and skim milk powder. In some preferred embodiments, the composition of the fermentation culture medium may be: glucose 30-70 g / L, peptone 5-25 g / L, yeast extract 10-30 g / L, and the remainder being water. The concentration of glucose in the fermentation culture medium may be 30-40 g / L, 40-50 g / L, 50-60 g / L, or 60-70 g / L, and the concentration of peptone in the fermentation culture medium may be 5-10 g / L or 10-15 g / L. The concentration of yeast powder in the fermentation medium can be 10-15 g / L, 15-20 g / L, 20-25 g / L, or 25-30 g / L. In the most preferred embodiment of this application, the composition of the fermentation medium can be: 50 g / L glucose, 15 g / L peptone, 20 g / L yeast powder, and the remainder is water.

[0119] The fermentation temperature is 20–37°C. In specific embodiments of this application, the fermentation temperature can be 20–22°C, 22–24°C, 24–26°C, 26–28°C, 28–30°C, 30–32°C, 32–34°C, or 34–37°C. In a preferred embodiment of this application, the fermentation temperature is 28°C.

[0120] The fermentation time is 72-168 hours. In specific embodiments of this application, the fermentation time can be 72-96 hours, 96-120 hours, 120-144 hours, or 144-168 hours. In a preferred embodiment of this application, the fermentation time is 120 hours.

[0121] The fermentation speed is 150-260 rpm. In specific embodiments of this application, the fermentation speed can be 150-160 rpm, 160-170 rpm, 170-180 rpm, 180-190 rpm, 190-200 rpm, 200-210 rpm, 210-220 rpm, 220-230 rpm, 230-240 rpm, 240-250 rpm, or 250-260 rpm. In a preferred embodiment of this application, the fermentation speed is 220 rpm.

[0122] In some other embodiments of this application, the above-mentioned bacteria can be inoculated into a fermenter for fermentation. The fermentation culture medium includes a carbon source, a nitrogen source, and inorganic salts. The carbon source is selected from one or more of glucose, soybean oil, glycerol, ethanol, sucrose, lactose, sorbitol, maltose, starch, xylose, galactose, and acetate. The nitrogen source is selected from one or more of yeast powder, peptone, ammonium chloride, ammonium sulfate, urea, sodium nitrate, ammonium nitrate, soybean meal, corn steep liquor, and skim milk powder. The inorganic salts are selected from one or more of potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium sulfate, magnesium sulfate, ammonium sulfate, ferrous sulfate, calcium chloride, sodium chloride, and calcium carbonate. In some preferred embodiments, the composition of the fermentation culture medium may be: glucose 20-60 g / L, peptone 5-25 g / L, yeast powder 10-30 g / L, potassium dihydrogen phosphate 2-6 g / L, ferrous sulfate 0.5-3 g / L, and the remainder is water. For example, in some embodiments of this application, the concentration of glucose in the fermentation medium can be 20-30 g / L, 30-40 g / L, 40-50 g / L, or 50-60 g / L; the concentration of peptone in the fermentation medium can be 5-10 g / L, 10-15 g / L, 15-20 g / L, or 20-25 g / L; and the concentration of yeast extract in the fermentation medium can be 10-15 g / L. The concentration of potassium dihydrogen phosphate in the fermentation medium can be 15-20 g / L, 20-25 g / L, or 25-30 g / L; the concentration of potassium dihydrogen phosphate in the fermentation medium can be 2-3 g / L, 3-4 g / L, 4-5 g / L, or 5-6 g / L; and the concentration of ferrous sulfate in the fermentation medium can be 0.5-1 g / L, 1-1.5 g / L, 1.5-2 g / L, 2-2.5 g / L, or 2.5-3 g / L. In the most preferred embodiment of this application, the fermentation medium consists of 40 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 4 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder is water.

[0123] The fermentation temperature is 20–37°C. In specific embodiments of this application, the fermentation temperature can be 20–22°C, 22–24°C, 24–26°C, 26–28°C, 28–30°C, 30–32°C, 32–34°C, or 34–37°C. In a preferred embodiment of this application, the fermentation temperature is 28°C.

[0124] The fermentation time is 72-240 hours. In specific embodiments of this application, the fermentation time can be 72-96 hours, 96-120 hours, 120-144 hours, 144-168 hours, 168-192 hours, 192-216 hours, or 216-240 hours. In a preferred embodiment of this application, the fermentation time is 160 hours.

[0125] The fermentation speed is 500-900 rpm. For example, the fermentation speed can be 500-550 rpm, 550-600 rpm, 600-650 rpm, 650-700 rpm, 700-750 rpm, 750-800 rpm, 800-850 rpm, or 850-900 rpm, and the speed range can be dynamically adjusted according to the actual situation.

[0126] When using a fermenter for fermentation, air is introduced into the fermenter. Generally, the aeration ratio can be 0.5–1.5:1. In specific embodiments of this application, the aeration ratio can be 0.5–0.6:1, 0.6–0.7:1, 0.7–0.8:1, 0.8–0.9:1, 0.9–1.0:1, 1.0–1.1:1, 1.1–1.2:1, 1.2–1.3:1, 1.3–1.4:1, or 1.4–1.5:1. In a preferred embodiment of this application, the aeration ratio is 1:1. The aeration ratio refers to the ratio of the amount of air introduced into the fermenter to the volume of the fermentation liquid.

[0127] When using a fermenter for culture, a carbon source needs to be added during the fermentation process. For example, for a 3L fermenter containing 1.5L of fermentation medium, the flow rate for adding glucose (500g / L, the remainder being water) during fermentation is 5-20mL / h. In specific embodiments of this application, the flow rate can be 5-7mL / h, 7-9mL / h, 9-11mL / h, 11-13mL / h, 13-15mL / h, 15-17mL / h, 17-19mL / h, or 19-20mL / h. In a preferred embodiment, for a 3L fermenter containing 1.5L of fermentation medium, the flow rate for adding glucose (500g / L, the remainder being water) during fermentation is 10mL / h.

[0128] In a specific embodiment of this application, before inoculation into the fermentation medium, the method may further include a process of preparing a seed culture, and then inoculating the seed culture into the fermentation medium. The process of preparing the seed culture includes inoculating Yarrowia lipolytica MC249 onto a plate culture medium for plate culture, then inoculating a piece onto a seed culture medium for seed culture to obtain the seed culture.

[0129] The plate culture medium and seed culture medium can be conventional culture media, such as YPD medium. YPD medium can be YPD plate culture medium that can be purchased through conventional channels, or it can be prepared by yourself and the ratio of components can be adjusted according to the actual situation. The components can be glucose 20g / L, peptone 20g / L, yeast powder 10g / L, and the remainder is water.

[0130] Furthermore, the plate culture temperature is 20–37°C. In some embodiments of this application, the plate culture temperature can be 20–22°C, 22–24°C, 24–26°C, 26–28°C, 28–30°C, 30–32°C, 32–34°C, or 34–37°C. In a preferred embodiment of this application, the plate culture temperature is 28°C.

[0131] Furthermore, the plate culture time is 48-96 hours. In some embodiments of this application, the plate culture time can be 48-72 hours or 72-96 hours. In a preferred embodiment of this application, the plate culture time is 72 hours.

[0132] Furthermore, the seed culture temperature is 20–37°C. In some embodiments of this application, the seed culture temperature can be 20–22°C, 22–24°C, 24–26°C, 26–28°C, 28–30°C, 30–32°C, 32–34°C, or 34–37°C. In a preferred embodiment of this application, the seed culture temperature is 28°C.

[0133] Furthermore, the seed culture time is 12-36 hours. In some embodiments of this application, the seed culture time is 12-24 hours, or it can be 24-36 hours. In a preferred embodiment of this application, the seed culture time is 24 hours.

[0134] Furthermore, the inoculation amount of the seed liquid into the fermentation medium is 5-20%, where the inoculation amount refers to the proportion of the volume of the seed liquid in the volume of the fermentation medium. In specific embodiments of this application, the inoculation amount can be 5-10%, 10-15%, or 15-20%. In a preferred embodiment of this application, the inoculation amount of the seed liquid into the fermentation medium is 10%.

[0135] Materials used in the examples:

[0136] 1. Primers

[0137] The primers used in this application are shown in Table 1:

[0138] Table 1 Primer List

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] 2. The β-carotene synthesis gene carB from Mucor circinelloides was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No. 1. It was inserted into the pUC57 vector to obtain pUC-CARB.

[0146] 3. The E78K mutation in the β-carotene synthesis gene carRP in Mucor circinelloides can block the activity of β-carotene cyclase (Antonio Velayos, Arturo P. Eslava, Enrique A. Iturriaga. Abifunctional enzyme with lycopene cyclase and phytoene synthase activities is encoded by the carRP gene of Mucor circinelloides. European Journal of Biochemistry. 2000; 267(17):5509). The mutated carRP-E78K was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No.2. It was inserted into the pUC57 vector to obtain pUC-CARRP-E78K.

[0147] 4. The recyclable screening marker HBU was obtained by inserting homologous arm fragments at both ends of URA3, the sequence of which is shown in SEQ ID No. 3. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and pUC-HBU was obtained by inserting it into the pUC57 vector.

[0148] 5. The LEU screening marker is found in GeneBank accession number M37309. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and inserted into the pUC57 vector to obtain pUC-LEU.

[0149] 6. Genes HMGR (sequence in SEQ ID No. 4), GGS (sequence in SEQ ID No. 5), ERG20 (sequence in SEQ ID No. 6), IDI (sequence in SEQ ID No. 7), promoters TEF, TEFIN, EXP, and terminators PRCT, PRLT, MIGT, PEXT, LIPT were all derived from *Yeroga lipolytica* and obtained by PCR.

[0150] 7. The lycopene cyclase gene OluLCY of Ostreococcus lucimarinus was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No. 8. It was inserted into the pUC57 vector to obtain pUC-LCY.

[0151] 8. The carotene hydroxylase LUT1 in Arabidopsis thaliana, which removes 36 amino acid residues from its N-terminus, is a transport peptide synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No. 9. It is inserted into the pUC57 vector to obtain pUC-LUT1.

[0152] 9. The carotene hydroxylase LUT5 in Arabidopsis thaliana, after removing 28 amino acid residues from the N-terminus, was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No. 10. It was inserted into the pUC57 vector to obtain pUC-LUT5.

[0153] 10. The transport peptide of the P450 reductase ATR2 in Arabidopsis thaliana, which has 44 amino acid residues removed from its N-terminus, was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. after codon optimization. The sequence is shown in SEQ ID No. 11. It was inserted into the pUC57 vector to obtain pUC-ATR2.

[0154] Example 1: Construction and Shaking Flask Fermentation of Engineered Bacteria for Producing Lycopene

[0155] In this embodiment, a lycopene-producing strain was obtained by additionally expressing two copies of GGS and HMGR from Yarrowia lipolytica, one copy of the lycopene precursor GGPP synthesis gene such as ERG20 and IDI from Yarrowia lipolytica, and three copies of the codon-optimized carB and carRP-E78K genes from Mucor truncatula in Yarrowia lipolytica Po1f (genotype: MatA,leu2-270,ura3-302,xpr2-322,Leu-,Ura-,Suc+,ΔAEP,ΔAXP) (Madzak C. Yarrowia lipolytica Strains and Their Biotechnological Applications: How Natural Biodiversity and Metabolic Engineering Could Contribute to Cell Factories Improvement. Journal of Fungi. 2021;7(7):548.).

[0156] 1.1 Construction of plasmid pMD-HA1-BRPM

[0157] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA1U-F / R and HA1D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA1 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA1 to obtain pMD-HA1-HBU.

[0158] 2) Using the Yerovia lipophila chromosome as a template, the promoter TEF and terminator MIGT were amplified using primers KTBM-1 / 2 and KTBM-5 / 6. Using pUC-CARB as a template, the gene carB was amplified using primers KTBM-3 / 4. Then, the TEF-carB-MIGT module was amplified by overlap PCR.

[0159] 3) Using the Yerovia lipophila chromosome as a template, the promoter EXP and terminator PEXT were amplified using primers KERPM-1 / 2 and KERPM-5 / 6. The gene carRP-E78K was amplified using primers KERPM-3 / 4 using pUC-CARRP-E78K as a template. Then, the EXP-carRP-E78K-PEXT module was amplified by overlap PCR.

[0160] 4) Using the One Step Fusion Cloning Mix kit (TOROIVD), the modules TEF-carB-MIGT and EXP-carRP-E78K-PEXT were integrated into the pMD-HA1-HBU plasmid to obtain pMD-HA1-BRPM. The assembly order of each module in the pMD-HA1-BRPM plasmid is as follows: Figure 1 .

[0161] 1.2 Construction of plasmid pMD-HA2-HGL

[0162] 1) Using the Yerovia lipolyticis chromosome as a template, the homologous arm sequence on the chromosome was amplified using primers HA2U-F / R and HA2D-F / R, and then inserted into the pMD19-T simple vector to obtain the pMD-HA2 plasmid.

[0163] 2) Using the Yerovia lipophila chromosome as a template, the promoter TEF, gene HMGR, and terminator PRCT were amplified using primers TTHM-1 / 2, TTHM-3 / 4, and TTHM-5 / 6. Then, the TEF-HMGR-PRCT module was amplified by overlap PCR.

[0164] 3) Using the Yerovia lipophila chromosome as a template, the promoter EXP, gene GGS, and terminator PRLT were amplified using primers EGGS-1 / 2, EGGS-3 / 4, and EGGS-5 / 6. Then, the EXP-GGS-PRLT module was amplified by overlap PCR.

[0165] 4) Using pUC-LEU as a template, the LEU module was amplified using primers LEU-1 / 2.

[0166] 5) Using the One Step Fusion Cloning Mix kit, the modules TEF-HMGR-PRCT, EXP-GGS-PRLT, and LEU were integrated into the pMD-HA2 plasmid to obtain pMD-HA2-HGL. The assembly order of each module in the pMD-HA2-HGL plasmid is as follows: Figure 2 .

[0167] 1.3 Construction of plasmid pMD-HA3-BRPM

[0168] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA3U-F / R and HA3D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA3 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA3 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA3-HBU.

[0169] 2) Using plasmid pMD-HA1-BRPM from Example 1.1 as a template, the TEF-carB-MIGT module was amplified using primers HA3CB-1 / 2.

[0170] 3) Using plasmid pMD-HA1-BRPM from Example 1.1 as a template, the EXP-carRP-E78K-PEXT module was amplified using primers HA3CRPM-1 / 2.

[0171] 4) Using the One Step Fusion Cloning Mix kit, the TEF-carB-MIGT and EXP-carRP-E78K-PEXT modules were integrated into the pMD-HA3-HBU plasmid to obtain pMD-HA3-BRPM. The assembly order of each module in the pMD-HA3-BRPM plasmid is as follows: Figure 3 .

[0172] 1.4 Construction of plasmid pMD-HA4-BRPM

[0173] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA4U-F / R and HA4D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA4 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA4 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA4-HBU.

[0174] 2) Using plasmid pMD-HA1-BRPM from Example 1.1 as a template, the TEF-carB-MIGT module was amplified using primers HA4CB-1 / 2.

[0175] 3) Using plasmid pMD-HA1-BRPM from Example 1.1 as a template, the EXP-carRP-E78K-PEXT module was amplified using primers HA4CRPM-1 / 2.

[0176] 4) Using the One Step Fusion Cloning Mix kit, the TEF-carB-MIGT and EXP-carRP-E78K-PEXT modules were integrated into the pMD-HA4-HBU plasmid to obtain pMD-HA4-BRPM. The assembly order of each module in the pMD-HA4-BRPM plasmid is as follows: Figure 4 .

[0177] 1.5 Construction of plasmid pMD-HA5-HG

[0178] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA5U-F / R and HA5D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA5 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA5 to obtain pMD-HA5-HBU.

[0179] 2) Using plasmid pMD-HA2-HGL from Example 1.2 as a template, the TEF-HMGR-PRCT module was amplified using primers HA5HM-1 / 2.

[0180] 3) Using plasmid pMD-HA2-HGL from Example 1.2 as a template, the EXP-GGS-PRLT module was amplified using primers HA5GS-1 / 2.

[0181] 4) Using the One Step Fusion Cloning Mix kit, the TEF-HMGR-PRCT and EXP-GGS-PRLT modules were integrated into the pMD-HA5-HBU plasmid to obtain pMD-HA5-HG. The assembly order of each module in the pMD-HA5-HG plasmid is as follows: Figure 5 .

[0182] 1.6 Construction of plasmid pMD-HA6-E20I

[0183] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA6U-F / R and HA6D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA6 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA6 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA6-HBU.

[0184] 2) Using the Yerovia lipophila chromosome as a template, the promoter TEF, gene ERG20, and terminator MIGT were amplified using primers TE20M-1 / 2, TE20M-3 / 4, and TE20M-5 / 6. Then, the TEF-ERG20-MIGT module was amplified by overlap PCR.

[0185] 3) Using the Yerovia lipophila chromosome as a template, the promoter EXP, gene IDI, and terminator LIPT were amplified using primers EIDI-1 / 2, EIDI-3 / 4, and EIDI-5 / 6. Then, the EXP-IDI-LIPT module was amplified by overlap PCR.

[0186] 4) Using the One Step Fusion Cloning Mix kit, the TEF-ERG20-MIGT and EXP-IDI-LIPT modules were integrated into the pMD-HA6-HBU plasmid to obtain pMD-HA6-E20I. The assembly order of each module in the pMD-HA6-E20I plasmid is as follows: Figure 6 .

[0187] 1.7 Construction of Lycopene-producing genetically engineered bacteria

[0188] pMD-HA1-BRPM was linearized by digestion with SwaⅠ and then transformed into Yerovia po1f using the Frozen-EZ Yeast Transformation II Kit (ZYMO RESEARCH). The mixture was then plated on SD+LEU medium plates (20 g / L glucose, 6.7 g / L YNB (yeast basal nitrogen source), 10 mg / L leucine, 20 g / L agar powder, and the remainder being water) and the mutant strain YBRPM was obtained through screening.

[0189] pMD-HA2-HGL was linearized by SwaⅠ restriction enzyme digestion and then transformed into the Yerva lipolytica mutant strain YBRPM. The mixture was then plated on SD medium plates (20 g / L glucose, 6.7 g / L YNB (yeast basal nitrogen source), 20 g / L agar powder, and the remainder was water) and the mutant strain YBRPM-HGL was obtained by screening.

[0190] YBRPM-HGL was cultured in YPD (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, the remainder being water), then diluted and spread on YPD+FOA medium plates (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid, 20 g / L agar powder). Homologous arms in the screening marker HBU were recovered and recombination eliminated URA3, resulting in the selection of the URA3-deficient mutant strain YBRPM-HGL-FOA.

[0191] pMD-HA3-BRPM was linearized by digestion with SwaI and then transformed into YRPM-HGL-FOA, resulting in the mutant strain YBRPM2-HGL. Similarly, YBRPM2-HGL was delabeled by removing the URA3 marker, and pMD-HA4-BRPM was linearized by digestion with SwaI and then transformed into it to obtain the mutant strain YRPM3-HGL. YBRPM3-HGL was delabeled by removing the URA3 marker, and pMD-HA5-HG was linearized by digestion with SwaI and then transformed into it to obtain the mutant strain YBRPM3-HG2L. YBRPM3-HG2L was delabeled by removing the URA3 marker, and pMD-HA6-E20I was linearized by digestion with SwaI and then transformed into it to obtain the mutant strain YBRPM3-HG2L-E20I.

[0192] 1.8 Shaking flask fermentation of engineered strain YRPBM3-HG2L-E20I

[0193] YRPBM3-HG2L-E20I was streaked onto YPD plates and cultured at 28°C for 3 days. A small amount was then inoculated into a 250 mL shake flask containing 25 mL of YPD seed culture medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and the remainder water), and cultured at 28°C with shaking at 220 rpm for 24 h. Then, the seed culture was transferred at a 10% (v / v) inoculation rate to a 250 mL shake flask containing 25 mL of fermentation medium (50 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, and the remainder water), and cultured at 28°C with shaking at 220 rpm for 5 days. The lycopene content in the fermentation broth was determined to be 1106.4 mg / L using HPLC. HPLC conditions: Agilent ZORBAX EclipsePlus C18 (250 mm × 4.6 mm, 5 μm); mobile phase A: tetrahydrofuran; mobile phase B: 95% acetonitrile; column temperature: 32℃; flow rate: 1 mL / min; injection volume: 5 μL; detection wavelength: 472 nm. Gradient elution: mobile phase A: 0-8 min (v / v) 10-35%, 8-10 min (v / v) 35-50%, 10-18 min (v / v) 50%; mobile phase B: 0-8 min (v / v) 90-65%, 8-10 min (v / v) 65-50%, 10-18 min (v / v) 50%.

[0194] Example 2 Construction of lutein-producing genetically engineered bacteria

[0195] In this embodiment, lycopene is converted into α-carotene by expressing two copies of the codon-optimized lycopene cyclase gene OlulCY from Ostreococcus lucimarinus in YRPBM3-HG2L-E20I, and α-carotene is converted into lutein by expressing three copies of the codon-optimized carotene hydroxylase genes LUT5 and LUT1 from Arabidopsis thaliana, and two copies of the codon-optimized P450 reductase gene ATR2 from Arabidopsis thaliana.

[0196] 2.1 Construction of plasmid pMD-HA7-LCY

[0197] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA7U-F / R and HA7D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA7 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA7 to obtain pMD-HA7-HBU.

[0198] 2) Using the Yerovia lipophila chromosome as a template, the promoter TEFIN and terminator PRCT were amplified using primers TILCY-1 / 2 and TILCY-5 / 6. The gene oluLCY was amplified using primers TILCY-3 / 4 using pUC-LCY as a template. Then, the TEFIN-oluLCY-PRCT module was amplified by overlap PCR.

[0199] 3) The TEFIN-oluLCY-PRCT module was integrated into the pMD-HA7-HBU plasmid using the One Step Fusion Cloning Mix kit to obtain pMD-HA7-LCY. The assembly order of each module in the pMD-HA7-LCY plasmid is as follows: Figure 7 .

[0200] 2.2 Construction of plasmid pMD-HA8-LUT

[0201] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA8U-F / R and HA8D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA8 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA8 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA8-HBU.

[0202] 2) Using the Yerovia lipolytica chromosome as a template, the promoter TEFIN and terminator PRCT were amplified using primers TLU1-1 / 2 and TLU1-5 / 6. Using pUC-LUT1 as a template, the gene LUT1 was amplified using primers TLU1-3 / 4. Then, the TEFIN-LUT1-PRCT module was amplified by overlap PCR.

[0203] 3) Using the Yerovia lipophila chromosome as a template, the promoter EXP and terminator PRLT were amplified using primers ELU5-1 / 2 and ELU5-5 / 6. The gene LUT5 was amplified using primers ELU5-3 / 4 using pUC-LUT5 as a template. Then, the EXP-LUT5-PRLT module was amplified by overlap PCR.

[0204] 4) Using the One Step Fusion Cloning Mix kit, modules TEFIN-LUT1-PRCT and EXP-LUT5-PRLT were integrated into the pMD-HA8-HBU plasmid to obtain pMD-HA8-LUT. The assembly order of each module in the pMD-HA8-LUT plasmid is as follows: Figure 8 .

[0205] 2.3 Construction of plasmid pMD-HA9-ATR2

[0206] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA9U-F / R and HA9D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA9 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA9 to obtain pMD-HA9-HBU.

[0207] 2) Using the Yerovia lipophila chromosome as a template, the promoter TEFIN and terminator PRCT were amplified using primers TATR2-1 / 2 and TATR2-5 / 6. The gene ATR2 was amplified using primers TATR2-3 / 4 using pUC-ATR2 as a template. Then, the TEFIN-ATR2-PRCT module was amplified by overlap PCR.

[0208] 3) Using the One Step Fusion Cloning Mix kit, the TEFIN-ATR2-PRCT module was integrated into the pMD-HA9-HBU plasmid to obtain pMD-HA9-ATR2. The assembly order of each module in the pMD-HA9-ATR2 plasmid is as follows: Figure 9 .

[0209] 2.4 Construction of plasmid pMD-HA10-LCY

[0210] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA10U-F / R and HA10D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA10 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA10 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA10-HBU.

[0211] 2) Using plasmid pMD-HA7-LCY from Example 2.1 as a template, the TEFIN-oluLCY-PRCT module was amplified using primers HA10LCY-1 / 2.

[0212] 3) The TEFIN-oluLCY-PRCT module was integrated into the pMD-HA10-HBU plasmid using the One Step Fusion Cloning Mix kit to obtain pMD-HA10-LCY. The assembly order of each module in the pMD-HA10-LCY plasmid is as follows: Figure 10 .

[0213] 2.5 Construction of plasmid pMD-HA11-LUT

[0214] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA11U-F / R and HA11D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA11 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA11 to obtain pMD-HA11-HBU.

[0215] 2) Using plasmid pMD-HA8-LUT from Example 2.2 as a template, the TEFIN-LUT1-PRCT module was amplified using primers HA11LU1-1 / 2.

[0216] 3) Using plasmid pMD-HA8-LUT from Example 2.2 as a template, the EXP-LUT5-PRLT module was amplified using primers HA11LU5-1 / 2.

[0217] 4) Using the One Step Fusion Cloning Mix kit, modules TEFIN-LUT1-PRCT and EXP-LUT5-PRLT were integrated into the pMD-HA11-HBU plasmid to obtain pMD-HA11-LUT. The assembly order of each module in the pMD-HA11-LUT plasmid is as follows: Figure 11 .

[0218] 2.6 Construction of plasmid pMD-HA12-LUT

[0219] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA12U-F / R and HA12D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA12 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was then inserted into pMD-HA12 via HindIII-EcoRI restriction enzyme digestion to obtain pMD-HA12-HBU.

[0220] 2) Using plasmid pMD-HA8-LUT from Example 2.2 as a template, the TEFIN-LUT1-PRCT module was amplified using primers HA12LU1-1 / 2.

[0221] 3) Using plasmid pMD-HA8-LUT from Example 2.2 as a template, the EXP-LUT5-PRLT module was amplified using primers HA12LU5-1 / 2.

[0222] 4) Using the One Step Fusion Cloning Mix kit, modules TEFIN-LUT1-PRCT and EXP-LUT5-PRLT were integrated into the pMD-HA12-HBU plasmid to obtain pMD-HA12-LUT. The assembly order of each module in the pMD-HA12-LUT plasmid is as follows: Figure 12 .

[0223] 2.7 Construction of plasmid pMD-HA13-ATR2

[0224] 1) Using the *Yerovia lipolytica* chromosome as a template, homologous arm sequences on the chromosome were amplified using primers HA13U-F / R and HA13D-F / R, and inserted into the pMD19-T simple vector to obtain the pMD-HA13 plasmid. The retrievable selection marker HBU containing URA3 on pUC-HBU was digested with HindIII-EcoRI and inserted into pMD-HA13 to obtain pMD-HA13-HBU.

[0225] 2) Using plasmid pMD-HA9-ATR2 from Example 2.3 as a template, the TEFIN-ATR2-PRCT module was amplified using primers HA13ATR-1 / 2.

[0226] 3) Using the One Step Fusion Cloning Mix kit, the TEFIN-ATR2-PRCT module was integrated into the pMD-HA13-HBU plasmid to obtain pMD-HA13-ATR2. The assembly order of each module in the pMD-HA13-ATR2 plasmid is as follows: Figure 13 .

[0227] 2.8 Construction of lutein-producing genetically engineered bacteria

[0228] Referring to the method in 1.7 of Example 1, the URA3 marker in YRPBM3-HG2L-E20I was eliminated, and the plasmid pMD-HA7-LCY was linearized and then transferred into it to obtain the mutant strain YLCY; the URA3 marker in YLCY was eliminated, and the plasmid pMD-HA8-LUT was linearized and then transferred into it to obtain the mutant strain YLCY-LUT; the URA3 marker in YLCY-LUT was eliminated, and the plasmid pMD-HA9-ATR2 was linearized and then transferred into it to obtain the mutant strain YLCY-LUT-ATR, thus initially obtaining the lutein-producing bacteria.

[0229] To further enhance lutein synthesis and increase the expression of oluLCY, LUT5, LUT1, and ATR2, after removing the URA3 marker from YLCY-LUT-ATR, the plasmids pMD-HA10-LCY, pMD-HA11-LUT, pMD-HA12-LUT, and pMD-HA13-ATR2 were linearized and sequentially transferred into them to obtain the corresponding mutants YLCY2-LUT-ATR, YLCY2-LUT2-ATR, YLCY2-LUT3-ATR, and YLCY2-LUT3-ATR2.

[0230] Example 3: Lutein-producing genetically engineered bacteria fermentation in shake flasks

[0231] Following the method described in section 1.8 of Example 1, engineered strains YLCY-LUT-ATR, YLCY2-LUT-ATR, YLCY2-LUT2-ATR, YLCY2-LUT3-ATR, and YLCY2-LUT3-ATR2 were subjected to shake-flask fermentation. Lutein content was detected using HPLC. The HPLC method was referenced from Lee HS, Castle WS, and Coates G A. High-performance liquid chromatography for the characterization of carotenoids in the new sweet orange (Earlygold) grown in Florida, USA. Journal of Chromatography A. 2001; 913(1-2):371. Lutein yields for each strain are shown in Table 2.

[0232] Table 2. Lutein yield per flask for each strain

[0233] strains Lutein production (mg / L) YLCY-LUT-ATR 41.6 YLCY2-LUT-ATR 43.3 YLCY2-LUT2-ATR 82.0 YLCY2-LUT3-ATR 91.7 YLCY2-LUT3-ATR2 119.5

[0234] Example 4: Ultraviolet Mutagenesis and Screening of Mutants

[0235] Take fresh YLCY2-LUT3-ATR2 YPD culture medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and the remainder water), wash with physiological saline, resuspend the cells, and transfer 5 mL of the cell suspension to a petri dish. Stir with a magnetic stirrer and place under a 15W UV lamp for mutagenesis for 40 s. After mutagenesis, dilute the bacterial suspension and spread it on YPD plates, and incubate at 28°C in the dark for 3 days.

[0236] The colonies that grew after mutagenesis were fermented in shake-flasks according to the method in Example 3. Strains with increased yields were screened and entered into the next round of mutagenesis. After repeated mutagenesis and selection, a high-yielding strain MC249 with a shake-flask yield of 201.6 mg / L of lutein was finally obtained. It is deposited at the China General Microbiological Culture Collection Center on April 15, 2024, with the accession number CGMCC NO.30340.

[0237] Example 5: Fermentation of lutein from mutant strain CGMCC NO.30340 in a fermenter.

[0238] The mutant strain CGMCC NO.30340 was streaked onto YPD plates and cultured at 28°C for 3 days. The resulting fragments were then inoculated into 500 mL shake flasks containing 50 mL of YPD seed culture medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and the remainder being water). The flasks were then cultured at 28°C with shaking at 220 rpm for 24 h. Finally, the seed culture was transferred at a 10% (v / v) inoculation rate to a 3 L fermenter containing 1.5 L of fermentation medium (40 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 4 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder being water). Fermentation temperature was 28℃, aeration rate was 1:1 (vol:vol), stirring speed was 500-900 rpm, glucose (500 g / L, the remainder was water) was added starting at 20 h, flow rate was 10 mL / h, and lutein yield of CGMCC NO.30340 was 1.65 g / L, 1.82 g / L, and 1.97 g / L at 160 h, with an average yield of 1.81 g / L.

[0239] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

Claims

1. A lutein-producing genetically engineered bacterium, wherein the genetically engineered bacterium is a lycopene-producing bacterium, the lycopene-producing bacterium being *Yerovia lipophila*, and the genetically engineered bacterium contains the lycopene cyclase gene *OluLCY*, the carotene hydroxylase gene, and the P450 reductase gene *ATR2*.

2. The genetically engineered bacterium according to claim 1, characterized in that, The lutein-producing genetically engineered bacteria also possess one or more of the following characteristics: 1) The carotene hydroxylase genes include LUT5 and LUT1. Preferably, the carotene hydroxylase genes LUT5 and LUT1 are derived from Arabidopsis thaliana. More preferably, the nucleotide sequence encoding the N-terminal 28 amino acid residues of the carotene hydroxylase gene LUT5 is removed, and the nucleotide sequence encoding the N-terminal 36 amino acid residues of the carotene hydroxylase gene LUT1 is removed. More preferably, the carotene hydroxylase genes LUT5 and LUT1 are codon-optimized. More preferably, the carotene hydroxylase gene LUT5 contains the nucleotide sequence shown in SEQ ID No. 10; and the carotene hydroxylase gene LUT1 contains the nucleotide sequence shown in SEQ ID No.

9. 2) The lycopene cyclase gene OlulCY is derived from Ostreococcus lucimarinus. Preferably, the lycopene cyclase gene OlulCY has undergone codon optimization. More preferably, the lycopene cyclase gene OlulCY contains the nucleotide sequence shown in SEQ ID No.

8. 3) The P450 reductase gene ATR2 is derived from Arabidopsis thaliana. Preferably, the P450 reductase gene ATR2 has the nucleotide sequence encoding the N-terminal 44 amino acid residues transport peptide removed. More preferably, the P450 reductase gene ATR2 has undergone codon optimization. Even more preferably, the P450 reductase gene ATR2 contains the nucleotide sequence shown in SEQ ID No.

11. 4) The lycopene cyclase gene OlulCY has two or more copies; the carotene hydroxylase gene has three or more copies; and the P450 reductase gene ATR2 has two or more copies.

3. The genetically engineered bacterium according to claim 1, characterized in that, The lycopene-producing bacteria contains the precursor geraniol geraniol pyrophosphate synthesis gene, as well as the carB and carRP genes.

4. The genetically engineered bacteria according to claim 3, characterized in that, The lycopene-producing bacteria also have one or more of the following characteristics: ① The precursor geraniol geraniol pyrophosphate synthesis gene includes the GGS gene, HMGR gene, ERG20 gene, and IDI gene. Preferably, the precursor geraniol geraniol pyrophosphate synthesis gene is derived from *Yeroga lipolyticis*. More preferably, the GGS gene contains the nucleotide sequence shown in SEQ ID No. 5, the HMGR gene contains the nucleotide sequence shown in SEQ ID No. 4, the ERG20 gene contains the nucleotide sequence shown in SEQ ID No. 6, and the IDI gene contains the nucleotide sequence shown in SEQ ID No.

7. ② Both carB and carRP are derived from Mucor; preferably, the protein encoded by carRP has an E78K mutation; more preferably, carB and carRP have undergone codon optimization; even more preferably, the carB gene contains the nucleotide sequence shown in SEQ ID No. 1, and the carRP gene contains the nucleotide sequence shown in SEQ ID No.

2. ③ The GGS and HMGR genes have three or more copies, the ERG20 and IDI genes have two or more copies, and the carB and carRP genes have three or more copies.

5. A lipolytic yeast, Yarrowia lipolytica MC249, with accession number CGMCC NO.30340.

6. The Yarrowia lipolytica MC249 according to claim 5, characterized in that, The yield of lutein produced by fermentation of the Yarrowia lipolytica MC249 was above 1.65 g / L.

7. The Yarrowia lipolytica MC249 according to claim 5, characterized in that, The Yarrowia lipolytica MC249 contains the precursor geraniol pyrophosphate synthesis gene, carB gene, carRP gene, OlulCY gene, carotene hydroxylase gene, and ATR2 gene. Preferably, the precursor geraniol pyrophosphate synthesis gene includes the GGS gene, HMGR gene, ERG20 gene, and IDI gene; the carotene hydroxylase gene includes LUT5 and LUT1; and the protein encoded by the carRP gene has an E78K mutation.

8. A method for constructing a lutein-producing genetically engineered bacterium, using *Yarrowia lipolytica* Po1f as the starting strain, expressing the precursor geraniol geraniol pyrophosphate synthesis gene, the carB gene, the carRP gene, the OluLCY gene, the carotene hydroxylase gene, and the ATR2 gene in the starting strain. Preferably, the precursor geraniol geraniol pyrophosphate synthesis gene includes the GGS gene, the HMGR gene, the ERG20 gene, and the IDI gene; the carotene hydroxylase gene includes LUT5 and LUT1; and the protein encoded by the carRP gene has an E78K mutation.

9. The use of the lutein-producing genetically engineered bacteria according to any one of claims 1-4, or the lipolysin yeast Yarrowia lipolytica MC249 according to any one of claims 5-7, in the production of lutein.

10. A method for producing lutein, comprising inoculating a lutein-producing genetically engineered bacterium as described in any one of claims 1-4, or a lipophilic Yarrowia lipolytica MC249 as described in any one of claims 5-7, into a fermentation medium, and obtaining lutein through fermentation culture.

Images