Polyketide synthases or polyketide synthase mutants and uses thereof

Abstract

The application discloses a kind of polyketide synthase or polyketide synthase mutant and application thereof, belong to genetic engineering technical field.The polyketide synthase is AspiPKS4, AspiPKS5, AspiPKS6, AspiPKS7 of source of Cyatheales, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6 of source of leaf fig, CrPKS of source of water fern;The mutant is obtained by single-point mutation to the second amino acid of AspiPKS7 or N-terminal redundant sequence is deleted.The polyketide synthase or mutant replaces NnHispS in original FBP luminescent system, and the level of biological spontaneous light can be significantly improved.The application also provides a kind of simplified improved FBP system, includes the polyketide synthase or polyketide synthase mutant, CPH, H3H, Luz, improves the application convenience and application luminous capacity of FBP system.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, specifically to a class of polyketide synthases or polyketide synthase mutants and their application in improving the bioluminescence intensity of plants and animals or in tracer technology. Background Technology

[0002] Bioluminescence is a biochemical phenomenon caused by the action of a specific luciferase synthesized within an organism on a corresponding luciferin. It is widely found in marine and terrestrial organisms, including shrimp (Widder 2010), marine bacteria, and terrestrial fungi (Mahish). et al 2021), earthworm (Rodionova) et al 2017), Firefly (Martin) et al (2017). The fungal bioluminescence pathway (FBP) is a reaction pathway that enables fungi to produce bioluminescence. It exists in some bioluminescent fungi in nature and can produce bioluminescence with a wavelength of approximately 520 nm under suitable conditions (Kaskova). et al (2017).

[0003] Olivera et al. demonstrated that the process of bioluminescence in fungi is an enzyme-mediated reaction (Oliveira and Stevani. 2009). Subsequently, the research group continued to examine the bioluminescence of substrate-enzyme combinations in different fungal lineages, showing that all known bioluminescent fungi share the same luminescent system (Oliveira et al. 2009). et al (2012). Purtov et al. identified fungal luciferin and its precursor structure as 3-hydroxylated hispidin and hispidin in four bioluminescent fungi (Purtov et al.). et al (2015). Kaskova et al. reported the structure of fungal luciferase, investigated the mechanism of fungal bioluminescence, and revealed that fungal luciferase allows different α-pyranones to serve as chemiluminescent substrates (Kaskova et al.). et al (2017). Ultimately, Kotlobay et al. determined the fungal bioluminescence mechanism, revealing that FBP is a caffeic acid metabolic cycle composed of four enzymes (Kotlobay). et al (2018).

[0004] The caffeic acid metabolic cycle is as follows: In the cycle, caffeic acid is converted into milk tree alkaloid by Hispidin synthase (HispS), and then hydroxylated by Hispidin-3-hydroxylase (H3H) to generate fungal luciferin. The process of luciferin oxidation by luciferase (Luz) produces photons and achieves luminescence. Finally, it is converted back into caffeic acid by caffeoyl pyruvate hydrolase (CPH).

[0005] The FBP reaction pathway is clear, with caffeic acid as the starting substrate. Compared to the commonly used firefly luciferase system, caffeic acid has a well-defined metabolism, high stability, can be produced by plant and animal cells, and exhibits low cytotoxicity and easy absorption, making it suitable for developing self-luminescent plants and luminescent reporter indicators. For example, Mitiouchkina et al. successfully achieved autonomous luminescence in tobacco without the need for exogenous substrates (Mitiouchkina et al.). et al In 2020, Khakhar et al. developed a luminescent reporter system based on gene expression and hormone flux studies. et al (2020). In subsequent research, Professor Du Hao's team at Zhejiang University used metabolic engineering and computer-aided methods to enhance the intensity of plant autoluminescence, and simultaneously developed a DNA-protein interaction reporter system (Zheng) using FBP. et al 2023; Ge et al 2024; Sun et al . 2025). The Sarkisyan laboratory improved the practicality of the FBP system through enzyme modification and orthologous gene replacement (Shakhova). et al 2024; Palkina et al (2024). Therefore, modifying the FBP reaction pathway to enhance plant autoluminescence intensity and operational practicality has always been a research direction for researchers in this field.

[0006] Polyketides (PKs) are a class of widely available and numerous natural products. Polyketide synthases (PKS) catalyze the biosynthesis of PKs and are multifunctional complex enzymes with modular structures, composed of a series of symmetrical or asymmetrical dimer modules. Milkweed alkaloids are small polyketide compounds found in plants and fungi. In fungal luminescence pathways, milkweed alkaloids are important precursors, synthesized by type I polyketide synthase milkweed alkaloid synthase (HispS). This enzyme consists of five predicted domains: an AMP-binding domain, a ketase domain, an acyltransferase domain, and two acyl carrier protein domains. In practical applications, HispS usually needs to be co-expressed with phosphopanthel-thioethylamine acyltransferase for phosphopanthel-thioethylamine modification (pantothenic acidification) to improve activity. Furthermore, the existing FBP luminescence system uses NnHispS (derived from *Gymnotrichum*). Neonothopanus nambi HispS is a multimodal functional complex enzyme, which makes the luminescent system relatively large, making it difficult to apply in small delivery systems and greatly reducing the overall application flexibility.

[0007] In contrast, plants possess a more compact class of polyketide synthases with specific biosynthetic functions: type III polyketide synthases. These enzymes accept coenzyme A esters as substrates and do not require post-translational pantothenic modification. Patent document CN119082071 B discloses a grape polyketide synthase that, by replacing the HispS gene in the FBP system, significantly increases plant luminescence intensity and milkweed alkaloid content. Although current research has significantly improved plant luminescence intensity, the intensity remains relatively weak, failing to achieve true low-brightness illumination, and its use as a reporter and tracer system is also limited.

[0008] In addition, milk alkaloids are a PKC inhibitor with antioxidant properties (Lee et al 2011), anti-inflammatory (Wanggun) et al .2006), antiviral (Awadh) et al .2003) and neuroprotection (Park et al It has multiple pharmacological effects, such as those observed in 2004.

[0009] Therefore, developing type III polyketide synthases with high enzyme activity for use in the biosynthesis of milkweed alkaloids or for use in FBP systems to improve plant luminescence brightness and develop luminescence reporting indicators has great industrial value. Summary of the Invention

[0010] The purpose of this invention is to provide a polyketide synthase that can efficiently catalyze the biosynthesis of milk tree alkaloids, for the modification of FBP luminescence systems, to optimize and simplify existing FBP systems, and to apply it to the construction of self-luminescent plants to enhance the intensity of plant bioluminescence, or to the development of animal tracking technology in animal cell lines.

[0011] To achieve the above objectives, the present invention adopts the following technical solution:

[0012] This invention utilizes tobacco transient expression technology to study the expression of tobacco fern (Cyathea spinulosa). Alsophila spinulosa ), for the leaf fig ( Ficus hispida ), water fern ( Ceratopteris richardii ), maidenhair fern ( Adiantum capillus-veneris The bioactivity of several polyketide synthases from *Bryum simonii* and grape was compared, and AspiPKS4, AspiPKS5, AspiPKS6, and AspiPKS7 from *Cyathea spinulosa* were finally selected. For *Ficus microcarpa*, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6, and *Ceratophyllum demersum*, respectively, replacing the HispS coding gene in the original FBP luminescence system with these polyketide synthase coding genes significantly increased the bioluminescence intensity of tobacco leaves, with AspiPKS7 showing the most significant improvement. Further verification in lower plant mosses, various monocotyledonous and dicotyledonous plants, and animal cells also achieved high-brightness luminescence. Protein structure analysis showed that these enzymes have similar spatial structures, and their protein sequences all contain a core chalcone synthase (CHS) catalytic triplet.

[0013] Specifically, the amino acid sequence of AspiPKS7 is shown in SEQ ID NO.1; the amino acid sequences of AspiPKS4, AspiPKS5, AspiPKS6, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6, and CrPKS are shown in SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, and SEQ ID NO.23, respectively.

[0014] This invention mutates the second amino acid residue of the AspiPKS7 amino acid sequence according to the N-terminal rule, and compares the bioactivity of the mutants using tobacco transient expression technology, identifying mutant F2A, where the phenylalanine at position 2 is mutated to alanine. Compared to AspiPKS7, replacing the coding gene of the HispS luminescence system of the original FBP with the coding gene of mutant F2A significantly improves the bioluminescence intensity of tobacco leaves.

[0015] Therefore, the present invention provides a polyketide synthase mutant obtained by mutagenesis of AspiPKS7, as shown in SEQ ID NO.1, wherein the mutation is a mutation of phenylalanine at position 2 to alanine. Specifically, the amino acid sequence of the polyketide synthase mutant is shown in SEQ ID NO.3 or has more than 50% homology with and is functionally identical to the sequence shown in SEQ ID NO.3.

[0016] This invention analyzes the three-dimensional structure of AspiPKS7, which contains a non-conserved fragment of no more than 76 amino acids at its N-terminus. Further, all or part of the redundant N-terminal sequence is deleted to obtain a truncated mutant. The bioactivity of the truncated mutant is verified using tobacco transient expression technology. The results show that replacing HispS in the original FBP luminescence system with the truncated mutant also improves the luminescence intensity, indicating that removing the redundant N-terminal sequence does not affect the production of fungal luciferin precursors catalyzed by polyketide synthase.

[0017] Therefore, the present invention provides a polyketide synthase mutant, which is obtained by mutation of AspiPKS7 with an amino acid sequence as shown in SEQ ID NO.1 or has more than 50% homology with the mutated sequence and has the same function. The mutation is the deletion of any amino acid residue from position 2 to position 77.

[0018] Preferably, the mutation is a deletion of amino acid residues from position 2 to position 77. Specifically, the amino acid sequence of the polyketide synthase mutant is as shown in SEQ ID NO. 5 or a sequence having more than 50% homology with and functionally identical to the sequence shown in SEQ ID NO. 5.

[0019] This invention also provides the application of the aforementioned polyketide synthase or polyketide synthase mutant in the biosynthesis of milk alkaloids. The application includes: using caffeoyl-CoA and malonyl-CoA as substrates, or using caffeic acid and malonyl-CoA as substrates, to catalyze the biosynthesis of milk alkaloids via polyketide synthase.

[0020] In one specific embodiment of the present invention, polyketide synthase or polyketide synthase mutant recombinant protein is expressed using an Escherichia coli expression system. The recombinant protein is then added to a reaction system containing caffeoyl-CoA or caffeic acid and malonyl-CoA, and reacted at 25-30°C. Finally, milk alkaloid is separated from the reaction product.

[0021] The present invention can optimize the coding gene sequence of the polyketide synthase or polyketide synthase mutant according to the codon preference of Escherichia coli. Preferably, the nucleotide sequence of the coding gene of the polyketide synthase is shown in SEQ ID NO. 28.

[0022] Preferably, the concentration of recombinant protein in the reaction system is 1 µM, the concentration of caffeoyl-CoA is 2 µM, and the concentration of malonyl-CoA is 2 µM.

[0023] Preferably, the reaction system uses HEPES buffer solution with a pH of 8.0 ± 0.2 as the reaction medium.

[0024] Another objective of this invention is to provide the application of the aforementioned polyketide synthase or polyketide synthase mutant in enhancing the bioluminescence intensity of plants. The plant possesses an FBP luminescence system containing HispS, CPH, H3H, and Luz, four proteases that participate in the caffeic acid cycle within the plant, enabling bioluminescence. This invention replaces the HispS coding gene in the original FBP luminescence system with the coding gene of the aforementioned polyketide synthase or polyketide synthase mutant; that is, the modified luminescence system contains the aforementioned polyketide synthase or polyketide synthase mutant, CPH, H3H, and Luz. The resulting transgenic plants exhibit significantly enhanced bioluminescence intensity.

[0025] Furthermore, the application includes: encoding the polyketide synthase or the polyketide synthase mutant gene, CPH Gene, H3H Gene, Luz Genes are integrated into recipient vectors to construct multi-gene vectors; then, using transgenic technology, the target gene fragments in the multi-gene vectors are introduced into recipient plants to cultivate transgenic plants with enhanced bioluminescence intensity.

[0026] This invention can optimize the nucleotide sequence of the gene based on the codon preference of the recipient plant, thereby improving protein expression efficiency.

[0027] When the recipient plant is tobacco, preferably, the nucleotide sequence of the polyketide synthase encoding gene is as shown in SEQ ID NO.2, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.22 or SEQ ID NO.24, and the nucleotide sequence of the mutant encoding gene is as shown in SEQ ID NO.4 or SEQ ID NO.6.

[0028] Preferably, the coding gene for the polyketide synthase or the polyketide synthase mutant is supplemented with the 5′ end of the Tobacco Mosaic Virus (TMN) sequence to improve the protein translation initiation rate.

[0029] The CPHThe nucleotide sequence of the gene is shown in SEQ ID NO.25. H3H The nucleotide sequence of the gene is shown in SEQ ID NO. 26. Luz The nucleotide sequence of the gene is shown in SEQ ID NO.27.

[0030] Preferably, the method for constructing the multi-gene vector includes: first preparing a gene encoding the polyketide synthase or the polyketide synthase mutant linked to the P2A fragment and... CPH The PKS-CPH dual gene fragment, and the P2A fragment linked together Luz Genes and H3H The Luz-H3H dual gene fragments were cloned into plant expression vectors to obtain recombinant plasmids; then the expression cassette regions of the two recombinant plasmids were ligated and assembled into the plant expression vector to obtain a multi-gene vector.

[0031] The expression cassette includes a promoter, a dual-gene fragment, and a terminator. In this invention, suitable promoters and terminators are introduced upstream and downstream of the dual-gene fragment according to the characteristics of the recipient plant to achieve dual-gene overexpression. Preferably, the plant expression vector is the pCAMBIA1300 vector, which carries the CaMV 35S promoter and the NOS terminator.

[0032] P2A is a self-cleaving peptide that splits the fusion protein in plants through self-cleavage, allowing four proteases to function independently.

[0033] Preferably, Agrobacterium-mediated transformation is used to introduce multiple gene fragments into recipient plants. Specifically, the Agrobacterium is GV3101 or EHA105.

[0034] The recipient plant can be any plant, including but not limited to tobacco.

[0035] This invention provides a simplified modified FBP3 plasmid, the plasmid containing the coding gene for the polyketide synthase or a polyketide synthase mutant, CPH Gene, H3H Gene, Luz Gene. Compared to HispS, the molecular weight of the polyketide synthase or polyketide synthase mutant provided by this invention is significantly reduced, greatly improving the flexibility of transgenic operations, and the catalytic activity for producing milk alkaloids is significantly enhanced.

[0036] The method for constructing the simplified modified FBP3 plasmid includes: using biological methods to convert the coding gene of the polyketide synthase or the polyketide synthase mutant, CPH Gene, H3H Gene, Luz The gene was integrated into the receptor vector to construct a simplified modified FBP3 plasmid.

[0037] Preferably, the method for constructing the simplified modified FBP3 plasmid includes: first preparing a plasmid by linking the P2A fragment to the coding gene of the polyketide synthase or the polyketide synthase mutant and... CPH The PKS-CPH dual gene fragment, and the P2A fragment linked together Luz Genes and H3H The Luz-H3H double gene fragments of the gene were cloned into plant or animal expression vectors to obtain recombinant plasmids; then the expression cassette regions of the two recombinant plasmids were ligated and assembled into plant or animal expression vectors to obtain a simplified modified FBP3 plasmid.

[0038] This invention also provides the application of the simplified and improved FBP3 plasmid in the creation of bioluminescent plants. The application includes: integrating the target gene from the FBP3 plasmid into the genome of a recipient plant using Agrobacterium-mediated genetic transformation technology to cultivate bioluminescent transgenic plants.

[0039] The plant can be any plant, including both lower and higher plants. Specifically, the lower plant is moss; the higher plant includes snapdragon, sunflower, tulip, freesia, dahlia, phalaenopsis orchid, water lily, privet, podocarpus, pothos, desert rose, camellia, cherry blossom, coral tree, podocarpus, marigold, cotton, tobacco, rice, tomato, or petunia. This invention is not limited to these.

[0040] The present invention also provides the application of the simplified modified FBP3 plasmid in animal cell tracing. By introducing the simplified modified FBP3 plasmid into animal cells, using caffeic acid as a substrate, four proteases expressed in the animal cells participate in the caffeic acid cycle to generate photons, achieving self-luminescence, which can be used for the development of tracing tools.

[0041] Preferably, lipid nanoparticles are used as carriers to transfect the simplified modified FBP3 plasmid into animal cells for expression, and caffeic acid is used as a substrate to achieve self-luminescence.

[0042] The animal cells may be, but are not limited to, the mammalian HEK293T cell line.

[0043] The beneficial effects of this invention are as follows:

[0044] (1) This invention provides AspiPKS4, AspiPKS5, AspiPKS6, and AspiPKS7 from *Cyathea spinulosa*, replacing NnHispS in the original bioluminescent plant FBP luminescence system with FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6 from *Ficus microcarpa* and CrPKS from *Adiantum capillus-veneris*, which can significantly improve the luminescence level. Further, a single-point mutation at the second amino acid position of AspiPKS7 or deletion of the N-terminal redundant sequence yields a mutant with more advantages. The coding gene of the polyketide synthase or mutant is... CPH Gene, H3H Gene, Luz Genes can be integrated into plant genomes to create self-luminous plants to enhance the intensity of plant bioluminescence, or integrated into animal cells for the development of animal tracking technologies.

[0045] (2) The present invention provides a simplified and improved FBP system, which includes the polyketide synthase or polyketide synthase mutant, CPH, H3H, and Luz, thereby improving the ease of use and luminescence capability of the FBP system.

[0046] (3) The polyketide synthase provided by the present invention has better biological activity than HispS in catalyzing the biosynthesis of milk tree alkaloids. Attached Figure Description

[0047] Figure 1 Three-dimensional structural predictions of polyketide synthases AspiPKS4, AspiPKS5, AspiPKS6, AspiPKS7, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6, CrPKS, and AcPKS2 from different sources.

[0048] Figure 2 Multiple alignments of amino acid sequences of polyketide synthases from different sources were performed. The homology with the AspiPKS7 sequence is as follows: AspiPKS4 95.98%, AspiPKS5 95.98%, AspiPKS6 92.29%, FhPKS2 54.92%, FhPKS3 55.14%, FhPKS4 55.6%, FhPKS5 54.92%, FhPKS6 55.36%, and CrPKS 94.2%. All of these sequences contain the core chalcone synthase (CHS) catalytic triplet, which is marked in red in the figure.

[0049] Figure 3Comparative analysis of luminescence intensity after transient conversion of tobacco leaves to 1300-Z4 carrier and carriers containing NnHispS, PpASCL, VvPKS, AspiPKS4, AspiPKS5, AspiPKS6, AspiPKS7, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6, CrPKS or AcPKS2.

[0050] Figure 4 The image shows a comparison of the instantaneous luminescence intensity of AspiPKS7 and NnHispS expressed in tobacco leaves. The left image is a fluorescence photograph, and the right image is a photon count.

[0051] Figure 5 Comparison of leaf metabolites transiently expressed in tobacco leaves of AspiPKS7 and NnHispS.

[0052] Figure 6 This study compares the luminescence intensity of AspiPKS7 wild-type and mutant F2A, F2C, F2E, F2G, F2I, F2M, F2P, F2S, F2T, and F2V tobacco transient expression. The left figure is a schematic diagram of the transient transformation experiment location for wild-type and mutants, and the right figure is a luminescence effect detection diagram of the transient transformation experiment for wild-type and mutants, i.e., fluorescence images taken 3 days after the transformation of AspiPKS7 wild-type and its mutants F2A, F2C, F2E, F2G, F2I, F2M, F2P, F2S, F2T, and F2V.

[0053] Figure 7 Quantitative analysis of luminescence intensity and photons of wild-type and mutant AspiPKS7 F2A, F2C, F2E, F2G, F2I, F2M, F2P, F2S, F2T and F2V.

[0054] Figure 8 The image shows a comparison of the transient luminescence intensity of AspiPKS7 expressed in tobacco wild-type and mutant AspiPKS7-F2A and AspiPKS7-△76. The left image is a fluorescence photograph, and the right image is a photon count.

[0055] Figure 9 Analysis of substrates and products catalyzed by AspiPKS7.

[0056] Figure 10 A simplified schematic diagram of the improved FBP3 vector.

[0057] Figure 11 To successfully transiently transform 16 plant tissues using the simplified and modified FBP3 vector, including snapdragon, sunflower, tulip, freesia, dahlia, phalaenopsis orchid, water lily, privet, podocarpus, pothos, desert rose, camellia, cherry blossom, coral tree, podocarpus, and marigold.

[0058] Figure 12 To create luminescent plants of cotton, tobacco, rice, tomato, and petunia using a simplified and improved FBP3 vector.

[0059] Figure 13 To create a stable transgenic luminescent moss, *Scleroderma pulcherrima*, using a simplified modified FBP3 vector.

[0060] Figure 14 To create a self-luminescent mammalian HEK293T cell line using a simplified modified FBP3 system, where A is a schematic diagram of an animal vector and B is the self-luminescent HEK293T cell line. Detailed Implementation

[0061] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0063] In this invention, the nucleotide sequence is from the 5′ end to the 3′ end from left to right; the amino acid sequence is from the N end to the C end from left to right.

[0064] Example 1: Gene cloning and vector construction of polyketide synthases from different sources

[0065] 1. Amino acid sequence analysis of polyketide synthase

[0066] The information was obtained from the Bioproject project PRJCA006485 in the China National Center for Bioinformation (CNCB) database, originating from *Cyathea spinulosa* (tree fern). Alsophila spinulosa The polyketide synthases AspiPKS4, AspiPKS5, AspiPKS6, and AspiPKS7 were obtained from the study of *Ficus microcarpa* (a type of Ficus microcarpa) by Bioproject project PRJCA002187. Ficus hispida Polyketide synthases FhPKS2, FhPKS3, FhPKS4, FhPKS5, and FhPKS6 were obtained from the water fern (Adiantum capillus-veneris) through a search of the NCBI website. Ceratopteris richardii Polyketide synthase CrPKS, maidenhair fern ( Adiantum capillus-veneris Polyketide synthase AcPKS2 of ), polyketide synthase PpASCL of lichen sclerotium, and polyketide synthase VvPKS of grape.

[0067] Specifically, the gene numbers of AspiPKS4, AspiPKS5, AspiPKS6, and AspiPKS7 in the protein file (https: / / figshare.com / articles / dataset / A_spinulosa_genome_rar / 19075346?file=38155950) are Aspi01Gene15356, Aspi01Gene15357, Aspi01Gene19041, and Aspi01Gene18241, respectively.

[0068] The gene numbers of FhPKS2, FhPKS3, FhPKS4, FhPKS5, and FhPKS6 in the protein file with Accession number GWHALOG00000000 in the CNCB database (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 7807 / show) are GWHPALOG015543, GWHPALOG015544, GWHPALOG015545, GWHPALOG015551, and GWHPALOG015554, respectively.

[0069] The NCBI database accession number for CrPKS is KAH7280191.1. The NCBI database accession number for AcPKS2 is KAI5058170.1. The NCBI database accession number for PpASCL is XP_024358417.1. The NCBI database accession number for VvPKS is LOC100259793.

[0070] The predicted three-dimensional structure of the above-mentioned polyketide synthase AlphaFold 3 is shown in the figure below. Figure 1 As shown, the protein contains a non-conserved fragment of no more than 76 amino acids at its N-terminus.

[0071] See multiple alignment of amino acid sequences Figure 2 The sequences with homology to AspiPKS7 are as follows: AspiPKS4 95.98%, AspiPKS5 95.98%, AspiPKS6 92.29%, FhPKS2 54.92%, FhPKS3 55.14%, FhPKS4 55.6%, FhPKS5 54.92%, FhPKS6 55.36%, and CrPKS 94.2%. All of these sequences contain a core chalcone synthase (CHS) catalytic triplet.

[0072] 2. Gene cloning and vector construction

[0073] The gene fragments encoding polyketide synthases AspiPKS4, AspiPKS5, AspiPKS6, and AspiPKS7 were synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd., and cloned into the pCAMBIA1300-P35S vector between the restriction sites BamHI and SacI, resulting in recombinant vectors 1300-AspiPKS4, 1300-AspiPKS5, 1300-AspiPKS6, and 1300-AspiPKS7.

[0074] The amino acid sequence of AspiPKS7 is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2. The amino acid sequences of AspiPKS4, AspiPKS5, and AspiPKS6 are shown in SEQ ID NO.7, SEQ ID NO.9, and SEQ ID NO.11, respectively, and the nucleotide sequences of the encoding genes are shown in SEQ ID NO.8, SEQ ID NO.10, and SEQ ID NO.12, respectively.

[0075] The gene fragments encoding polyketide synthases FhPKS2, FhPKS3, FhPKS4, FhPKS5, and FhPKS6 were obtained by PCR amplification. Specifically, Ficus pumila leaves were cut and rapidly ground into a fine powder using liquid nitrogen. 100 mg of the powder was transferred to a 1.5 mL centrifuge tube. 1 mL of TRIZOL was added and mixed thoroughly, then allowed to stand at room temperature for 10 min. 200 µl of chloroform was then added and the mixture was vigorously shaken for 30 s and allowed to stand for 5 min. The mixture was then centrifuged at 12,000 rpm for 10 min at 4 °C. 500 µl of the supernatant was transferred to a pyrogen-free 1.5 mL centrifuge tube containing 500 µl of isopropanol. The mixture was inverted and mixed thoroughly, then allowed to stand at room temperature for 10 min. The mixture was then centrifuged at 12,000 rpm for 10 min at 4 °C. The supernatant was discarded, and 1 mL of 75% ethanol (prepared with 1% DEPC water) was added and vortexed to thoroughly wash the white, feathery RNA precipitate. The mixture was then centrifuged at 12,000 rpm for 10 min at 4 °C. The ethanol was discarded and the mixture was centrifuged again. The remaining ethanol was carefully aspirated with a 20 µl pipette. Once the RNA precipitate became translucent, 1% oDEPC water was added to dissolve it and obtain cDNA. Next, use Mona Biotech's MonScript. TM cDNA was prepared by reverse transcription using RTIII Super Mix with dsDNase (Two-Step) premix, and then amplified by PCR using the cDNA as a template to obtain the target gene fragment. The primers used for the PCR amplification reaction are as follows:

[0076] FhPKS2-F: acgggggactctagaggatccATGGTGACCGTCGAGGAAATC;

[0077] FhPKS2-R:cgatcggggaaattcgagctcTTAAATAGCAACGCTGTGAAGCA;

[0078] FhPKS3-F: acgggggactctagaggatccATGGTGACTGTCGAGGAAATCC;

[0079] FhPKS3-R: cgatcggggaaattcgagctcCTAAATAGCAACACTGTGGAGCACC;

[0080] FhPKS4-F: acgggggactctagaggatccATGGTGAACGTCGAGGAAATTC;

[0081] FhPKS4-R: cgatcggggaaattcgagctcCTAAATAGCAACACTGTGGAGCACC;

[0082] FhPKS5-F: acgggggactctagaggatccATGGTGACTGTTGAGGAAATCCG;

[0083] FhPKS5-R: cgatcggggaaattcgagctcCTAAATAGCAACACTGTGGAGCACC;

[0084] FhPKS6-F: acgggggactctagaggatccATGGTGACTGTCGAGGAAGTCC;

[0085] FhPKS6-R: cgatcggggaaattcgagctcCTAAATAGCAACACTGTGGAGCACC.

[0086] The target gene fragments obtained by PCR amplification were assembled into the pCAMBIA1300-P35S vector between the BamHI and SacI restriction sites using Gibson Assembly to obtain recombinant vectors 1300-FhPKS2, 1300-FhPKS3, 1300-FhPKS4, 1300-FhPKS5, and 1300-FhPKS6.

[0087] The amino acid sequences of FhPKS2, FhPKS3, FhPKS4, FhPKS5, and FhPKS6 are shown in SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, and SEQ ID NO.21, respectively, and the nucleotide sequences of the encoding genes are shown in SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, and SEQ ID NO.22, respectively.

[0088] The nucleotide sequences encoding the CrPKS and AcPKS2 genes were obtained after codon optimization based on tobacco codon preference. The gene fragments were synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd., and cloned into the pCAMBIA1300-P35S vector to obtain the recombinant vectors 1300-CrPKS and 1300-AcPKS2. The amino acid sequence of CrPKS is shown in SEQ ID NO.22, and the nucleotide sequences are shown in SEQ ID NO.24.

[0089] According to literature reports, the gene encoding the grape-derived type III polyketide synthase VvPKS (accession number LOC100259793 in NCBI database) and the type III polyketide synthase PpASCL (Palkina) are also mentioned. et al The gene encoding PpASCL (2024) is accessed in the NCBI database under accession number XP_024358417.1. The gene fragment was synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd. and cloned into the pCAMBIA1300-P35S vector to obtain the recombinant vectors 1300-VvCHS2 and 1300-PpASCL.

[0090] 3. Construction of the 1300-Z4 vector

[0091] The P2A fragment was used to fuse NnCPH and AnNPGA, as well as NnH3H and NnLuz. The expression cassettes of the two fusion proteins were then assembled into the pCAMBIA1300 vector to construct the 1300-Z4 vector. Specifically, the P2A fragment was used as a homologous arm sequence between the two genes for overlap PCR amplification to obtain the NnCPH-P2A-AnNPGA fragment. This fragment was then assembled into the BamHI restriction site of the empty pCAMBIA1300-P35S vector to obtain 1300-NnCPH / AnNPGA. The NnH3H-P2A-NnLuz fragment was obtained using the same method and assembled into the SacI restriction site of the empty pCAMBIA1300-P35S vector to obtain 1300-NnH3H / NnLuz. Subsequently, using these two recombinant plasmids as modules, seamless cloning primers were designed to amplify the two expression cassettes. Homologous recombination was then used to assemble them into the pCAMBIA1300 empty vector, which had been pre-digested with restriction enzymes HindIII and EcoRI to remove the promoter and terminator regions, resulting in 1300-Z4. The 1300-Z4 vector contains four genes: (AnNPGA, NnH3H, NnLuz, and NnCPH).

[0092] The sequence information for NnCPH can be found in NCBI Gene Accession Number QJQ48093.1; the sequence information for AnNPGA can be found in NCBI Gene Accession Number QJQ48097.1; the sequence information for NnH3H can be found in NCBI Gene Accession Number QJQ48094.1; the sequence information for NnLuz can be found in NCBI Gene Accession Number QJQ48096.1; the coding gene sequence for the P2A fragment is: GGTTCAGGTGCCACTAATTTTTCTCTCTTGAAACAGGCCGGTGACGTTGAAGAGAACCCAGGTCCC, and the amino acid sequence is: GSGATNFSLLKQAGDVEENPGP; the above gene fragments were synthesized by a biotechnology company.

[0093] 4. Construction of the 1300-NnHispS vector

[0094] The NnHispS accession number in the NCBI database is QJQ48095.1. The gene fragment was synthesized by a biotechnology company and assembled into the pCAMBIA1300-P35S vector using Gibson Assembly to obtain the 1300-NnHispS vector.

[0095] Example 2: Comparison of leaf luminescence intensity during transient tobacco transformation involving different polyketide synthases

[0096] The 1300-Z4 vector, 1300-NnHispS vector, and polyketide synthase recombinant vector constructed in Example 1 were transformed into Agrobacterium GV3101, respectively. Then, Agrobacterium containing 1300-NnHispS or Agrobacterium containing the polyketide synthase vector were mixed with Agrobacterium containing the 1300-Z4 vector at a 1:1 ratio and used to transiently co-express the vector in tobacco. The photon intensity was then measured. The specific method is as follows:

[0097] Transfer 1 µL of plasmid to GV3101 Agrobacterium competent cells and gently tap to mix. Incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37 ℃ water bath for 5 min, and in an ice bath for 5 min. Add 1 mL of antibiotic-free LB agar and incubate at 28 ℃ with shaking for 2 h. Centrifuge at 4000 rpm for 2 min to collect the bacterial cells. Retain 100 µL and resuspend the cells by pipetting. Spread the suspension onto an LB agar plate containing antibiotics (50 mg / L Kan + 50 mg / L Rif). Invert the plate and incubate at 28 ℃ for 2 days. Perform PCR identification of the bacterial culture and retain positive strains.

[0098] A small amount of Agrobacterium strain was streaked onto an LB agar plate containing antibiotics (50 mg / L Kan + 50 mg / L Rif) for activation. Single colonies were picked and cultured in liquid culture at 28°C and 200 rpm until OD500 was reached. 600 =0.6-0.8, 4000 rpm, 10 min to collect bacterial cells, suspend Agrobacterium cells in infection solution (containing 10 mM MgCl2, 10 mM MES, 150 μM As), and let stand at room temperature for 2-3 h.

[0099] Transient transformation was performed using Nicotiana benthamiana as the recipient material. An equal volume of the required bacterial solution was drawn using a 1mL sterile syringe (without the needle). Three to five leaves of healthy, flat tobacco plants were selected. Small holes were made on the underside of the leaves using the syringe, and the infection solution containing the mixed bacteria was injected into the leaves through these holes. After 48 hours of culture under normal conditions, luminescence imaging was performed using a Tanon 5200. The imaging results were visually assessed, and further imaging and quantum number calculations were performed using the LB985 plant in vivo imaging system.

[0100] The results are as follows Figure 3As shown, compared with the sites expressing NnHispS, the expression of PpASCL and VvCHS2 had the weakest luminescence effects, while the expression of AspiPKS7 significantly increased the leaf luminescence intensity. AspiPKS4, AspiPKS5, AspiPKS6, FhPKS2, FhPKS3, FhPKS4, FhPKS5, FhPKS6, and CrPKS significantly promoted FBP luminescence intensity higher than NnHispS. This indicates that these polyketide synthases have important application value in the creation of luminescent plants and in tracer technology.

[0101] Example 3: Detection of metabolites from the transient conversion of tobacco to AspiPKS7 or NnHispS

[0102] The method described in Example 2 was used for transient co-expression of tobacco, and the biological activities of AspiPKS7 and NnHispS were compared. Figure 4 As shown, the luminescence intensity of AspiPKS7 is five times that of NnHispS.

[0103] Subsequently, the injected area of ​​the leaf was cut off and analyzed by LC-MS / MS (liquid chromatography-mass spectrometry) to determine the content of the metabolites caffeic acid and p-coumaric acid. The detection results are as follows: Figure 5 As shown in the figure, the results indicate that the caffeic acid content of AspiPKS7 is significantly higher than that of NnHispS, resulting in higher catalytic efficiency. The p-coumaric acid content of AspiPKS7 is significantly reduced, and combined with the increased caffeic acid accumulation, it is speculated that AspiPKS7 may utilize both caffeic acid and p-coumaric acid as catalytic substrates. The milk alkaloid accumulation of AspiPKS7 is more than twice that of NnHispS.

[0104] Example 4: Screening for favorable mutations by transiently expressing different AspiPKS7 mutants in tobacco.

[0105] In this embodiment, the second amino acid of the AspiPKS7 protein was selected as the mutation site according to the N-terminal rule. Site-directed mutagenesis PCR was used to mutate the second phenylalanine (F) in the AspiPKS7 amino acid sequence to alanine (A), cysteine ​​(C), glutamic acid (E), glycine (G), isoleucine (I), methionine (M), proline (P), serine (S), threonine (T), or valine (V). The specific method is as follows:

[0106] PCR primers were designed, with the specific F primer containing a BamHI restriction site and the universal R primer containing a SacI restriction site. PCR amplification was performed using the pCAMBIA1300-AspiPKS7 circular plasmid (1300-AspiPKS7) prepared in Example 1 as a template.

[0107] The PCR primers are as follows:

[0108] F2A-F: AGAACACGGGGGACTCCAAGGATCCATGgctCTGGAGATCGAAGT;

[0109] F2C-F: AGAACACGGGGGACTCCAAGGATCCATGtgtCTGGAGATCGAAGT;

[0110] F2E-F: AGAACACGGGGGACTCCAAGGATCCATGgaaCTGGAGATCGAAGT;

[0111] F2G-F: AGAACACGGGGGACTCCAAGGATCCATGggtCTGGAGATCGAAGT;

[0112] F2I-F: AGAACACGGGGGACTCCAAGGATCCATGattCTGGAGATCGAAGT;

[0113] F2M-F: AGAACACGGGGGACTCCAAGGATCCATGatgCTGGAGATCGAAGT;

[0114] F2P-F: AGAACACGGGGGACTCCAAGGATCCATGccaCTGGAGATCGAAGT;

[0115] F2S-F: AGAACACGGGGGACTCCAAGGATCCATGtctCTGGAGATCGAAGT;

[0116] F2T-F: AGAACACGGGGGACTCCAAGGATCCATGactCTGGAGATCGAAGT;

[0117] F2V-F: AGAACACGGGGGACTCCAAGGATCCATGgttCTGGAGATCGAAGT;

[0118] PKS7-R: tgaacgatcggggaaattcgagctcTCATTTGCACCGCTTGAGGA.

[0119] The PCR system is as follows: 0.5 μL of template; 1.5 μL each of 10 μM primer F and primer R; 25 μL of 2× KOD One MasterMix; make up the volume to 50 μL.

[0120] The PCR thermal cycling conditions were as follows: 94 °C pre-denaturation for 2 min; 98 °C denaturation for 10 s, 62 °C annealing for 305 s, 68 °C extension for 15 s, for 32 cycles; and incubation at 4 °C.

[0121] After the PCR product was recovered, the gene fragment was assembled into the pCAMBIA1300 vector.

[0122] The instantaneous transformation of tobacco leaves was performed according to the method in Example 2, and the photons were photographed and analyzed using the LB985 plant live imaging system.

[0123] The results are as follows Figure 6 and Figure 7 As shown, among all single-point mutations, only F2A can significantly increase luminescence intensity.

[0124] Example 5: Construction and comparison of luminescence intensity of AspiPKS7 truncated mutants

[0125] This embodiment uses AlphaFold3 to predict the three-dimensional structure of the AspiPKS7 monomeric protein and compares the structure of AspiPKS7 with that of a typical type III polyketide synthase, PDB:1EE0. Figure 1 As shown, compared to 1EE0, AspiPKS7 has an N-terminal redundant sequence. Therefore, in this embodiment, a truncated mutant AspiPKS7-△76 with amino acid residues deleted from positions 2-77 was constructed, and the amino acid sequences are shown in SEQ ID NO.5. The specific method is as follows:

[0126] A PCR primer 77-F was designed from amino acid position 77. Then, a specific primer with a homologous arm to 77-F was designed based on the truncated length. Using the pCAMBIA1300-AspiPKS7 circular plasmid (1300-AspiPKS7) prepared in Example 1 as a template, PCR amplification was performed to remove the nucleic acid sequence between the primers.

[0127] The PCR primers are as follows:

[0128] 77-F: CCTGCGTCCTGGCTATGGGCAGGGCTACCC;

[0129] △76-R: TAGCCAGGACGCAGGCCATGGATCCTTGGAGTCCCCGTG.

[0130] After digestion with DpnI, 10 μL of the amplified product was transformed into DH5α competent cells. Positive clones were selected for sequencing of the AspiPKS7 gene. After sequencing, the gene fragment was amplified again. The nucleotide sequence of the mutant AspiPKS7-△76 is shown in SEQ ID NO. 6.

[0131] Biological activity was detected by transient transformation of tobacco leaves according to the method in Example 2. Photographs were taken and the photon counts were analyzed using a Tanon 5200 and LB985 plant in vivo imaging system.

[0132] The results are as follows Figure 8 As shown, both the AspiPKS7-△76 truncated mutant and AspiPKS7-F2A increase luminescence intensity, and their luminescence intensities are comparable, indicating that the deletion of 76 amino acids at the N-terminus of AspiPKS7 or the replacement of the second amino acid F with A at the N-terminus significantly enhances the ability of FBP metabolism to generate photons. Based on the data, it is concluded that removing the N-terminal redundant sequence does not affect the production of fungal luciferin precursors catalyzed by polyketide synthase. This invention can also replace this fragment with other N-terminal sequences without losing the function of polyketide synthase.

[0133] Example 6: Obtaining recombinant polyketide synthase

[0134] The coding sequence of AspiPKS7 was optimized based on the codon preference of *E. coli*. The optimized nucleotide sequence is shown in SEQ ID NO.28. This sequence was synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd. and cloned into the pGEX-4T-1 vector to construct a recombinant plasmid. This plasmid was then transformed into BL21(DE3) competent cells. Positive clones were selected and cultured to OD200. 600 =0.6, add 0.5 mM IPTG, and induce overnight at 16 ℃ and 150 rpm. Collect by centrifugation at 4 ℃ and 4000 rpm for 10 min. Resuspend the obtained precipitate in buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4), add 1 mM PMSF and sonicate on ice for lysis. Centrifuge the lysate at 4 ℃ and 4000 rpm for 20 min, and obtain the supernatant as crude enzyme solution. Purify the protein using a chromatography column, and after complete washing, elute with buffer containing 20 mM reduced glutathione. Collect the protein and separate the sample by denaturing polyacrylamide gel electrophoresis.

[0135] The purified AspiPKS7 protein sample was concentrated by ultrafiltration and then subjected to enzymatic activation reaction. The 50 µL reaction system contained 1 µM protein; 2 mM malonyl-CoA substrate; 2 mM caffeic acid or caffeoyl-CoA / p-coumaroyl-CoA substrate; and 100 mM HEPES buffer (pH=8.0). The reaction was carried out at 30℃ and 1000 rpm with shaking for 4 h, followed by quenching the reaction with 50 µL of methanol. After centrifugation at 1000 rpm for 2 min, the supernatant was collected for HPLC analysis. The results are as follows: Figure 9As shown, AspiPKS7 can accept caffeoyl-CoA / coumaroyl-CoA (excluding caffeic acid) as reaction substrates to produce hispidin and bisnoryangonin, respectively.

[0136] Example 7: Simplified modified FBP3 vector assembly and Agrobacterium-mediated transient plant transformation method

[0137] 1. This embodiment provides a simplified modified FBP3 vector. The specific method is as follows: The P2A fragment is used as the homologous arm sequence between two genes for overlap PCR amplification to obtain the AspiPKS7-△76-P2A-NnCPH fragment. The fragment is then assembled into the BamHI restriction site of the pCAMBIA1300-P35S empty vector to obtain 1300-AspiPKS7-NnCPH. The NnLuz-P2A-NnH3H fragment is amplified using the same method. The fragment is then assembled into the SacI restriction site of the pCAMBIA1300-P35S empty vector to obtain 1300-NnLuz-NnH3H. Subsequently, seamless cloning primers were designed, and the two recombinant plasmids were used as modules to amplify the two expression cassettes. Homologous recombination technology was then used to assemble them into the pCAMBIA1300 empty vector, which had been pre-digested with restriction enzymes HindIII and EcoRI to remove the promoter and terminator regions, resulting in a simplified modified FBP3 vector. A schematic diagram of the vector is shown below. Figure 10 .

[0138] In this embodiment, an Ω sequence derived from tobacco mosaic virus (nucleotide sequence: GTATTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATTACA) was added before AspiPKS7-△76 to improve the protein translation initiation rate.

[0139] 2. Agrobacterium-mediated transient transformation in plants

[0140] Transfer 1 µL of plasmid to GV3101 Agrobacterium competent cells and gently tap to mix. Incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37 ℃ water bath for 5 min, and in an ice bath for 5 min. Add 1 mL of antibiotic-free LB agar and incubate at 28 ℃ with shaking for 2 h. Centrifuge at 4000 rpm for 2 min to collect the bacterial cells. Retain 100 µL and resuspend the cells by pipetting. Spread the suspension onto an LB agar plate containing antibiotics (50 mg / L Kan + 50 mg / L Rif). Invert the plate and incubate at 28 ℃ for 2 days. Perform PCR identification of the bacterial culture and retain positive strains.

[0141] The positive strains transformed into this system were streaked onto LB agar plates containing antibiotics (50 mg / L Kan + 50 mg / L Rif) for activation, and single clones were picked and cultured in liquid culture until OD. 600 =0.6, centrifuge the bacterial culture, and resuspend the cells in liquid infiltration medium (1 / 4 MS salt, 1% sucrose, 100 μM acetylsalicylic acid, 0.005% Silwet L-77, pH 5.8) until OD. 600 =0.6 is used for infection.

[0142] This embodiment selects snapdragon leaves, sunflower petals, tulip petals, freesia petals, dahlia petals, phalaenopsis orchid petals, water lily leaves, privet leaves, podocarpus leaves, pothos leaves, desert rose leaves, camellia leaves, cherry blossom leaves, coral tree leaves, podocarpus leaves, and marigold leaves for instantaneous transformation. Details are as follows:

[0143] A shallow wound was created on the surface of the plant tissue using a 1 mL plastic syringe, and Agrobacterium tumefaciens solution was injected. The leaves were dried under light for 1 hour, and then cultured in the dark at room temperature for 12 hours. The transformed plants were then transferred to a greenhouse for further culture for 2-3 days, after which samples were taken and photographed using a NIGHTSHADE LB985 plant fluorescence analyzer for recording.

[0144] See results Figure 11 The leaves of snapdragons, sunflowers, tulips, freesias, dahlias, orchids, water lilies, privet leaves, podocarpus leaves, pothos leaves, desert rose leaves, camellia leaves, cherry blossom leaves, coral tree leaves, podocarpus leaves, marigold leaves, and marigold leaves all showed obvious bioluminescence from the tissues of the instantaneously converted simplified and improved FBP3 carrier. Since all microtubule plants can synthesize the precursors of the FBP3 luminescent system, it indicates that the simplified and improved FBP3 can be applied to all microtubule plants.

[0145] Example 8: Creation and Photographic Analysis of Transgenic Luminescent Plants

[0146] 1. Creation of genetically modified luminescent tobacco

[0147] Select fully expanded healthy ZY100 tobacco leaves (4-5 weeks old), cut them into 0.5 cm square pieces with a scalpel (cut off the leaf edge, avoiding the midrib), and place the leaves face down on MS1 ​​solid medium (MS + 0.5 mg / L IAA + 2.0 mg / L BA + 3% sucrose + 0.6-0.8% Phytagel, pH=5.8) and incubate in the dark at 25°C for 2-3 days. Pre-cultured tobacco leaves were added to the Agrobacterium infection solution prepared in Example 7. The leaves were vortexed to ensure the cut surfaces were submerged in the solution. After standing for 5-30 minutes, the adhering solution was blotted off with sterile filter paper. The infected leaves were then placed top-side down on MS1 ​​solid medium and incubated in the dark at 28°C for 2 days. Next, the leaves were placed top-side up on MS1 ​​selection medium containing Timentin and hygromycin and incubated in the light at 25°C. When buds emerged from the leaf margins and could be separated (over 1 cm), the buds were cut off and transferred to MS2 solid medium (MS + 0.5 mg / L IAA + 3% sucrose + 0.6-0.8% Phytagel, pH=5.8) containing antibiotics (TM+HygB). Roots developed after two weeks. The rooted tobacco plants were then transplanted into soil, and photographs were taken using a Nikon D750 camera. The results are as follows: Figure 12 As shown, self-luminous tobacco has a strong luminous brightness and has significant industrialization value.

[0148] 2. Creation of genetically modified glowing tomatoes

[0149] Agrobacterium tumefaciens GV3101 containing the FBP3 vector was used. Positive single colonies were picked and cultured in YEP liquid medium containing the appropriate antibiotics (e.g., 50 mg / L kanamycin and 50 mg / L rifampin) at 28°C with shaking until OD... 600 ≈0.6. After centrifugation to collect bacterial cells, resuspend them in an equal volume of MS liquid medium (containing 100 μM acetylsylgenone) to OD0.6. 600 =0.5 as the inoculum.

[0150] Cotyledons of sterile seedlings of the Micro-Tom tomato variety were cut into 5-8 mm explants using a scalpel and immersed in Agrobacterium suspension for 15-20 minutes, gently agitated during the process. The infected explants were then placed on co-culture medium (MS + 2 mg / L 6-BA + 0.1 mg / L IAA + 100 μM acetylsylcholine) and cultured in the dark at 25°C for 2-3 days. Subsequently, they were transferred to selection medium (supplemented with 500 mg / L carbenicillin for inhibition and 5 mg / L hygromycin for selection), and subcultured every 2 weeks. After approximately 4-6 weeks, resistant callus was transferred to differentiation medium (MS + 1 mg / L ZT + 0.1 mg / L IAA). When the regenerated shoots reached 2-3 cm in length, they were cut and inoculated into rooting medium (1 / 2 MS + 0.1 mg / L IBA). Transgenic plants were obtained after verification by photographing with a NIGHTSHADE LB985 plant fluorescence analyzer. After the glossy tomatoes had rooted, they were transplanted into soil and then photographed using a Nikon D750 camera. (See attached image.) Figure 12 As shown.

[0151] 3. Creation of luminescent rice

[0152] Agrobacterium tumefaciens EHA105 containing the FBP3 vector was used. Positive single colonies were picked and cultured in YEP liquid medium containing the appropriate antibiotics (e.g., 50 mg / L kanamycin and 50 mg / L rifampin) at 28°C with shaking until OD... 600 ≈0.6. After centrifugation to collect bacterial cells, resuspend them in an equal volume of MS liquid medium (containing 100 μM acetylsylgenone) to OD0.6. 600 =0.5 as the inoculum.

[0153] Transformation was performed using the japonica rice variety ZH11 as the recipient material. The transformation method involved genetic transformation of rice callus mediated by Agrobacterium EHA105 containing the FBP3 vector. After obtaining T0 generation transgenic plants, T1 generation plants were harvested. The plants were then photographed and documented using a Nikon D750 camera. (See attached image.) Figure 12 As shown.

[0154] 4. Creation of luminous cotton

[0155] Agrobacterium tumefaciens EHA105 containing the FBP3 vector was used. Positive single colonies were picked and cultured in YEP liquid medium containing the appropriate antibiotics (e.g., 50 mg / L kanamycin and 50 mg / L rifampin) at 28°C with shaking until OD... 600 ≈0.6. After centrifugation to collect bacterial cells, resuspend them in an equal volume of MS liquid medium (containing 100 μM acetylsylgenone) to OD0.6. 600 =0.5 as the inoculum.

[0156] First, surface-sterilize upland cotton JIN668 seeds with 70% ethanol for 1 minute, then soak them in 10% sodium hypochlorite solution for 30 minutes. Rinse them 5 times with sterile water before inoculating them onto MS basal medium for germination for 3-5 days. Cut the hypocotyls of etiolated seedlings into 0.5-1 cm segments and pre-culture them on MSB medium (MS + 0.1 mg / L 2,4-D + 0.5 mg / L KT) for 24 hours. After soaking the explants in the infection solution for 10-15 minutes, transfer them to co-culture medium (MSB + 100 μM acetylsylcholine) and incubate in the dark at 25°C for 48 hours. Then transfer them to selection medium (MSB + 500 mg / L carbenicillin + 10-50 mg / L kanamycin), changing the medium every 2 weeks. After 4-6 weeks, the formed resistant callus was transferred to differentiation medium (MS + 0.5 mg / L KT + 0.1 mg / L IAA). Once buds formed, 1-2 cm young shoots were excised and transferred to rooting medium (1 / 2 MS + 0.1 mg / L IBA). The entire culture process was maintained at 28℃ with a 16 / 8 h photoperiod. The rooted luminescent cotton was then transplanted into soil, and photographs were taken using a Nikon D750 camera for documentation. Figure 12 As shown.

[0157] 5. Creation of the Glowing Morning Glory

[0158] Agrobacterium tumefaciens GV3101 containing the FBP3 vector was used. Positive single colonies were picked and cultured in YEP liquid medium containing the appropriate antibiotics (e.g., 50 mg / L kanamycin and 50 mg / L rifampin) at 28°C with shaking until OD... 600 ≈0.6. After centrifugation to collect bacterial cells, resuspend them in an equal volume of MS liquid medium (containing 100 μM acetylsylgenone) to OD0.6. 600 =0.5 as the inoculum.

[0159] Young leaves or stem segments of petunia were selected as explants and co-cultured with Agrobacterium carrying a simplified modified FBP3 vector. Agrobacterium invaded plant cells through wounds and integrated the T-DNA segment from its Ti plasmid containing FBP3 into the petunia genome. The co-cultured explants were then transferred to an antibiotic-containing dedifferentiation medium (e.g., MS + 6-BA + NAA) to inhibit Agrobacterium growth and induce callus formation. Subsequently, the callus was transferred to a differentiation medium, and transgenic resistant seedlings were selected. Rooted, luminescent petunias were transplanted into soil, and photographs were taken using a Nikon D750 camera for documentation. Figure 12 As shown.

[0160] Example 9: Creation of Agrobacterium-mediated simplified modified FBP3 system transgenic Physcomitrellapatens

[0161] Add 5 mL of Agrobacterium tumefaciens (containing the FBP3 vector system) EHA105 culture medium directly to each *Phyllostachys nigra* culture dish. After 30 minutes of treatment, remove the bacterial solution using a sterile pipette and seal the culture dish with sealing film. Then, transfer the gametophytes to 50 mL centrifuge tubes, add 20 mL of infection solution, let stand for 30 minutes, and then pour the mixture back into the culture dish. Incubate the sealed culture dishes in the dark for 3 days, then transfer them to standard *Phyllostachys nigra* culture conditions for continued growth. After one month of selection culture, transfer the transgenic positive *Phyllostachys nigra* to conventional culture medium. The successful transformation of *Phyllostachys nigra* with the simplified modified FBP3 vector was analyzed using a NIGHTSHADE LB985 plant fluorescence analyzer. (See [link to NIGHTSHADE LB985]). Figure 13 .

[0162] Example 10: Simplified modified pcDNA3.1-FBP3 system in transfection of mammalian HEK293 cell line

[0163] In constructing the pcDNA3.1-FBP3 vector for HEK293T cell transfection, the P2A fragment was first amplified using overlap PCR as the homologous arm sequence between the two genes to obtain the AspiPKS7-△76-P2A-NnCPH fragment. This fragment was then assembled into the BamHI restriction site of the empty pcDNA3.1 vector (containing the CMV promoter and BGH polyA terminator) to obtain pcDNA3.1-AspiPKS7-NnCPH. The NnLuz-P2A-NnH3H fragment was amplified using the same method and assembled into the restriction site of the empty pcDNA3.1 vector to obtain pcDNA3.1-NnLuz-NnH3H. Subsequently, seamless cloning primers were designed, and using these two recombinant plasmids as modules, the two expression cassettes were amplified. Homologous recombination technology was then used to assemble them into the empty pcDNA3.1 vector to obtain the simplified modified pcDNA3.1-FBP3 vector. A schematic diagram of the vector is shown below. Figure 14 A. Transformed into DH5α competent cells, and after selection with ampicillin, positive clones were picked for colony PCR and sequencing verification. Finally, high-purity plasmids were extracted for subsequent HEK293T cell transfection experiments.

[0164] Mammalian HEK293 cells in good growth condition were seeded into 24-well plates and cultured in DMEM medium (antibiotic-free) containing 10% fetal bovine serum (FBS) at 37°C for 24 hours. One hour before transfection, the medium was replaced with fresh medium to remove metabolic waste. In sterile centrifuge tubes, 250 μL of serum-free Opti-MEM medium diluted with 2 μg of FBP3 plasmid was added to tube A. In tube B, 250 μL of Opti-MEM medium diluted with 5 μL of Lipofectamine 3000 was added, gently mixed, and allowed to stand for 5 minutes. The solution from tube A was then added dropwise to tube B, gently pipetting to mix, and incubated at room temperature for 15-20 minutes to form the DNA-liposome complex. 500 μL of the complex was evenly added to the cell culture wells, and the plate was gently shaken to distribute it evenly. Six hours after transfection, the medium was replaced with complete medium to reduce liposome toxicity, and 100 μM caffeic acid was added. The cells were cultured for another 24-48 hours, and fluorescence was detected using live-cell imaging techniques. Figure 14 As shown in B, the FBP3 vector system can be expressed in mammals to enable animal cells to emit light.

[0165] The above description is merely a specific embodiment of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. All equivalent modifications or substitutions made based on the essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A polyketide synthase mutant, characterized in that, The polyketide synthase mutant is obtained by mutating AspiPKS7, whose amino acid sequence is shown in SEQ ID NO.1, wherein the mutation is that the phenylalanine at position 2 is mutated to alanine.

2. The application of the polyketide synthase mutant as described in claim 1 in the biosynthesis of milkweed alkaloids or in enhancing the intensity of plant bioluminescence, characterized in that, The plants include lower plants and higher plants. The lower plants are mosses. The higher plants are snapdragons, sunflowers, tulips, freesias, dahlias, phalaenopsis orchids, water lilies, privet, podocarpus, pothos, desert roses, camellias, cherry blossoms, coral trees, podocarpus, marigolds, cotton, tobacco, rice, tomatoes, or petunias.

3. The application as described in claim 2, characterized in that, The application of the biosynthesized milk alkaloids includes: preparing milk alkaloids by means of a polyketide synthase mutant catalytic reaction using caffeoyl-CoA and malonyl-CoA as substrates, or using caffeic acid and malonyl-CoA as substrates.

4. The application as described in claim 2, characterized in that, The application of enhancing the bioluminescence intensity of plants includes: integrating the encoding genes of the polyketide synthase mutant, caffeoylpyruvate hydrolase, milk tree alkaloid-3-hydroxylase, and luciferase into a recipient vector to construct a multi-gene vector; and then using transgenic technology to introduce the target gene fragment from the multi-gene vector into the recipient plant to cultivate transgenic plants with enhanced bioluminescence intensity.

5. The application as described in claim 4, characterized in that, The method for constructing the multi-gene vector includes: firstly, preparing a PKS-CPH double gene fragment consisting of a P2A fragment linking the gene encoding the polyketide synthase mutant and the gene encoding caffeoylpyruvate hydrolase, and a Luz-H3H double gene fragment consisting of a P2A fragment linking the gene encoding luciferase and the gene encoding milk alkaloid-3-hydroxylase, and cloning them into a plant expression vector to obtain recombinant plasmids; then, assembling the expression cassette regions of the two recombinant plasmids into the plant expression vector to obtain the multi-gene vector.

6. The application as described in claim 4 or 5, characterized in that, The coding gene of the polyketide synthase mutant has an Ω sequence of tobacco mosaic virus added to its 5′ end.

7. The application as described in claim 4, characterized in that, The nucleotide sequence of the polyketide synthase mutant encoding gene is shown in SEQ ID NO.4, the nucleotide sequence of the caffeoylpyruvate hydrolase encoding gene is shown in SEQ ID NO.25, the nucleotide sequence of the milk tree alkaloid-3-hydroxylase encoding gene is shown in SEQ ID NO.26, and the nucleotide sequence of the luciferase encoding gene is shown in SEQ ID NO.

27.

8. A simplified and improved FBP3 plasmid, characterized in that, The plasmid contains the encoding gene for the polyketide synthase mutant as described in claim 1, the encoding gene for caffeoylpyruvate hydrolase, the encoding gene for milk tree alkaloid-3-hydroxylase, and the encoding gene for luciferase.

9. The application of the simplified and improved FBP3 plasmid as described in claim 8 in the creation of bioluminescent plant or animal cell tracers.

10. The application as described in claim 9, characterized in that, The plants include lower plants and higher plants. The lower plants are mosses. The higher plants are snapdragons, sunflowers, tulips, freesias, dahlias, phalaenopsis orchids, water lilies, privet, podocarpus, pothos, desert roses, camellias, cherry blossoms, coral trees, podocarpus, marigolds, cotton, tobacco, rice, tomatoes, or petunias.

11. The application as described in claim 9, characterized in that, The application of the animal cell tracing includes: using lipid nanoparticles as a carrier to transfect the simplified modified FBP3 plasmid into animal cells for expression, and using caffeic acid as a substrate to achieve self-luminescence.

Images