Enzyme mutant CYP109A2-HE81G as well as gene, expression vector, engineering bacterium and application thereof
By constructing and expressing the cytochrome P450 enzyme mutant CYP109A2-HE81G derived from Bacillus megaterium, and optimizing fermentation conditions and co-solvents, the shortcomings of chemical synthesis methods were overcome, achieving efficient production of calcitriol and reducing costs.
Patent Information
- Application Number
- CN202511258815.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-04
- Publication Date
- 2025-12-05
AI Technical Summary
Existing chemical synthesis methods for producing calcitriol suffer from problems such as low product yield, poor regional selectivity, high cost, significant safety hazards, and severe environmental pollution. Furthermore, the catalytic activity and substrate specificity of natural cytochrome P450 enzymes for VD3 need to be improved.
A cytochrome P450 enzyme mutant CYP109A2-HE81G derived from Bacillus megaterium and its expression vector were constructed and heterologously expressed in Bacillus subtilis WB600. The fermentation medium and solubilizing conditions were optimized, and VD3 was used as a substrate for biotransformation.
It significantly improved the conversion efficiency of calcitriol, with a product concentration of up to 5.48 mg/L, reduced production costs, and provided a new approach for the industrial production of calcitriol.
Smart Images

Figure CN121065115A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, and particularly relates to an enzyme mutant CYP109A2-H E81G and a gene, an expression vector, an engineering bacterium and an application thereof. BACKGROUND
[0002] Calcitriol (1α, 25 (OH)2VD3) as the main active metabolite of vitamin D3 (VD3) is a key substance for regulating human calcium and phosphorus metabolism and maintaining bone health, and has an irreplaceable role in preventing and treating diseases such as osteoporosis and chondropathy, and also has important application value in the field of steroid hormone drug preparation. With the aggravation of population aging and the increasing attention to bone health, the market demand for calcitriol continues to grow.
[0003] At present, the industrial production of calcitriol mainly relies on chemical synthesis method, but this method has significant technical bottlenecks: on the one hand, the VD3 molecule structure contains unstable conjugated double bonds, which is easy to degrade in the chemical synthesis process, resulting in low product yield; on the other hand, the synthesis of calcitriol needs to be regionally selective hydroxylated at C-1 and C-25, and the chemical method has poor region selectivity, which easily produces a large amount of by-products, and the subsequent separation and purification steps are complicated, which greatly increases the production cost. In addition, chemical synthesis needs to use a variety of toxic, flammable and explosive chemical reagents, which not only has safety hazards, but also causes serious pollution to the environment, which does not meet the development trend of green chemical industry.
[0004] Microbial transformation method has become an important direction to replace chemical synthesis method to produce calcitriol due to its advantages of high region selectivity, mild reaction conditions, less by-products and environmental friendliness. Among them, cytochrome P450 enzyme shows outstanding potential in the conversion of VD3 to calcitriol because it can specifically catalyze the hydroxylation reaction of steroid compounds.
[0005] At present, there are related researches on the mutation modification of natural cytochrome P450 enzyme, but the number is small, and the catalytic activity and substrate specificity of the existing natural cytochrome P450 enzyme on VD3 still need to be improved. Therefore, it is of great significance to obtain a mutant with high activity through directed modification, construct its expression vector and engineering bacteria, and expand its application in the synthesis of calcitriol for improving the efficiency of biological transformation and promoting the industrial production of calcitriol. SUMMARY
[0006] The technical problem to be solved by the present application is to provide a cytochrome P450 enzyme mutant CYP109A2-H E81GThe enzyme mutant, along with its gene, expression vector, engineered bacteria, and applications, can efficiently catalyze the production of calcitriol from VD3, significantly improving biotransformation efficiency, reducing production costs, and providing a new pathway for the industrial production of calcitriol.
[0007] The present invention solves the above-mentioned technical problems by adopting the following technical solutions: A cytochrome P450 enzyme mutant CYP109A2-H derived from Bacillus megaterium E81G Its amino acid sequence is shown in SEQ ID NO: 1.
[0008] A mutant of the above-mentioned enzyme, CYP109A2-H E81G The encoding gene, whose nucleotide sequence is shown in SEQ ID NO: 2.
[0009] An expression vector containing the above-mentioned coding gene.
[0010] As one of the preferred embodiments of the present invention, the original vector is the Escherichia coli-Bacillus subtilis shuttle constitutive expression vector pMA5.
[0011] A recombinant engineered bacteria B. subtilis WB600-pMA5-CYP109A2-H E81G Bacillus subtilis ( B. B. subtilis WB600 was used as the host, and an expression vector containing the target coding gene was introduced; the target coding gene is the aforementioned coding gene.
[0012] As one of the preferred embodiments of the present invention, the recombinant engineered bacteria, after activation and fermentation, express the enzyme mutant CYP109A2-H. E81G The enzyme mutant CYP109A2-H E81G Using VD3 as a substrate, calcitriol is generated through biotransformation.
[0013] As one of the preferred embodiments of the present invention, the activation and fermentation culture method of the recombinant engineered bacteria is as follows: the recombinant engineered bacteria are transferred from a glycerol tube onto a solid LB substrate for activation and cultured at 30-40°C for 12-20 h; then, a single colony is picked and inoculated into TB medium for seed culture, and cultured at 30-40°C and 150-220 r / min for 12-20 h to obtain the seed culture solution; subsequently, it is transferred to a fermentation medium, and substrate VD3 is added simultaneously, and biotransformation is performed at 30-40°C and 150-220 r / min for 12-24 h.
[0014] A mutant of the above-mentioned enzyme, CYP109A2-H E81G Or the application of recombinant engineered bacteria in the synthesis of calcitriol.
[0015] As one of the preferred modes of the present application, the above-mentioned enzyme mutant CYP109A2-H E81G is used as a catalyst or a biological system for expressing the enzyme mutant CYP109A2-H E81G , and VD3 is used as a substrate for conversion; specifically including: contacting the catalyst or biological system containing the enzyme mutant CYP109A2-H E81G with the substrate VD3 in a fermentation medium, and obtaining a conversion liquid after biological conversion.
[0016] As one of the preferred modes of the present application, the components of the fermentation medium include: soluble starch 10-50 g / L, tryptone 10-50 g / L, potassium phosphate dibasic 1-5 g / L, pH 7.0; more preferably: soluble starch 30 g / L, tryptone 30 g / L, potassium phosphate dibasic 1 g / L, pH 7.0.
[0017] As one of the preferred modes of the present application, the components of the fermentation medium are sterilized at 121°C under high-pressure steam for 20 min.
[0018] As one of the preferred modes of the present application, the time node for adding the substrate VD3 is to add it into the fermentation medium at the same time as the enzyme-containing system; the concentration for adding is 0.1-1.25 g / L, more preferably 0.5 g / L; and the fermentation period after adding VD3 is 12-24 h, more preferably 24 h.
[0019] As one of the preferred modes of the present application, in the process of biological conversion, organic cosolvents DMF and / or DMSO and / or methanol and / or ethanol are also added at the same time as the substrate, more preferably DMF, and the concentration for adding is 1-6% (v / v), more preferably 3% (v / v).
[0020] As one of the preferred modes of the present application, the conditions for fermentation medium culture and biological conversion are as follows: under the condition of a 37°C, 220 r / min shaker.
[0021] A calcitriol prepared according to the method of any one of the above, and its structural formula is shown in the following formula (I):
[0022] The above-mentioned calcitriol is used for preparing a steroid hormone drug.
[0023] The present application has the following advantages compared with the prior art: The present application constructs a cytochrome P450 enzyme mutant CYP109A2-H E81G from Bacillus megaterium, and heterologously expresses it in Bacillus subtilis WB600 to obtain a recombinant bacteria Bacillus subtilisWB600-pMA5-CYP109A2-H E81G The recombinant bacteria is used to express the enzyme mutant in an optimized fermentation medium, and the conversion efficiency is significantly improved by optimizing the substrate concentration and cosolvent conditions, the production of calcitriol is increased (the product concentration is up to 5.48 mg / L), and the production cost is reduced, thereby providing a new way for industrial production of calcitriol. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 The nucleic acid electrophoresis result diagram of one-step reverse PCR in Example 3 (in the diagram, the lane "M" represents a DNA marker, and the lane "1" represents a PCR product); Figure 2 The recombinant strain in Example 4 B. subtilis WB600-pMA5-CYP109A2-H E81G The colony morphology diagram of Figure 3 The recombinant strain in Example 5 B. subtilis WB600-pMA5-CYP109A2-H and B. B. subtilis WB600-pMA5-CYP109A2-H E81G The transformation verification result of B. subtilis WB600-pMA5-CYP109A2-H E81G ” represents B. subtilis WB600-pMA5-CYP109A2-H E81G ”); Figure 4 The influence of adding different kinds of organic cosolvents on the conversion of VD3 to calcitriol by the recombinant strain B. subtilis WB600-pMA5-CYP109A2-H E81G in Example 6; Figure 5 The influence of different addition concentrations of the cosolvent DMF on the conversion of VD3 to calcitriol by the recombinant strain B. subtilis WB600-pMA5-CYP109A2-H E81G in Example 7; Figure 6 The influence of different substrate feeding concentrations on the conversion of VD3 to calcitriol by the recombinant strain B. subtilis WB600-pMA5-CYP109A2-H E81G in Example 8. DETAILED DESCRIPTION
[0025] The following detailed description of the embodiments of the present application is made on the premise of the technical solutions of the present application, and detailed implementation manners and specific operation processes are given, but the protection scope of the present application is not limited to the following embodiments. Meanwhile, unless otherwise specified, the reagents, methods and equipment used in the following embodiments and experimental examples are conventional reagents, methods and equipment in the technical field.
[0026] The medium formula used in the following embodiments is as follows: LB medium (solid): yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar 20 g / L.
[0027] TB medium (liquid): peptone 12 g / L, yeast powder 24 g / L, K2HPO4 12.54 g / L, KH2PO4 2.31 g / L, glycerol 4 mL.
[0028] Fermentation medium: soluble starch 30 g / L, tryptone 30 g / L, potassium phosphate dibasic 1 g / L, pH 7.0.
[0029] The HPLC analysis method of the product is as follows: Chromatographic conditions: linear gradient elution for 12 min on an Agilent TC-C18 chromatographic column (250 mm x 4.6 mm, 5 μm) with 50-100% acetonitrile-water as the mobile phase, followed by 100% acetonitrile elution for 13 min, and then column equilibration with 50% acetonitrile-water for 5 min. The single injection volume was 20 μL, the detection wavelength was 265 nm, the flow rate was 1.0 mL / min, and the column temperature was 40°C.
[0030] Example 1, obtaining of wild-type cytochrome P450 enzyme: In the early stage, the laboratory used transcriptome sequencing technology to screen cytochrome P450 enzyme (CYP) genes of Bacillus megaterium (B. megaterium) Bacillus megaterium H-1 (preserved in China General Microbiological Culture Collection Center, preservation number CGMCC No. 20362), and finally confirmed that a CYP was highly consistent with the known VD3 hydroxylase CYP109A2 gene sequence, which was named CYP109A2-H, and the gene sequence is shown as SEQ ID NO: 3. The complete CYP109A2-H amino acid sequence deduced from the target gene is SEQ ID NO: 4.
[0031] Example 2, recombinant strain B. subtilis Construction of WB600-pMA5-CYP109A2-H strain: The expression plasmid used in this embodiment is Bacillus subtilis expression plasmid pMA5, and the host bacteria is Bacillus subtilis (B. subtilis) B. subtilis) WB600.
[0032] The CYP109A2-H and the vector pMA5 were double digested by Ndel and BamHI and ligated by T4 ligase to construct a recombinant plasmid. The ligation product was transformed into the competent cells, which were cultured overnight on LB plates containing ampicillin (50 mg / L) to screen positive transformants. After enrichment culture, the plasmid was extracted and named pMA5-CYP109A2-H. E. coli JM109
[0033] The successfully constructed recombinant expression plasmid pMA5-CYP109A2-H was transformed into B. subtilis WB600 by chemical transformation method and coated on LB medium containing 50 mg / L of kanamycin for overnight culture. Positive transformants were picked to obtain the recombinant strain WB600-pMA5-CYP109A2-H. B. subtilis WB600-pMA5-CYP109A2-H.
[0034] Example 3, Enzyme Mutant CYP109A2-H E81G Design and expression vector construction: Based on the wild-type cytochrome P450 enzyme (CYP109A2-H), the enzyme mutant CYP109A2-H was designed. E81G The amino acid sequence of the enzyme mutant CYP109A2-H is shown in SEQ ID NO: 1, and the encoding gene nucleotide sequence is shown in SEQ ID NO: 2. E81G
[0035] The enzyme mutant CYP109A2-H E81G The construction method of the expression vector is as follows: The primers E81G-F and E81G-R (see Table 1) were designed, and the plasmid pMA5-CYP109A2-H (constructed in Example 2) was used as a template to replace the glutamic acid at position 81 of the VD3 dihydroxylase CYP109A2-H with glutamic acid by one-step reverse PCR technology. The PCR reaction conditions were: 95°C for 3 min, 34 cycles (95°C for 30 s, 58°C for 30 s, 72°C for 3 min), and 72°C for 5 min. The PCR amplification system: template 2 μL, upper and lower primers each 2 μL, Prime Star Max (Preamix) DNA 20 μL, and ddH2O 14 μL.
[0036] Table 1 Primers E81G-F and E81G-R Primer name Primer sequence (5'-3') Primer E81G-F GAACGTCAA GCC AGTATCTTAATGATGGATCCT]]> Primer E81G-R <![CDATA[AAGATACT GGC TTGACGTTCTTCCATTGCTC]]> Note: The underlined sequence represents the mutant amino acid site.
[0037] The PCR product band was checked by electrophoresis Figure 1 ), and used a gel extraction kit to identify the PCR product (pMA5-CYP109A2-H) with the correct band position. E81G The product (8300bp) was purified and recovered, and the concentration of the recovered product was determined.
[0038] Example 4, Recombinant Strains B. subtilis WB600-pMA5-CYP109A2-H E81G Construction: The PCR product of Example 3 (vector pMA5-CYP109A2-H) E81G ) Transform to E. coli JM109 competent cells were plated on ampicillin LB agar plates, and positive colonies were picked.
[0039] After overnight culture on a shaker at 37°C, plasmids were extracted and then transferred into Bacillus subtilis WB600 competent cells, and cultured overnight at 37°C to obtain recombinant strains. B. subtilis WB600-pMA5-CYP109A2-H E81G .
[0040] Recombinant strains B. subtilis WB600-pMA5-CYP109A2-H E81G Colony morphology such as Figure 2 As shown, the colonies are irregularly round, with a rough and uneven surface and irregular edges, consistent with the colony morphology of Bacillus subtilis.
[0041] Example 5: Fermentation verification of recombinant strains: The recombinant strain stored in the glycerol tube was removed from the -80°C freezer. B. subtilis WB600-pMA5-CYP109A2-H (wild-type strain) and B. subtilis WB600-pMA5-CYP109A2-H E81G (Mutant strain). 10 μL of the stored bacterial culture was aspirated onto LB agar plates using a clean bench. The inoculated plates were then incubated upside down at 37°C for 16 h until single colonies were observed. Next, single colonies were picked from the freshly streaked plates and transferred to 10 mL of TB liquid medium (10 mL per 50 mL Erlenmeyer flask) and incubated at 37°C and 220 rpm for 16 h on a shaker.
[0042] Subsequently, the inoculum was transferred to the fermentation medium at an inoculum volume of 2%, and kanamycin and substrate VD3 were added at a concentration of 0.1%. Simultaneously, 1% (v / v) ethanol was added to aid substrate dissolution.
[0043] The culture medium was placed on a shaker at 37℃ and 220r / min for 24h for fermentation, and the fermentation broth was taken for HPLC analysis.
[0044] The results are as follows Figure 3 As shown. By Figure 3 It can be seen that after 24 hours of fermentation, the concentration of calcitriol (1α,25(OH)2VD3) synthesized by CYP109A2-H was 0.71 mg / L; after mutation, CYP109A2-H E81G The concentration of synthesized calcitriol was 2.00 mg / L, which was 181.7% higher than that of the wild-type strain.
[0045] Example 6: Recombinant bacterial strains under different organic solvent-assisted solubilization conditions B. subtilis WB600-pMA5-CYP109A2-H E81G The result of converting VD3: A single colony from a fresh LB agar plate was inoculated into TB medium and cultured for 16 hours to obtain a seed culture. The seed culture was then inoculated at a rate of 2% (v / v) into a 250 mL Erlenmeyer flask containing 50 mL of fresh fermentation medium. Simultaneously, 0.25 g / L of substrate VD3 and 1% (v / v) of co-solvent were added. Methanol, ethanol, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), glycerol, and acetone were selected as co-solvents for substrate VD3. Fermentation was carried out at 37 °C and 220 rpm for 24 hours on a shaker, yielding the fermentation broth. The fermentation broth was analyzed by HPLC.
[0046] The results are as follows Figure 4 As shown. By Figure 4 It was found that the organic co-solvents selected were methanol, ethanol, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), glycerol, and acetone, with an addition amount of 1% of the fermentation volume. Among them, except for glycerol, the organic co-solvents generally promoted product synthesis. When the substrate concentration was 0.25 g / L, the exogenous addition of 1% (v / v) DMF had the greatest positive promoting effect on the fermentation conversion of VD3, with the product concentration of calcitriol (1α,25(OH)2VD3) reaching 3.50 mg / L, which can subsequently be used as a recombinant strain. B. subtilis WB600-pMA5-CYP109A2-H E81G The optimal co-solvent for the conversion of VD3 was found. Furthermore, methanol, ethanol, and DMSO also exhibited similar positive promoting effects to DMF and could be used as recombinant bacteria. B. B. subtilis WB600-pMA5-CYP109A2-H E81GGlycerol is a co-solvent for the conversion of VD3. Conversely, glycerol has a reverse inhibitory effect on the conversion, and no product was detected, which is detrimental to the conversion process. Therefore, it is not recommended as a recombinant strain. B. B. subtilis WB600-pMA5-CYP109A2-H E81G A co-solvent for the conversion of VD3.
[0047] Example 7: Recombinant strains under different concentrations of DMF B. subtilis WB600-pMA5-CYP109A2-H E81G The result of converting VD3: A single colony from a fresh LB agar plate was inoculated into TB medium and cultured for 16 hours to obtain a seed culture. The seed culture was then inoculated at a 2% (v / v) inoculation rate into a 250 mL Erlenmeyer flask containing 50 mL of fresh fermentation medium. Simultaneously, 0.25 g / L of VD3 substrate and different concentrations of the co-solvent DMF were added to achieve final DMF concentrations of 1%, 2%, 3%, 4%, 5%, and 6%. Fermentation was carried out at 37°C and 220 rpm for 24 hours on a shaker, yielding the fermentation broth. The fermentation broth was analyzed by HPLC.
[0048] The results are as follows Figure 5 As shown. By Figure 5 It can be seen that when the DMF addition is low, at 1% (v / v), it has little effect on bacterial growth and also has a certain solubilizing effect on the poorly soluble substrate VD3. As the DMF addition increases up to 4% (v / v), bacterial growth is inhibited to some extent, and the product concentration gradually decreases. When the DMF addition is 3% (v / v), the highest concentration of calcitriol is 3.49 mg / L.
[0049] Example 8: Recombinant strains under different substrate concentrations B. subtilis WB600-pMA5-CYP109A2-H E81G The result of converting VD3: A single colony from a fresh LB agar plate was inoculated into TB medium and cultured for 16 hours to obtain a seed culture. This seed culture was then inoculated at a rate of 2% (v / v) into a 250 mL Erlenmeyer flask containing 50 mL of fresh fermentation medium. Simultaneously, substrate VD3 and 3% (v / v) DMF were added to achieve final substrate concentrations of 0.1 g / L, 0.25 g / L, 0.5 g / L, 0.75 g / L, 1.0 g / L, and 1.25 g / L. Fermentation was carried out at 37℃ and 220 rpm for 24 hours on a shaker, yielding fermentation broths with different substrate concentrations. The fermentation broths were analyzed by HPLC.
[0050] The results are as follows Figure 6 As shown. By Figure 6It can be seen that when the substrate concentration gradually increases from 0.1 g / L to 0.5 g / L, the product concentration gradually increases. When the substrate concentration is 0.5 g / L, the product calcitriol concentration reaches a maximum value of 5.48 mg / L. When the substrate concentration continues to increase to more than 0.5 g / L, the product concentration and the cell concentration decrease obviously, and it is speculated that high-concentration substrate has an inhibitory effect on the growth of the cell, thereby inhibiting the synthesis of the product. Therefore, the optimal substrate concentration is 0.5 g / L.
[0051] In summary, the application constructs a cytochrome P450 enzyme mutant CYP109A2-H from Bacillus megaterium E81G , and heterologously expresses the mutant in Bacillus subtilis WB600 to obtain a recombinant bacterium Bacillus subtilis WB600-pMA5-CYP109A2-H E81G ; the recombinant bacterium is used to express the enzyme mutant in an optimized fermentation medium, and through optimization of the substrate concentration and the cosolvent conditions, the conversion efficiency can be significantly improved, the calcitriol yield (the product concentration is up to 5.48 mg / L) is improved, and the production cost is reduced, thereby providing a new way for industrial production of calcitriol.
[0052] The above only describes the preferred embodiments of the application and is not intended to limit the application, and any modification, equivalent replacement and improvement made within the spirit and principle of the application shall be included in the protection scope of the application.
Claims
1. A mutant of a cytochrome P450 enzyme of Bacillus megaterium origin, CYP109A2-H E81G characterized in that, The amino acid sequence is shown as SEQ ID NO:
1.
2. An enzyme mutant CYP109A2-H according to claim 1, characterized by E81G a coding gene, characterized by The nucleotide sequence is shown as SEQ ID NO:
2.
3. An expression vector, characterized by, The coding gene of claim 2.
4. The expression vector of claim 3, wherein, The original vector is Escherichia coli-Bacillus subtilis shuttle constitutive expression vector pMA5.
5. A recombinant engineered bacterium, characterized in that, The expression vector containing the target coding gene is introduced into Bacillus subtilis WB600 as the host, and the target coding gene is the coding gene of claim 2.
6. The recombineering bacteria of claim 5, wherein, The recombinant engineering bacteria express enzyme mutant CYP109A2-H after activation culture and fermentation culture E81G ; the enzyme mutant CYP109A2-H E81G Bioconversion generates calcitriol with VD3 as a substrate.
7. An enzyme mutant CYP109A2-H according to claim 1 E81G or the use of the recombinant engineering bacteria according to any one of claims 5-6 in the synthesis of calcitriol.
8. A method of bioconversion to produce calcitriol, characterized by, Using the enzyme mutant CYP109A2-H as described in claim 1 E81G As a catalyst or using the recombinant engineered bacteria according to any one of claims 5-6 as the enzyme expression mutant CYP109A2-H E81G The biological system uses VD3 as a substrate for transformation; specifically, it includes: transforming the enzyme-containing mutant CYP109A2-H... E81G The catalyst or biological system is contacted with the substrate VD3 in a fermentation medium, and the conversion solution is obtained after biotransformation.
9. The method of bioconversion to form calcitriol according to claim 8, wherein, The components of the fermentation medium include: soluble starch 10-50 g / L, tryptone 10-50 g / L, potassium phosphate 1-5 g / L, pH 7.0; The time node of adding the substrate VD3 is simultaneously added into the fermentation medium with the enzyme system, the concentration is 0.1-1.25 g / L, and the fermentation period after adding VD3 is 12-24 h.
10. The method of bioconversion to produce calcitriol according to claim 8, wherein, In the biological conversion process, the organic cosolvent DMF and / or DMSO and / or methanol and / or ethanol are also added simultaneously with the substrate, and the concentration is 1-6%.