Maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, preparation method of acetylated naringenin-7-O-glucoside and application of acetylated naringenin-7-O-glucoside in preparation of weight-losing products

By modifying the maltose-O-acyltransferase mutant MATM3, the problems of weak lipid-lowering effect of naringenin derivatives and traditional production were solved, and the efficient biosynthesis of acetylated naringenin-7-O-glucoside was realized for the preparation of weight loss products, which have significant weight loss effect and environmental advantages.

CN121065129AActive Publication Date: 2025-12-05FOSHAN GOLDEN HEALTH TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511613515.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-06
Publication Date
2025-12-05
Estimated Expiration
2045-11-06

AI Technical Summary

Technical Problem

The existing lipid-lowering effects of naringenin and its derivatives are relatively weak, and traditional production methods suffer from low yield, insufficient purity, complicated processes, significant environmental impact, and high dependence on plant raw materials, resulting in high production costs, low efficiency, and susceptibility to supply chain fluctuations.

Method used

The maltose-O-acyltransferase mutant MATM3 was used to change glutamic acid to alanine through gene mutation, thereby improving the efficiency of acyl transfer reaction. Naringenin-7-O-glucoside was converted into acetylated naringenin-7-O-glucoside using recombinant expression strains, and the production process was simplified by using biosynthesis technology.

Benefits of technology

It improved the conversion rate of naringenin-7-O-glucoside. Acetylated naringenin-7-O-glucoside showed significant weight loss and fat reduction effects in inhibiting adipocyte division and lipid droplet accumulation, and reduced triglyceride levels. It is also environmentally friendly and highly effective.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065129A_ABST
    Figure CN121065129A_ABST
Patent Text Reader

Abstract

The invention relates to a maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, a preparation method of the maltose-O-acyltransferase mutant MATM3 and acetylated naringenin-7-O-glucoside, and application of the maltose-O- According to the maltose-O-acyltransferase mutant MATM3 disclosed by the invention, on the basis of MAT enzyme, glutamic acid at the 125th site is mutated into alanine, and a recombinant strain containing the maltose-O-acyltransferase mutant MATM3 can be used for converting naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside, so that the yield of the maltose-O-acyltransferase mutant MATM3 is increased, and the yield of the maltose-O-acyltransferase mutant MATM3 is increased. The acetylated naringenin-7-O-glucoside reduces the triglyceride level by inhibiting mitosis cloning proliferation and lipid droplet accumulation of 3T3-L1 fat cells, and plays a good role in reducing weight and fat.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of variation or genetic engineering, and in particular to a maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, a preparation method thereof and application thereof in preparing a weight loss product. BACKGROUND

[0002] Obesity and related metabolic diseases have become a global health problem. Existing lipid-lowering drugs are often accompanied by side effects, so the development of natural active ingredients has attracted much attention. Naringenin and its derivatives (such as naringin and naringenin-7-O-glucoside) have potential lipid-lowering activity, but the lipid-lowering effect of naturally occurring naringenin and its derivatives is weak.

[0003] Furthermore, the main methods for producing acetylated naringenin-7-O-glucoside include chemical synthesis, fermentation and plant extraction. However, these methods generally have problems such as low yield, insufficient purity, complex process, significant environmental impact and high dependence on plant raw materials. Low yield leads to high production cost and long production cycle, while low purity directly affects the quality and stability of the product. The production process usually involves multiple complex steps, which not only increases the risk of pollution, but also reduces the overall production efficiency. In addition, some production methods have adverse effects on the environment, such as emitting pollutants or excessive consumption of non-renewable resources. At the same time, excessive dependence on plant raw materials makes production vulnerable to supply fluctuations, price fluctuations and other supply chain risks. Therefore, if the production of acetylated naringenin-7-O-glucoside through enzymatic synthesis technology can effectively overcome the above-mentioned drawbacks, it will have great commercial potential and environmental advantages, and is expected to become an important research direction and development hotspot in the field of biotechnology. SUMMARY

[0004] The purpose of the present application is to overcome the deficiencies of the prior art and provide a maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, a preparation method thereof and application thereof in preparing a weight loss product.

[0005] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:

[0006] In a first aspect, the present application provides a maltose-O-acyltransferase mutant MATM3, wherein the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is obtained by mutating glutamic acid at position 125 of the wild-type maltose-O-acyltransferase amino acid sequence shown in SEQ ID NO: 2 to alanine, and the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is shown in SEQ ID NO: 1.

[0007] Preferably, the base sequence of the maltose-O-acyltransferase mutant MATM3 gene is shown as SEQ ID NO: 3.

[0008] In a second aspect, the present application provides a recombinant expression strain containing the maltose-O-acyltransferase mutant MATM3 in the first aspect.

[0009] In a third aspect, the present application provides a preparation method of the recombinant expression strain in the second aspect, comprising the following steps:

[0010] S1, obtaining and amplifying the gene of wild-type maltose-O-acyltransferase shown as SEQ ID NO: 4, purifying the amplification product to obtain a MAT PCR product;

[0011] S2, using double enzyme digestion technology to connect the purified MAT PCR product into a pMD18-T vector to obtain a recombinant pMD18-T-MAT vector;

[0012] S3, transforming the recombinant pMD18-T-MAT vector into a competent Escherichia coli DH5α, screening positive clones, extracting the plasmid of the positive clones, and performing enzyme digestion treatment on the expression vector pET-28a;

[0013] S4, performing enzyme digestion on the recombinant pMD18-T-MAT vector to release an insert fragment containing the nucleotide sequence shown as SEQ ID NO: 4, introducing it into the enzyme-digested pET-28a expression vector through a ligation reaction to obtain a pET-28a-MAT recombinant expression vector;

[0014] S5, designing a site-directed mutation primer, taking the pET-28a-MAT recombinant expression vector as a template, adding the site-directed mutation primer, and introducing the mutation site into the expression vector through PCR amplification of the maltose-O-acyltransferase mutant MATM3 to obtain a BL21 / pET-28a-MATM3 mutant enzyme expression vector containing the maltose-O-acyltransferase mutant MATM3 in the first aspect; wherein the site-directed mutation primer is used to mutate glutamic acid at the 125th position of the maltose-O-acyltransferase to alanine;

[0015] S6, transforming the pET-28a-MATM3 mutant enzyme expression vector into a competent expression Escherichia coli BL21 to obtain a BL21 / pET-28a-MATM3 recombinant expression strain, which is the recombinant expression strain.

[0016] Preferably, the mutation primer in step S5 is:

[0017] M3-F: GGTCGCGGTCGACATATG;

[0018] M3-R: CCCCAGCGCAGCACCGCTATTACGTGCTAC.

[0019] In a fourth aspect, the present application provides use of the recombinant expression strain in the second aspect in the preparation of acetylated naringenin-7-O-glucoside, wherein the recombinant expression strain is used to convert naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside.

[0020] In a fifth aspect, the present application provides a method for preparing acetylated naringenin-7-O-glucoside in the fourth aspect, comprising the following steps:

[0021] (1) Strain culture and induction: the recombinant expression strain in the second aspect is cultured to OD600=0.6-0.8, IPTG is added to induce expression at 16-20℃, and a culture liquid is obtained; 600

[0022] (2) Bacterial concentration and biotransformation: the culture liquid is centrifuged, the bacterial cells are collected, resuspended, and a bacterial solution is obtained, the substrate naringenin-7-O-glucoside, DMSO and a carbon source are added, and stirring reaction is carried out, and a reaction liquid is obtained; wherein the wet weight of the bacterial cells in the bacterial solution is 50-100 mg / mL, the ratio of naringenin-7-O-glucoside to the bacterial solution is (0.2-0.4) mg: 1 mL, the stirring reaction is carried out at a temperature of 35-45℃, a rotation speed of 100-300 rpm, and for a time of 18-24 h;

[0023] (3) Product extraction and purification: the reaction liquid is centrifuged, the supernatant is taken, the supernatant is extracted with ethyl acetate, the solvent is removed by rotary evaporation under reduced pressure, dissolved in methanol and vacuum dried, and the acetylated naringenin-7-O-glucoside is obtained.

[0024] In a sixth aspect, the present application provides use of the acetylated naringenin-7-O-glucoside obtained in the fourth aspect in the preparation of a weight loss health care product.

[0025] Preferably, the dosage form of the weight loss product includes but is not limited to capsules, tablets, pills and liquid preparations, and can also be prepared into beverages, meal replacement powders, solid beverages, oral liquids, compressed tablets and the like, and applied in functional foods or health care foods. It can also be prepared into external application preparations such as emulsions, essences, moisturizing creams and the like, and applied in the field of cosmetics.

[0026] Compared with the prior art, the present application has the following beneficial effects:

[0027] ​The maltose-O-acyltransferase mutant MATM3 of the present application, based on the MAT enzyme, the glutamic acid at position 125 is mutated to alanine, the steric hindrance of the side chain group of the amino acid residue is reduced, so that the substrate molecules naringenin-7-O-glucoside and acetyl-CoA are more easily enter the active cavity and undergo acyltransferase reaction. The substrate conversion number is improved. The recombinant strain containing the maltose-O-acyltransferase mutant MATM3 of the present application can convert naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside. Acetylated naringenin-7-O-glucoside can inhibit the mitotic clonal proliferation and lipid droplet accumulation of 3T3-L1 adipocytes, reduce the level of triglyceride, and has a good effect of weight loss and fat reduction. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 HPLC chromatogram of acetylated naringenin-7-O-glucoside (acetylated naringenin monoglucoside);

[0029] Figure 2 Mitotic clonal proliferation potency of each compound in a 3T3-L1 cell model;

[0030] Figure 3 Comparison chart of lipid-lowering activity of each compound in a 3T3-L1 cell model. DETAILED DESCRIPTION

[0031] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with specific examples.

[0032] Example 1: Preparation of BL21 / pET-28a-MATM3 recombinant expression bacteria

[0033] Table 1: All primers used in Example 1

[0034] Primer name Primer sequence (5'→3') (lower case part is homology arm) Use SEQ ID NO MAT_F ATGAGCACAGAAAAAGAAAAGATG Cloning MAT fragment 5 MAT_R TTACAATTTTTTAATTATTCTGGC Cloning MAT fragment 6 28a_MAT_F caaatgggtcgcggatccgaattcATGAGCACAGAAAAA MAT homologous recombination primer 7 28a_MAT_R gagtgcggccgcaagcttgtcgacTTACAATTTTTTAAT MAT homologous recombination primer 8 M3-F GGTGCTgcgCTGGGGAAACCCGTCACCATC MAT M3 mutation upstream primer 9 M3_R CCCCAGcgcAGCACCGCTATTACGTGCTAC MAT M3 mutation downstream primer 10

[0035] 1. Preparation of mutant enzyme recombinant cells

[0036] 1.1 Construction of BL21 / pET-28a-MAT recombinant expression bacteria

[0037] (1) Single colonies were picked from BL21(DE3) plates, diluted in 10 μL ddH2O, and subjected to PCR. The reaction system is shown in Table 2.

[0038] Table 2: PCR reaction system

[0039] Content Volume / μL 2xPrimeSTAR ® Max DNA Polymerase 25 MAT_ F 0.5 MAT_R 0.5 Bacterial solution 4 ddH2O 20 Total volume 50

[0040] PCR reaction procedure: pre-denaturation 98℃ 3 min; denaturation 98℃ 10 s, annealing 47℃ 30 s, extension 72℃ 1 min, cycle 35 times; complete extension 72℃ 10 min; the final storage temperature is 4℃.

[0041] (2) Add an equal volume of 2xM5 Taq HiFi PCR mix to the amplification product, and react at 72℃ for 30 min. The reaction product is detected by agarose gel electrophoresis, and the gel recovery and purification are performed according to the instructions of the HiPure Gel Pure DNA Micro Kit.

[0042] (3) The target gene as shown in SEQ ID NO: 4 is constructed into a pMD18-T vector, and reacts at 16℃ for 30 min. The reaction system is shown in Table 3.

[0043] Table 3 Reaction system

[0044] Content Volume / μL DNA fragment 2 pMD18-T vector 0.5 Solution I 2.5 Total volume 5

[0045] (4) Plasmid transformation and verification: the constructed recombinant vector pMD18-T-MAT is transformed into E. coli competent DH5α, and plated on LB solid medium containing Amp antibiotic. The plate is placed in a 37℃ incubator overnight, and single colonies are picked from the culture dish incubated in a 37℃ incubator overnight, and subjected to colony PCR identification and sequencing.

[0046] (5) Extract the pMD18-T-MAT plasmid. Primer 28a_MAT_F / 28a_MAT_R is used for PCR to add homologous arms to the target gene MAT. The PCR reaction system is shown in Table 4.

[0047] Table 4 PCR reaction system

[0048] Content Volume / μL Template 2 2x PrimeSTAR ® Max DNA Polymerase 25 28a_MAT_F 1 28a_MAT_R 1 ddH2O 21 Total volume 50

[0049] PCR reaction procedure: pre-denaturation 98℃ 3 min; denaturation 98℃ 10 s, annealing 47℃ 30 s, extension 72℃, 1 min, cycle 35 times; complete extension 72℃ 10 min; the final storage temperature is 4℃. The PCR product is detected by agarose gel electrophoresis, and the gel recovery and purification are performed according to the instructions of the HiPure Gel Pure DNA Micro Kit.

[0050] (6) The pET-28a empty plasmid was treated with restriction enzymes EcoR I and Sal I at 37°C for 40 min. The PCR product was detected by agarose gel electrophoresis, and the gel was recovered and purified according to the instructions of the HiPure Gel Pure DNA Micro Kit reagent box. The PCR reaction system is shown in Table 5.

[0051] Table 5 PCR reaction system

[0052] Content Volume / μL EcoRI 1.5 SalI 1.5 10x Qcut buffer 3 ddH2O 9 Total volume 30

[0053] (7) The target gene and the vector were ligated at 50°C for 30 min, and the reaction system is shown in Table 6.

[0054] Table 6 Reaction system

[0055] Content Volume / μL Linearized vector pET-28a 2 Uniclone One Step Seamless Cloning Kit 5 Target gene 2 ddH2O 1 Total volume 10

[0056] According to the steps in (4), the recombinant vector pET-28a-MAT was transformed into the expression strain BL21 (DE3).

[0057] (8) Verification and sequencing: according to the steps in (5), the transformant was detected, and the positive single colony was sequenced to obtain the BL21 / pET-28a-MAT recombinant expression strain.

[0058] 2.2 Construction of BL21 / pET-28a-MATM3 recombinant mutant expression strain

[0059] The expression vector pET-28a-MAT in 2.1 was subjected to point mutation, glutamic acid at position 125 was mutated to alanine, and the mutation primer is shown in Table 1. The PCR (25 μL) amplification system is as follows: 2 x Primer star 12.5 μL, primer 1 μL, template plasmid 2 μL, and ddH2O is added to 25 μL. The PCR amplification conditions are as follows: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s; 63°C annealing for 30 s; 72°C extension for 90 s; 35 cycles; 72°C extension for 10 min; 4°C storage. After PCR, 3 μL of the amplification product was subjected to nucleic acid gel electrophoresis analysis, and the obtained target band was clear. The remaining product was added to 0.5 μL Dpn I endonuclease, and the template DNA was digested at 37°C for 1 h. After the reaction was completed, it was transformed into BL21 competent cells, and coated on LB solid medium containing 50 μg / mL kanamycin and cultured at 37°C overnight. A single colony was picked to obtain the mutant transformant. The BL21 / pET-28a-MATM3 recombinant mutant expression bacteria were obtained according to the method described in step 2.1. The amino acid sequence of the MATM3 mutant is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 3.

[0060] Example 2: Preparation of acetylated naringenin-7-O-glucoside

[0061] Seed liquid culture and fermentation induction

[0062] Culture medium preparation:

[0063] Prepare 2 L of LB liquid medium, and divide it into 4 1 L conical flasks (500 mL each). Sterilize at 121°C for 20 min, and cool to room temperature. Then add 500 μL of kanamycin stock solution to each conical flask (final concentration 0.1 mg / mL), and mix well for standby use.

[0064] Single colony inoculation and pre-culture:

[0065] In the clean bench, pick 1 single colony into 20 mL of LB+KAN medium as the first-stage seed. Inoculate the first-stage seed into 2 L of LB+KAN liquid medium at 1% (divided into 4 500 mL), and culture at 37°C, 200 rpm shaking bed for 3-4 h. Sample and detect OD600 by spectrophotometer until OD600 reaches 0.7.

[0066] IPTG induction expression:

[0067] Add IPTG stock solution to each conical flask (calculated according to the final concentration of 0.02 mM: 500 mL of medium needs to add 10 μL of 1M IPTG), and mix gently. Induce culture at 20°C, 150 rpm for 17 h.

[0068] 3. Cell centrifugation and concentration:

[0069] Cell centrifugation:

[0070] After the induction is completed, centrifuge 6000 of the fermentation liquid in the four conical flasks at 10,000 rpm for 10 min, discard the supernatant, and collect the cell precipitate.

[0071] Concentration:

[0072] According to the "5:1 concentration ratio", resuspend the cells with phosphate buffer: 500 mL of the original fermentation liquid corresponds to the cells resuspended with 100 mL of phosphate buffer (400 mL of fermentation liquid requires 400 mL of phosphate buffer), vortex mix until there is no obvious precipitate.

[0073] 4. Substrate preparation and reaction initiation:

[0074] Weigh 120 mg of naringin monoglucoside, dissolve it in 1 mL of DMSO, and add it to the resuspended cell solution (wet weight of 60 mg / mL, 400 mL). Add glucose (final concentration 35 mM, according to 400 mL of the system, add 2.52 g of glucose), stir to dissolve, then add the above substrate-DMSO solution, mix gently, and incubate at 40°C, 200 rpm for 20 h.

[0075] 5. Product extraction and detection

[0076] Reaction liquid centrifugation and sampling:

[0077] After the reaction is completed, 400 mL of the reaction liquid is divided into 50 mL centrifuge tubes, centrifuged at 8000 rpm for 10 min at 4°C, the supernatant is collected, 1 mL of the supernatant is taken, filtered through a 0.22 μm filter, labeled as "reaction liquid sample", and used for liquid chromatography detection.

[0078] Ethyl acetate extraction:

[0079] Transfer the remaining supernatant to a 1 L separatory funnel, add an equal volume of ethyl acetate, shake, extract twice, and collect the ethyl acetate phase after extraction is completed.

[0080] 6. Concentration and drying:

[0081] Transfer the ethyl acetate phase to a rotary evaporator, rotary evaporate under reduced pressure until dry, dissolve the white solid remaining after rotary evaporation in methanol (chromatographically pure), and finally place it in a vacuum drying oven to dry (to avoid residual methanol).

[0082] 7. Liquid phase detection:

[0083] The dried product crude extract was dissolved in methanol, filtered through a 0.22 μm filter, and loaded onto a liquid chromatograph for comparison with a standard to confirm that the crude extract was naringin-7-o-glucoside and to determine the purity.

[0084] Example 3: Evaluation of Lipid-lowering Effect

[0085] 1. Instruments and reagents: analytical balance, clean bench, cell incubator, microplate reader, mouse embryonic fibroblasts (3T3-L1), DMEM high-sugar medium, trypsin, serum, double antibody, anti-mycoplasma removal reagent, PBS, 48-well plate, differentiation induction solution components (isobutyl-methyl-xanthine, dexamethasone, insulin), 4% paraformaldehyde, isopropyl alcohol, oil red O, ultrapure water, trichloroacetic acid, acetic acid, sulforhodamine B, Tris-Base

[0086] Test method

[0087] Test substance preparation

[0088] The test substance stock solution was prepared in dimethyl sulfoxide (DMSO) at 100 mM, and diluted with culture medium according to the actual administration concentration, with the concentration of the solvent in the test solution not exceeding 0.5%.

[0089] 3T3-L1 cell model for determination of the lipid-lowering activity of naringin, naringin-7-O-glucoside (referred to as "naringin monoglucoside"), acetylated naringin monoglucoside, and naringin

[0090] 2. Cocktail method for inducing differentiation of 3T3-L1 cells

[0091] 3T3-L1 cells cultured in high-sugar DMEM medium containing 10% newborn bovine serum (NBS) were inoculated at 5.0×10 4 The cells were inoculated evenly in a 48-well plate, and the high-sugar DMEM medium containing 10% fetal bovine serum (FBS) was replaced, and the cells were incubated in a cell incubator, with the medium being replaced every 3 days until the cells were completely fused (Day 0), so that the cell growth was arrested, which helped to enter the differentiation stage.

[0092] After the cells were completely fused, the non-differentiation induction group (Blank) was replaced with high-sugar DMEM medium containing 10% FBS, the differentiation induction control group (Ctrl) was replaced with differentiation induction solution I (0.5 mM isobutyl-methyl-xanthine, 1 μM dexamethasone, 10 μg / mL insulin), and the compound group (Compd.) was diluted with differentiation induction solution I to the corresponding concentration, and incubated in the incubator for 3 days (Day 3), i.e., the first induction stage (Day 0-3), at which time the cells underwent mitotic clonal proliferation, the number of cells increased, the cell morphology was shriveled, and sporadic small lipid droplets were visible in some areas.

[0093] After 3 days, the Blank group was replaced with high-sugar DMEM medium containing 10% FBS, the Ctrl group was replaced with differentiation inducer II (10 μg / mL insulin), and the compound group was diluted with differentiation inducer II to the corresponding concentration, and continued to be cultured in the incubator for 3 days (Day 6), that is, the induction phase II (Day 3-6), at this time the cells began to generate a large number of lipid droplets, and the lipid droplets grew vigorously, the cell morphology was round and the adhesion was weakened, and there was a three-dimensional feeling.

[0094] After 3 days, the Blank group and the Ctrl group were replaced with high-sugar DMEM medium containing 10% FBS (differentiation inducer III), and the compound group was diluted with differentiation inducer III to the corresponding concentration, and continued to be cultured in the incubator for 3 days (Day 9), that is, the induction phase III (Day 6-9), at this time the cells accumulated lipid droplets, which was the terminal differentiation stage of 3T3-L1 cells.

[0095] The cells differentiated to the 9th day were fixed with 4% paraformaldehyde and stained with oil red O, and the lipid was quantitatively determined.

[0096] 3. Oil red O staining and quantification

[0097] The culture medium was carefully discarded, 200 μL / well of 1×PBS was added, the 1×PBS was poured out, 100 μL / well of 4% paraformaldehyde was gently added, and the room temperature was fixed for 30 min. Discard the fixing solution, add 100 μL / well of 60% isopropanol to rinse the cells, discard, and then add 100 μL / well of oil red O working solution, and stain at room temperature for 30 min. Discard the staining solution, wash off the dye with ultrapure water, repeat 2-3 times. Discard the ultrapure water, add 100 μL / well of 60% isopropanol, and avoid light to wash for 5 min. Discard the washing solution, place it in a fume hood to evaporate, then add 100 μL / well of isopropanol for extraction, tightly wrap with parafilm, and shake quickly for 5 min. Take 80 μL / well of the extraction solution in a 96-well plate, detect the absorbance value at 510 nm (including the OD (None) of the empty well plate), and calculate the lipid-lowering rate (Lipid-lowering rate) or triglyceride level (TG level).

[0098]

[0099]

[0100] Example 4: Cytotoxicity detection

[0101] The 48-well plate with the cells which have finished oil red O quantification (excess isopropanol was added to wash off the oil red O dye completely and the solvent was evaporated) was added with 100 μL / well 10% trichloroacetic acid and fixed at room temperature for 1 h. The fixing solution was discarded, 200 μL / well secondary water was added to wash 3 times at room temperature and dried. 50 μL / well 0.4% SRB was added to stain for 30 min in the dark. The dye solution was discarded, 200 μL / well 1% acetic acid was added to wash 3 times or more until there was no obvious color, and dried at room temperature. 50 μL / well 10 mM Tris-Base was added to dissolve SRB, shaken for 5-10 min, and the absorbance value was detected at 515 nm to calculate the cytotoxicity or mitotic clonal expansion efficacy (MCE efficacy). When the MCE efficacy is close to 100%, it means that the compound does not affect the normal mitotic clonal expansion process of 3T3-L1 cells, and when the MCE efficacy is less than 0, it means that the compound not only inhibits the normal mitotic clonal expansion process of 3T3-L1 cells, but also has toxicity to the background cells.

[0102]

[0103]

[0104] Results

[0105] Preparation results of acetylnaringin monoglucoside

[0106] From Figure 1 As can be seen from the liquid phase diagram, under the preparation method of Example 1 above, naringin monoglucoside is converted into acetylnaringin monoglucoside, and the content of acetylnaringin monoglucoside is 85%.

[0107] Lipid-lowering effect and cytotoxicity test

[0108] As Figure 2 shown, among naringin, naringin monoglucoside and naringin, the lipid-lowering activity of naringin as the aglycone is good and has concentration dependence, but naringin at a high concentration (400 μM) has certain cytotoxicity, which can damage the number of background cells, and naringin at a low concentration (100 and 200 μM) mainly plays a certain lipid-lowering activity by inhibiting the mitotic clonal expansion of 3T3-L1 cells.

[0109] By Figure 3It can be seen that the lipid-lowering activity of naringin monoglucoside is weak, the lipid-lowering rate is 15.79% at 100 μM, the lipid-lowering rate is 10.52% at 200 μM, and the lipid-lowering rate is 24.09% at 400 μM. The acetylated naringin monoglucoside improves the lipid-lowering activity, the lipid-lowering rate is 43.84% at 100 μM, the lipid-lowering rate is 32.53% at 200 μM, and the lipid-lowering rate is 80.47% at 400 μM. At the same concentration (from low to high), the lipid-lowering rate of acetylated naringin monoglucoside is 2.78 times, 3.09 times and 3.34 times of that of naringin monoglucoside, respectively.

[0110] It can be seen from the above results that the lipid-lowering activity of naringin monoglucoside is weak, but the acetylated naringin monoglucoside greatly improves the lipid-lowering activity. And at high concentration, it has no toxicity to cells. It has great development potential in the preparation of weight loss products.

[0111] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. Use of a recombinant expression strain, characterized in that The recombinant expression strain is used for converting naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside, and the recombinant expression strain contains a maltose-O-acyltransferase mutant MATM3, the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is obtained by mutating glutamic acid at position 125 of the wild-type maltose-O-acyltransferase amino acid sequence shown in SEQ ID NO: 2 into alanine, the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is shown in SEQ ID NO: 1, and the base sequence of the maltose-O-acyltransferase mutant MATM3 gene is shown in SEQ ID NO:

3.

2. Use of a recombinant expression strain according to claim 1, characterized in that The preparation method of the recombinant expression strain comprises the following steps: S1, obtaining and amplifying the gene of the wild-type maltose-O-acyltransferase shown in SEQ ID NO: 4, purifying the amplification product to obtain a MAT PCR product; S2, using double enzyme digestion technology to connect the purified MAT PCR product into a pMD18-T vector to obtain a recombinant pMD18-T-MAT vector; S3, transforming the recombinant pMD18-T-MAT vector into a competent Escherichia coli DH5α, screening positive clones, extracting the plasmid of the positive clones, and performing enzyme digestion treatment on the expression vector pET-28a; S4, performing enzyme digestion on the recombinant pMD18-T-MAT vector to release an insert fragment containing the nucleotide sequence shown in SEQ ID NO: 4, introducing it into the enzyme-digested pET-28a expression vector through a ligation reaction to obtain a pET-28a-MAT recombinant expression vector; S5, designing a site-directed mutation primer, taking the pET-28a-MAT recombinant expression vector as a template, adding the site-directed mutation primer, and introducing the mutation site into the expression vector through PCR amplification of the maltose-O-acyltransferase mutant MATM3 to obtain a BL21 / pET-28a-MATM3 mutant enzyme expression vector containing the maltose-O-acyltransferase mutant MATM3 of claim 1 or 2; wherein the site-directed mutation primer is used for mutating glutamic acid at position 125 of the maltose-O-acyltransferase into alanine; S6, transforming the pET-28a-MATM3 mutant enzyme expression vector into a competent expression Escherichia coli BL21 to obtain a BL21 / pET-28a-MATM3 recombinant expression strain, which is the recombinant expression strain.

3. Use of a recombinant expression strain according to claim 1, wherein The mutation primer in the preparation step S5 of the recombinant expression strain is: M3-F:GGTGCTGCGCTGGGGAAACCCGTCACCATC; M3-R:CCCCAGCGCAGCACCGCTATTACGTGCTAC.

4. A process for the preparation of acetylated naringenin-7-O-glucoside, characterized in that, The method comprises the following steps: (1) Strain culture and induction: the recombinant expression strain of claim 1 is cultured to OD 600 =0.6-0.8, IPTG is added to induce expression at 16-20℃, and the culture liquid is obtained; (2) Bacterial body concentration and biological transformation: centrifuging the culture liquid, collecting bacterial bodies, resuspending to obtain a bacterial body solution, adding a substrate naringin-7-O-glucoside, DMSO and a carbon source to perform stirring reaction to obtain a reaction liquid; wherein the wet weight of the bacterial bodies in the bacterial body solution is 50-100 mg / mL, the ratio of naringin-7-O-glucoside to the bacterial body solution is (0.2-0.4) mg:1 mL, the stirring reaction temperature is 35-45℃, the stirring speed is 100-300 rpm, and the stirring time is 18-24 h; (3) Product extraction and purification: centrifuging the reaction liquid, taking the supernatant, extracting the supernatant with ethyl acetate, removing the solvent by rotary evaporation under reduced pressure, dissolving in methanol and vacuum drying to obtain the acetylated naringin-7-O-glucoside.

5. Use of acetylated naringenin-7-O-glucoside in the preparation of a slimming health product, characterized in that, The acetylated naringin-7-O-glucoside is prepared by the preparation method of the acetylated naringin-7-O-glucoside according to claim 4.

Citation Information

Patent Citations

  • Method for enzymatic synthesis of acetyl coenzyme A by using diacerein donor

    CN116348606A

  • Acetyltransferase mutant and application thereof

    CN116656643A

  • Method for examining therapeutic agent or prophylactic for disease such as hyperlipemia

    JP2004000101A