A method for promoting growth and development and lipid droplet accumulation in young sandalwood

Soaking sandalwood seeds and seedlings in horseradish peroxidase solution addresses the issues of slow seed germination and insufficient haustorium formation, promoting sandalwood growth and development, lipid droplet accumulation, and improving the efficiency of sandalwood essential oil synthesis.

CN117813962BActive Publication Date: 2026-02-03SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311794493.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-25
Publication Date
2026-02-03
Estimated Expiration
2043-12-25

AI Technical Summary

Technical Problem

Sandalwood seeds germinate slowly and have insufficient haustoria, resulting in slow root and stem growth, which affects essential oil accumulation. Current technology lacks effective measures to promote this process.

Method used

Sandalwood seeds and seedlings were soaked in a 0.0001% horseradish peroxidase (HRP) solution to promote essential oil synthesis in sandalwood seedlings by upregulating the expression of terpene synthesis-related genes SaCYP736A167, SaTPS2, and SaTPS6.

Benefits of technology

It accelerates the germination process of sandalwood seeds, induces the early occurrence and maturation of haustoria, increases the biomass of both above-ground and underground parts, promotes the accumulation of lipid droplets and the synthesis of essential oils, and significantly increases plant height, number of haustoria and biomass.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117813962B_ABST
    Figure CN117813962B_ABST
Patent Text Reader

Abstract

The application discloses a method for promoting growth and development and lipid droplet accumulation of young sandalwood. The application of horseradish peroxidase can accelerate the seed germination process of sandalwood, induce the early occurrence of haustoria, improve the biomass of the aboveground and underground parts, induce the production of lipid droplets in the epidermal cells and endothelial cells of the haustoria of sandalwood seedlings, and induce the synthesis of sandalwood essential oil. The research results provide a theoretical basis for the research on the development of sandalwood vegetative organs, including the development of haustoria, roots and stems, and the molecular mechanism of lipid droplets and essential oil synthesis of sandalwood, and also provide a practical basis for the subsequent scientific guidance of sandalwood planting by applying HRP nutrient solution.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of sandalwood industry, and particularly relates to application of a biological enzyme preparation in promoting growth and development and lipid droplet accumulation of young sandalwood. BACKGROUND

[0002] Santalum album L. is a kind of evergreen semi-parasitic small tree in Santalaceae, and its economic value mainly comes from roots and heartwood and high-quality essential oil extracted therefrom. Mature heartwood and roots with solid texture and dense texture are excellent materials for precious handicrafts and wood carvings, and the essential oil and its main component santalene compounds are widely used in the perfume, medicine and beauty industries (Fox 2000; Bommareddy et al., 2012), and have great commercial value. Driven by high profits, long-term overexploitation has caused serious damage to the habitat of sandalwood, and the wild resources have been sharply reduced to the verge of extinction. China has no original distribution of sandalwood, and after decades of introduction and cultivation, sandalwood can be planted, seeded and bred, and fragrant in Guangdong, Hainan, Fujian, Yunnan and Sichuan, but there are few large-scale high-quality artificial forests, and there are problems such as slow growth and difficulty in obtaining benefits in the short term. This is closely related to the semi-parasitic nature of sandalwood roots. Unlike other non-parasitic and fast-growing economic forests, sandalwood needs to rely on the haustoria on the roots to invade the host roots and absorb water and nutrients from the host roots to survive, otherwise the sandalwood will gradually die (Lu et al., 2014). Therefore, the number of haustoria formation, maturity and the ability to successfully establish a parasitic relationship with the host seriously restrict the growth of sandalwood roots and stems, and then affect the accumulation of volatile oil in the roots and stems. Scientific and reasonable regulation of haustoria development can improve the development of poor-quality forest from the source and improve the cultivation efficiency of high-quality artificial forest to a certain extent.

[0003] Haematopsies are not endogenous; their development is influenced by both the host and exogenous signaling molecules. Early studies have shown that legume hosts have a positive impact on sandalwood plant growth and development (plant height, number of haustoria, root length, etc.), amino acid content, photosynthetic rate, and macronutrient content compared to non-leguminous hosts (Ouyang et al., 2016; Li et al., 2022). Exogenous application of 2,6-dimethyl-p-benzoquinone and syringaldehyde significantly promotes sandalwood seedling height, root development, and nutrient absorption (Li et al., 2022). In weedy parasitic plants, these 2,6-dimethyl-p-benzoquinone secreted by host roots, along with a series of reducing quinones and phenolic acids, have been shown to play a positive role in haustorium development (Goyet et al., 2019). The fact that these haustorium-inducing factors are all within a certain redox potential range suggests the important role of redox reactions in haustorium development. In this process, reactive oxygen species are considered important signal transduction mediators. Reactive oxygen species (ROS) play a crucial regulatory role in the growth, development, and stress resistance of non-parasitic plants. However, research on their mechanisms in host-parasitic interactions has focused primarily on weedy parasitic plants that rely on hosts to produce haustoria, with few reports on parasitic plants that spontaneously produce haustoria without host dependence, such as sandalwood. Peroxidases, a class of redox enzymes, catalyze and regulate the production of ROS depending on the activity of different peroxidase isomers, playing key roles in pathogen responses, cell wall lignification, and cell elongation. However, the role of peroxidases in sandalwood seed germination and the development of roots, haustoria, and stems in young sandalwood is unknown. In particular, research combining morphological, anatomical, histochemical staining, and molecular biological methods to investigate the transcriptional regulation of peroxidases on biomass accumulation, haustoria development, lipid droplet metabolism, and essential oil synthesis in the aboveground and underground parts of sandalwood seeds and seedlings is currently lacking in available information. Summary of the Invention:

[0004] The first objective of this invention is to provide the application of horseradish peroxidase in accelerating the germination process of sandalwood seeds, inducing early occurrence and maturation of haustoria, and increasing the biomass of the aboveground and underground parts; inducing the production of lipid droplets in the epidermal and endodermal cells of sandalwood seedling haustoria, and inducing the synthesis of sandalwood essential oil.

[0005] Preferably, the horseradish peroxidase is a solution with a mass fraction of 0.0001%.

[0006] Preferably, the synthesis of essential oil in sandalwood seedlings is induced by upregulating the expression levels of SaCYP736A167, SaTPS2, and SaTPS6 genes related to terpene synthesis.

[0007] The second objective of this invention is to provide a method for promoting the growth and development of young sandalwood and the accumulation of resin droplets, which involves soaking sandalwood in a horseradish peroxidase solution.

[0008] Preferably, the sandalwood is sandalwood seed or sandalwood seedling, and more preferably, sandalwood seedling.

[0009] Preferably, the horseradish peroxidase is a solution with a mass fraction of 0.0001%.

[0010] This invention investigates the effects of HRP nutrient solution on sandalwood seed germination, growth and development of young sandalwood, lipid droplet accumulation, and gene expression levels in the essential oil synthesis pathway. HRP nutrient solution plays a positive role in accelerating seed germination, inducing early development and maturation of haustoria, and increasing biomass in both aboveground and belowground parts. Furthermore, HRP nutrient solution can induce lipid droplet production in haustoria epidermal and endothelial cells; and it also plays a positive role in inducing the expression of key enzyme genes involved in sandalwood essential oil synthesis, such as SaCYP736A167, SaFPPS, SaGPPS, SaTPS2, and SaTPS6. These findings provide a theoretical basis for studying the development of sandalwood vegetative organs, including haustoria development, root and stem development, and the molecular mechanisms of sandalwood lipid droplet and essential oil synthesis. They also provide practical evidence for the subsequent scientific guidance of sandalwood cultivation through the application of HRP nutrient solution. Attached image description:

[0011] Figure 1 This diagram shows the phenotypic effects of exogenous HRP nutrient solution treatment on sandalwood seeds and seedlings. A and B are germination diagrams of seeds after 30 days of HRP nutrient solution treatment (control and HRP nutrient solution treatment, respectively); C and D are germination diagrams of seeds after 45 days of HRP nutrient solution treatment (control and HRP nutrient solution treatment, respectively); E and F are phenotypic diagrams of root systems and haustoria of seedlings after 90 days of HRP nutrient solution treatment (control and HRP nutrient solution treatment, respectively). HA represents haustoria. Figure 1 AD, scale: 2cm; Figure 1 EF, scale bar: 4cm. CK represents control, HRP represents horseradish peroxidase nutrient solution treatment.

[0012] Figure 2 The differences in plant height, biomass, haustoria number, and haustoria microstructure between the control and HRP nutrient solution treatments are shown. A represents the statistical analysis of plant height, aboveground and underground biomass, and the number of young and mature haustorias, n=20. B is a cross-sectional microscopic image of the haustoria. Figure 2 A significance level is indicated by an asterisk, with ** representing significance between samples when p < 0.01, using the Student's test method. Figure 2 B scale bar, 75 μm. CK represents control, HRP represents horseradish peroxidase nutrient solution treatment.

[0013] Figure 3 Sudan Black B staining of haustoria in sandalwood seedlings in control and HRP nutrient solution treatment. Scale bar, 100 μm. CK represents control, and HRP represents horseradish peroxidase nutrient solution treatment.

[0014] Figure 4 This indicates the expression of terpene synthesis-related genes SaFPPS, SaGGPS, SaTPS2, SaTPS6, and SaCYP736A167 in the haustoria of sandalwood seedlings in the control and HRP nutrient solution treatments. Different colors represent log2 fold changes, i.e., log2(gene / SaACTIN), with 3 biological replicates. CK represents the control, and HRP represents the horseradish peroxidase nutrient solution treatment. Detailed implementation method:

[0015] Example 1:

[0016] I. Materials and Methods

[0017] 1. Plant growth conditions

[0018] Fresh, mature sandalwood (Santalum album L.) seeds were cleaned by removing the purplish-red fleshy aril. The seeds were rinsed with tap water until the aril was no longer sticky, then air-dried. Plump, uniform seeds were soaked in a 2mM gibberellin solution (Aladdin, Shanghai, China) for 12 hours, then in a 3% sodium hypochlorite solution for 5 minutes, shaking 2-3 times during the soaking process. The seeds were then rinsed 5 times with sterile distilled water. The seeds were sown in sterile sand in a greenhouse under the following conditions: 16 hours light (32℃) / 8 hours darkness (27℃), 100 μmol m... -2 S -1 70% relative humidity.

[0019] 2. External application of peroxidase nutrient solution

[0020] The experiment was conducted in a greenhouse at the South China Botanical Garden of the Chinese Academy of Sciences, using sandalwood seeds and seedlings as experimental materials.

[0021] This study prepared an HRP nutrient solution by mixing horseradish peroxidase (HRP) (Maclean's, Shanghai, China) with macro-elements, micro-elements, and iron salts (Sinopharm, Beijing, China).

[0022] (1) Preparation of HRP nutrient solution:

[0023] Solution A: 0.1% horseradish peroxidase (HRP). Weigh 0.05g of HRP powder in a sterile operating table and dissolve it in 50mL of sterile phosphate buffer (pH 6.1). If there are undissolved particles, filter them with sterile filter paper and dispense 1mL into 1.5mL sterile brown centrifuge tubes. Store at -20℃.

[0024] Solution B: A mixture of macro-elements, iron salts, and trace elements.

[0025] The preparation method is as follows:

[0026]

[0027]

[0028] Solution C: Dissolve 1 mL of solution B in solution C, adjust the pH to 6.0, and prepare 1 L of HRP nutrient solution working solution.

[0029] Solution D: Dissolve 1 mL of phosphate buffer (pH 6.1) in solution B, adjust the pH to 6.0, and prepare 1 L of control working solution.

[0030] (2) Application of HRP nutrient solution:

[0031] A. Soak 100 seeds after disinfection in 200mL HRP nutrient solution (treatment) and 200mL control working solution respectively, with 50 seeds for each treatment. Place them in a dark incubator at 25℃ for 24 hours.

[0032] B. Carefully wash the roots of the sand-stored seedlings with running water. Randomly select 300 healthy, uniformly developed seedlings and soak them in 500 mL of HRP nutrient solution (treatment) and 500 mL of control working solution, with 150 seedlings for each treatment. Place them in a dark incubator at 25°C for 24 hours of pretreatment. After treatment, place the seedlings in a mixed substrate (yellow clay: peat moss = 5:1 volume ratio), add the seedling host plant *Amaranthus praecox*, and cultivate them together for 3 months.

[0033] 3. Morphological and anatomical observation

[0034] (1) Morphological observation

[0035] To understand the effects of peroxidase nutrient solution on seed and seedling development, we continuously observed the morphological changes of different parts of sandalwood in the control and treatment groups at different developmental stages and took pictures using a Nikon camera.

[0036] (2) Anatomical observation and histochemical staining

[0037] To investigate the effects of peroxidase nutrient solution on the microstructure of haustoria, we selected haustoria from control and HRP-treated seedlings that developed synchronously for 10 days as our research subjects.

[0038] 1) Routine sample preparation and sectioning for semi-thin sections:

[0039] A. Use a mixed solution of 2.5% glutaraldehyde (Aladdin) + 2% paraformaldehyde (AlfaAesar) to fix the haustoria growing on the roots of the control group and the treatment group, mark the sample number, vacuum them, and store them at 4℃.

[0040] B. Wash 6 times with 0.1M pH 7.2 phosphate buffer, 15 minutes each time;

[0041] C. Fixation with 1% osmium tetroxide for 4 hours;

[0042] D. Wash 6 times with 0.1M pH 7.2 phosphate buffer, 15 minutes each time;

[0043] E. Stepwise alcohol dehydration: 30% alcohol for 20 minutes - 50% alcohol for 20 minutes - 70% alcohol overnight - 80% alcohol for 20 minutes - 90% alcohol for 20 minutes - 100% alcohol for 30 minutes, twice;

[0044] F. Gradual resin transition: First, use propylene oxide:EP812 = 3:1, 1:1, and 1:3 for transition, then permeate with pure EP812 resin 3 times.

[0045] G. After embedding the sample in the embedding box, place it in a 60℃ oven for polymerization for 3-4 days.

[0046] H. Trim the sample to the appropriate size and slice it using a Leica EMUC7 microtome to a thickness of 1 μm.

[0047] 2) Staining and observation:

[0048] Stain samples routinely with 0.1% toluidine blue (TBO).

[0049] Sudan Black B staining:

[0050] A. Weigh 0.3 g of Sudan Black B (Maclean's), dissolve it in 100 mL of 70% ethanol, seal the bottle, shake to dissolve, and incubate overnight at 37°C. Prepare fresh before use.

[0051] B. Preheat Sudan Black B dye solution in a 60℃ water bath for 20 minutes;

[0052] C. Place the completely dried slices into Sudan Black B staining solution and soak at 60°C for 20 minutes;

[0053] D. Rinse with tap water for 2 minutes, then soak in double-distilled water once.

[0054] E. Soak in 70% alcohol for 2 minutes, then rinse once with tap water and once with double-distilled water.

[0055] F. Dry sections at room temperature and mount with glycerol gelatin.

[0056] observe:

[0057] The stained sample sections were observed and photographed using a Leica DVM63D digital microscope and the accompanying Leica software.

[0058] 4. Plant height and biomass statistics

[0059] (1) Plant height measurement

[0060] Plant height in both the control and treatment groups was measured using a steel ruler with a 50 cm range (Deli, Ningbo, China).

[0061] (2) Biomass statistics

[0062] The roots of the haustoria in both the control and treatment groups were dug out of the substrate. After gently shaking to remove most of the substrate, they were carefully rinsed with running water and blotted dry with large filter paper. Using a double-edged blade, the roots were divided into aboveground and underground parts at the base of the main root. All branches and upper leaves were removed from the aboveground part, leaving only the stem, which was then cut into 5cm segments. The underground part consisted of all the roots of the haustoria. The stems and roots of both the control and treatment groups were weighed using an analytical balance, and the data were recorded. They were then placed in kraft paper bags, dried in an oven at 80°C, and weighed dry.

[0063] 5. Real-time quantitative polymerase chain reaction (qRT-PCR)

[0064] Based on the obtained omics results, genes related to the synthesis pathways of sandalwood lipids, flavonoids, and essential oils that showed significant changes in expression levels were selected for qRT-PCR to verify their expression.

[0065] (1) RNA extraction and cDNA synthesis

[0066] 0.1g of each sample was extracted using liquid nitrogen grinding apparatus and control apparatus, respectively, according to the instructions of the rapid RNA extraction kit. RNA integrity was assessed using 1% agarose gel electrophoresis, and RNA purity and concentration were determined using NanoDrop. cDNA synthesis for each sample used 1μg of RNA, genomic DNA remover, and... -Uni RT / RI enzyme mixing system (TransGold, Beijing, China), reaction system 20 μl, add 5 times volume of deionized water and mix well, then freeze at -20℃ for later use.

[0067] (2) qRT-PCR

[0068] In both the treatment and control groups, the expression of terpene biosynthesis-related genes and internal reference genes was studied using the same qRT-PCR system and reaction conditions. 2 μL of cDNA and gene-specific primers were added sequentially. Green qPCRSuperMix system (Full Gold), 20 μL volume, was used on an ABI 7500 qRT PCR system. SaACTIN was used as an internal control, and each sample was repeated three times. Relative gene expression levels were measured using 2... -ΔΔCt Formula calculation.

[0069] The primer sequences are as follows:

[0070] Gene name Upstream primer (5'-3') Downstream primer (5'-3') SaFPPS TCTTGTGCAGTCCAGTGAAG CTACCATGTCTGCTCCTGATG SaGGPS TGACAGGACACAACGAAAGAG CGAAGGGACCGAATACAAGG SaTPS2 TGTTCGATCTTGTGAGACACG ATATGTTAGCAGTGGCGTCC SaTPS6 CAATTTTCTCCGGTTGCTTGG GTCCCATCGATCCCATAATCAG SaCYP736A167 GCGGGAGGGTCTTAGTATCAT CACTCGACGCCACTTGTTG SaACTIN GTCACACGGTGCCAATCTAT TACCCTCTCTCAGTCAGAATCTT

[0071] II. Experimental Results

[0072] 1. External application of HRP nutrient solution can promote seed germination and seedling development.

[0073] First, the effect of HRP nutrient solution on sandalwood seed germination was observed. After 30 days of treatment, the seedlings in the control group were at the SG5 (Seed Germination 5) stage. Figure 1 A), while the seedlings in the HRP-treated group had developed to the SG6 stage and occasional lateral root haustoria were observed. Figure 1 B). After 45 days of treatment, there was no significant difference in plant height and leaf number between the control and treatment groups. However, in terms of leaf development, the leaves of HRP-treated plants matured slightly earlier than those of the control group. Regarding root and haustorium development, the root system of HRP-treated plants was more developed and haustoriums were attached to the roots compared to the control group, while no haustoriums were attached to the roots of the control group. Figure 1 C and D). Next, the effect of HRP nutrient solution on the development of sandalwood seedlings was observed. Seedlings were treated with control nutrient solution and HRP nutrient solution respectively, and then cultured with the host plant. After 90 days of treatment, compared with the control group where only a few small haustoria attached to the roots successfully parasitized the host root system (C and D), the HRP nutrient solution had a significantly smaller impact on the seedling development. Figure 1 E), after HRP treatment, the plant's root system was more developed and had a large number of large haustoria that established vascular connections with the host root. Figure 1 F). In summary, exogenous application of HRP nutrient solution can not only shorten the seed development process and promote root development, but also induce the early occurrence and maturation of haustoria, and promote the establishment of a parasitic relationship between haustoria and host roots.

[0074] 2. HRP nutrient solution affects plant height, haustoria number, biomass, and haustoria microstructure.

[0075] Next, we statistically analyzed the growth and development indicators of seedlings, such as plant height and biomass, after 90 days in both the control and HRP nutrient solution treatment groups. Figure 2 A) Plant height analysis showed that, compared with the control, the height of seedlings treated with HRP increased by 25.45%. In terms of biomass, compared with the control, the dry weight of the aboveground stems and underground parts of the plants treated with HRP increased by 33.96% and 60.89%, respectively. In terms of haustoria number, compared with the control, the number of young and mature haustoria in the plants treated with HRP increased by 89.96% and 397.29%, respectively. Figure 2As shown in Figure A, compared with the control, the application of HRP nutrient solution significantly increased plant height, biomass accumulation, and the number of haustoria, especially the number of mature haustoria. HRP induces a greater number of mature haustoria in sandalwood, suggesting that it can absorb more inorganic salts and water from the host roots, thereby promoting the co-growth of the underground and aboveground parts.

[0076] To investigate the effects of HRP on early haustorium development, we selected haustoriums from control and HRP-treated seedlings that grew synchronously for 10 days as the research subjects and conducted microscopic observations. Toluidine blue staining results showed that, in cross-section, both the control and HRP-treated groups exhibited flattened haustorium tips, vascular tissue formation in the middle of the haustorium, and collapsed epidermal cells. Figure 2 B). Compared with the control group, HRP-treated seedlings produced a large number of spherical or near-spherical substances in the endothelial cells near the haustorium epidermis. Figure 2 B).

[0077] 3. HRP affects lipid droplet accumulation.

[0078] To investigate the types of the aforementioned spherical and near-spherical substances, we then used Sudan Black B dye to stain the cross-sections of the suction tubes in both the control group and the HRP-treated group. Figure 3 As shown, Sudan Black B staining results indicated that the control group had only scattered, small lipid droplets in the endothelial layer of the aspirator, while the HRP-treated group showed relatively concentrated, larger, and more numerous lipid droplets in the endothelial layer of the aspirator. Figure 3 This indicates that HRP nutrient solution can significantly induce the synthesis and accumulation of lipid droplets within the haustorium.

[0079] 4. HRP affects the expression of genes related to essential oil and terpene synthesis.

[0080] To further understand the early molecular biological events in HRP-induced haustorium development, we conducted a comparative transcriptomic analysis using haustorium from control and HRP-treated seedlings that had not yet established vascular connections with the host and were growing synchronously. Compared with the control group, the expression levels of key genes involved in terpene synthesis were significantly upregulated in haustorium treated with HRP. Previous studies on sandalwood essential oil synthesis have focused on organs or tissues such as mature heartwood, sapwood, roots, young shoots, and callus, but there have been no reports on terpene synthesis in haustoriums, especially exogenous application of biological enzymes to induce terpene synthesis. To validate the above omics results, five genes were selected: SaFPPS (encoding farnesyl pyrophosphate synthase, FPPS), SaGGPS (encoding squalene pyrophosphate synthase, GGPS), SaTPS2 and SaTPS6 (encoding terpene synthases), and SaCYP736A167 (encoding cytochrome P450 monooxygenase). The expression levels of these five genes in control and HRP-treated pipettes were detected using quantitative real-time PCR. Figure 4 As shown, compared with the control, HRP application significantly increased the expression of SaCYP736A167, SaFPPS, SaGGPS, SaTPS2, and SaTPS6 genes, with the expression levels of SaCYP736A167, SaTPS2, and SaTPS6 genes upregulated by 4.3-fold, 15.3-fold, and 5.9-fold, respectively. Figure 4 CYP450 and TPS are both key enzymes in the synthesis of santalin terpenes. Gene quantification results indicate that HRP application may affect essential oil synthesis by promoting the expression of key enzymes in santalin terpenes synthesis.

Claims

1. The application of horseradish peroxidase in accelerating the germination process of sandalwood seeds, inducing the early occurrence and maturation of haustoria, and increasing the biomass of aboveground and underground parts; inducing the production of lipid droplets in the endothelial cells of sandalwood seedling haustoria, and inducing the synthesis of sandalwood essential oil, wherein the horseradish peroxidase is a solution with a mass fraction of 0.0001%.

2. The application according to claim 1, characterized in that, By upregulating terpene synthesis-related SaCYP736A167, SaTPS2 and SaTPS6 Gene expression levels were used to induce essential oil synthesis in sandalwood seedlings.

3. A method for promoting the growth and development of young sandalwood and the accumulation of resin droplets, characterized in that, Sandalwood is soaked in a horseradish peroxidase solution, wherein the horseradish peroxidase is a solution with a mass fraction of 0.0001%.

4. The method according to claim 3, characterized in that, The sandalwood mentioned refers to sandalwood seeds or sandalwood seedlings.

5. The method according to claim 4, characterized in that, The sandalwood seedlings mentioned are sandalwood seedlings.

Citation Information

Patent Citations

  • Method for improving quality of vegetable by using turnip peroxidase

    CN100998297A

  • Method for promoting germination of wheat and barley

    CN101892135A