A maltose-o-acyltransferase mutant matm3, acetylated naringenin-7-o-glucoside, and a preparation method and application thereof in preparing a weight loss product

By using the enzymatic synthesis technology of the maltose-O-acyltransferase mutant MATM3, the problems of low yield, low purity and environmental impact of existing production methods have been solved, and the efficient preparation of acetylated naringenin-7-O-glucoside has been achieved. This product is used to prepare weight loss products and has a significant weight loss effect.

CN121065129BActive Publication Date: 2026-02-17FOSHAN GOLDEN HEALTH TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511613515.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-06
Publication Date
2026-02-17
Estimated Expiration
2045-11-06

AI Technical Summary

Technical Problem

Existing methods for producing acetylated naringenin-7-O-glucoside suffer from low yield, insufficient purity, cumbersome processes, significant environmental impact, and strong dependence on plant-based raw materials, resulting in high production costs, low efficiency, and susceptibility to supply chain fluctuations.

Method used

Using the maltose-O-acyltransferase mutant MATM3, the glutamic acid at position 125 of the wild-type maltose-O-acyltransferase was mutated to alanine. Acetylated naringenin-7-O-glucoside was prepared by recombinant expression strains, and the substrate conversion efficiency was improved by using enzymatic synthesis technology.

Benefits of technology

It increased the yield and purity of acetylated naringenin-7-O-glucoside, reduced production costs, decreased environmental impact, and showed good weight loss and fat reduction effects by inhibiting adipocyte mitosis and lipid droplet accumulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065129B_ABST
    Figure CN121065129B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside and its preparation method and application in preparation of weight loss product.The maltose-O-acyltransferase mutant MATM3 of the present application, glutamic acid in the 125th position is mutated to alanine based on MAT enzyme, and the recombinant strain containing the maltose-O-acyltransferase mutant MATM3 can convert naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside, acetylated naringenin-7-O-glucoside can inhibit the mitotic clonal proliferation and lipid droplet accumulation of 3T3-L1 adipocyte, reduce triglyceride level, and play a good weight loss and fat loss effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field of mutation or genetic engineering, specifically to a maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, their preparation methods, and their application in the preparation of weight-loss products. Background Technology

[0002] Obesity and related metabolic diseases have become a global health problem. Existing lipid-lowering drugs often have side effects, so the development of natural active ingredients has attracted much attention. Naringenin and its derivatives (such as naringin and naringenin-7-O-glucoside) have potential lipid-lowering activity, but naturally occurring naringenin and its derivatives have weak lipid-lowering effects.

[0003] Furthermore, the main methods for producing acetylated naringenin-7-O-glucoside encompass chemical synthesis, fermentation, and plant extraction. However, these methods generally suffer from low yields, insufficient purity, complex processes, significant environmental impacts, and high dependence on plant-based raw materials. Low yields lead to high production costs and long production cycles, while low purity directly affects product quality and stability. Production processes typically involve multiple complex steps, increasing pollution risks and reducing overall production efficiency. In addition, some production methods have adverse environmental impacts, such as pollutant emissions or excessive consumption of non-renewable resources. Simultaneously, over-reliance on plant-based raw materials makes production susceptible to supply fluctuations, price changes, and other supply chain risks. Therefore, the production of acetylated naringenin-7-O-glucoside through enzymatic synthesis technology, if it can effectively overcome the aforementioned drawbacks, will demonstrate enormous commercial potential and environmental advantages, and is expected to become an important research direction and development hotspot in the field of biotechnology. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a maltose-O-acyltransferase mutant MATM3, acetylated naringenin-7-O-glucoside, its preparation method, and its application in the preparation of weight loss products.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a maltose-O-acyltransferase mutant MATM3, wherein the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is obtained by mutating glutamic acid at position 125 of the amino acid sequence of the wild-type maltose-O-acyltransferase shown in SEQ ID NO: 2 to alanine, and the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is shown in SEQ ID NO: 1.

[0007] Preferably, the base sequence of the maltose-O-acyltransferase mutant MATM3 gene is shown in SEQ ID NO: 3.

[0008] In a second aspect, the present invention provides a recombinant expression strain containing the maltose-O-acyltransferase mutant MATM3 described in the first aspect.

[0009] Thirdly, the present invention provides a method for preparing the recombinant expression strain of the second aspect, comprising the following steps:

[0010] S1. Obtain and amplify the gene of wild-type maltose-O-acyltransferase as shown in SEQ ID NO:4, purify the amplification product, and obtain the MAT PCR product;

[0011] S2. The purified MAT PCR product was ligated into the pMD18-T vector using double enzyme digestion technology to obtain the recombinant pMD18-T-MAT ​​vector.

[0012] S3. Transform the recombinant pMD18-T-MAT ​​vector into competent Escherichia coli DH5α, screen for positive clones, extract the plasmids of the positive clones, and digest the expression vector pET-28a with enzymes.

[0013] S4. The recombinant pMD18-T-MAT ​​vector is digested with enzymes to release the insert fragment containing the nucleotide sequence shown in SEQ ID NO:4. The insert fragment is then introduced into the digested pET-28a expression vector through a ligation reaction to obtain the pET-28a-MAT recombinant expression vector.

[0014] S5. Design site-directed mutagenesis primers. Using the pET-28a-MAT recombinant expression vector as a template, add site-directed mutagenesis primers. The maltose-O-acyltransferase mutant MATM3 is amplified by PCR to introduce the mutation site into the expression vector, resulting in the BL21 / pET-28a-MATM3 mutant enzyme expression vector containing the maltose-O-acyltransferase mutant MATM3 from the first aspect; wherein, the site-directed mutagenesis primers are used to mutate the glutamic acid at position 125 of the maltose-O-acyltransferase to alanine;

[0015] S6. The pET-28a-MATM3 mutant enzyme expression vector was transformed into competent Escherichia coli BL21 to obtain the BL21 / pET-28a-MATM3 recombinant expression strain, which is the recombinant expression strain.

[0016] Preferably, the mutation primer in step S5 is:

[0017] M3-F: GGTGCTGCGCTGGGGAAACCCGTCACCATC;

[0018] M3-R:CCCCAGCGCAGCACCGCTATTACGTGCTAC.

[0019] Fourthly, the present invention provides the application of the recombinant expression strain of the second aspect in the preparation of acetylated naringenin-7-O-glucoside, wherein the recombinant expression strain is used to convert naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside.

[0020] Fifthly, the present invention provides a method for preparing acetylated naringenin-7-O-glucoside as described in the fourth aspect, comprising the following steps:

[0021] (1) Culture and induction of strains: The recombinant expression strains from the second aspect were cultured to OD. 600 =0.6-0.8, add IPTG and induce expression at 16-20℃ to obtain the culture solution;

[0022] (2) Cell concentration and biotransformation: The cultured bacterial solution was centrifuged, the cells were collected, resuspended, and a cell solution was obtained. The substrate naringenin-7-O-glucoside, DMSO and carbon source were added and stirred to obtain a reaction solution. The wet weight of the cells in the cell solution was 50-100 mg / mL, the ratio of naringenin-7-O-glucoside to the cell solution was (0.2-0.4) mg:1 mL, the stirring temperature was 35-45℃, the stirring speed was 100-300 rpm, and the stirring time was 18-24 h.

[0023] (3) Product extraction and purification: The reaction solution was centrifuged, and the supernatant was taken. The supernatant was extracted with ethyl acetate, the solvent was removed by rotary evaporation under reduced pressure, dissolved in methanol and dried under vacuum to obtain the acetylated naringenin-7-O-glucoside.

[0024] In a sixth aspect, the present invention provides the application of the acetylated naringenin-7-O-glucoside obtained in the fourth aspect in the preparation of weight-loss health products.

[0025] Preferably, the dosage forms of weight-loss products include, but are not limited to, capsules, tablets, pills, and liquid preparations. They can also be formulated into beverages, meal replacement powders, solid beverages, oral liquids, compressed candies, etc., for use in functional foods or health foods. They can also be formulated into topical preparations, such as lotions, serums, and moisturizing creams, for use in the cosmetics field.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] The maltose-O-acyltransferase mutant MATM3 of this invention, based on the MAT enzyme, mutates glutamic acid at position 125 to alanine. This reduces steric hindrance in the side chain groups of the amino acid residues, making it easier for the substrate molecules naringenin-7-O-glucoside and acetyl-CoA to enter the active cavity and undergo acyltransferase reactions. This increases the substrate conversion number. Recombinant strains containing the maltose-O-acyltransferase mutant MATM3 of this invention can convert naringenin-7-O-glucoside to acetylated naringenin-7-O-glucoside. Acetylated naringenin-7-O-glucoside reduces triglyceride levels by inhibiting mitotic clonal proliferation and lipid droplet accumulation in 3T3-L1 adipocytes, thus achieving a good weight loss and fat reduction effect. Attached Figure Description

[0028] Figure 1 The HPLC chromatogram of acetylated naringenin-7-O-glucoside (acetylated naringenin monoglucoside);

[0029] Figure 2 The mitotic clonal proliferation efficacy of each compound in the 3T3-L1 cell model;

[0030] Figure 3 This is a comparison of the lipid-lowering activities of various compounds in the 3T3-L1 cell model. Detailed Implementation

[0031] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0032] Example 1: Preparation of BL21 / pET-28a-MATM3 recombinant expression bacteria

[0033] Table 1. All primers used in Example 1

[0034] Primer name Primer sequence (5, →3,) (lowercase parts are homologous arms) use SEQ ID NO MAT_F ATGAGCACAGAAAAAGAAAAGATG Cloning MAT fragments 5 MAT_R TTACAATTTTTTAATTATTCTGGC Cloning MAT fragments 6 28a_MAT_F caaatgggtcgcggatccgaattcATGAGCACAGAAAAA MAT homologous recombination primers 7 28a_MAT_R gagtgcggccgcaagcttgtcgacTTACAATTTTTTAAT MAT homologous recombination primers 8 M3-F GGTGCTgcgCTGGGGAAACCCGTCACCATC MATM3 mutation upstream primer 9 M3_R CCCCAGcgcAGCACCGCTATTACGTGCTAC MATM3 mutant downstream primer 10

[0035] 1. Preparation of recombinant cells with mutant enzymes

[0036] 1.1 Construction of BL21 / pET-28a-MAT recombinant expression bacteria

[0037] (1) Pick a single colony from BL21(DE3) plate, dilute it in 10 μL ddH2O and perform PCR. The reaction system is shown in Table 2.

[0038] Table 2 PCR reaction system

[0039] Contents Volume / μL <![CDATA[2xPrimeSTAR ® Max DNA Polymerase]]> 25 MAT_ F 0.5 MAT_R 0.5 bacterial solution 4 <![CDATA[ddH2O]]> 20 Total volume 50

[0040] The PCR reaction program was as follows: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 s, annealing at 47℃ for 30 s, extension at 72℃ for 1 min, for 35 cycles; final extension at 72℃ for 10 min; and final storage at 4℃.

[0041] (2) Add an equal volume of 2×M5 Taq HiFi PCR mix to the amplification product and react at 72℃ for 30 min. Detect the reaction product by agarose gel electrophoresis and perform gel extraction and purification according to the HiPure Gel Pure DNA Micro Kit instructions.

[0042] (3) The target gene as shown in SEQ ID NO:4 was constructed into the pMD18-T vector and reacted at 16℃ for 30 min. The reaction system is shown in Table 3.

[0043] Table 3 Reaction System

[0044] Contents Volume / μL DNA fragments 2 pMD18-T vector 0.5 Solution I 2.5 Total volume 5

[0045] (4) Plasmid transformation and verification: The constructed recombinant vector pMD18-T-MAT ​​was transformed into competent Escherichia coli DH5α cells, plated on LB solid medium containing Amp antibiotic, and incubated overnight at 37°C. Single colonies were picked from the culture dish after overnight incubation at 37°C, and colony PCR identification was performed before sequencing.

[0046] (5) Extract the pMD18-T-MAT ​​plasmid. Use primers 28a_MAT_F / 28a_MAT_R to perform PCR to add homologous arms to the target gene MAT. The PCR reaction system is shown in Table 4.

[0047] Table 4 PCR reaction system

[0048] Contents Volume / μL template 2 <![CDATA[2×PrimeSTAR ® Max DNA Polymerase]]> 25 28a_MAT_F 1 28a_MAT_R 1 <![CDATA[ddH2O]]> 21 Total volume 50

[0049] The PCR reaction program was as follows: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 s, annealing at 47℃ for 30 s, extension at 72℃ for 1 min, repeated 35 times; final extension at 72℃ for 10 min; and final storage at 4℃. PCR products were detected by agarose gel electrophoresis, and gel extraction and purification were performed according to the HiPure Gel Pure DNA Micro Kit instructions.

[0050] (6) The pET-28a empty vector plasmid was digested with restriction endonucleases EcoRI and SalI at 37℃ for 40 min. The PCR products were detected by agarose gel electrophoresis, and the gel was cut, recovered, and purified according to the HiPure Gel Pure DNA Micro Kit instructions. The PCR reaction system is shown in Table 5.

[0051] Table 5 PCR reaction system

[0052] Contents Volume / μL EcoRI 1.5 SalI 1.5 10xQcutbuffer 3 <![CDATA[ddH2O]]> 9 Total volume 30

[0053] (7) Connect the target gene and the vector, react at 50℃ for 30 min, and the reaction system is shown in Table 6.

[0054] Table 6 Reaction System

[0055] Contents Volume / μL Linearized vector pET-28a 2 Uniclone One Step Seamless Cloning Kit 5 Target gene 2 <![CDATA[ddH2O]]> 1 Total volume 10

[0056] Following the steps in (4), the recombinant vector pET-28a-MAT was transformed into the expression strain BL21(DE3).

[0057] (8) Verification and sequencing: Transformant detection was performed according to the steps in (5), and positive single colonies were sequenced to confirm the BL21 / pET-28a-MAT recombinant expression bacteria.

[0058] 2.2 Construction of BL21 / pET-28a-MATM3 recombinant mutant expression bacteria

[0059] The expression vector pET-28a-MAT in section 2.1 was point-mutated, replacing glutamic acid at position 125 with alanine. The mutation primers are shown in Table 1. The PCR (25 μL) amplification system was as follows: 12.5 μL of 2×Primer Star, 1 μL of primers, 2 μL of template plasmid, and ddH2O added to a final volume of 25 μL. PCR amplification conditions: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s; 63℃ annealing for 30 s; 72℃ extension for 90 s; 35 cycles; 72℃ extension for 10 min; storage at 4℃. After PCR, 3 μL of the amplified product was analyzed by nucleic acid gel electrophoresis. The target band was clear. The remaining product was added to 0.5 μL of Dpn I restriction enzyme and incubated at 37℃ for 1 h to digest the template DNA. After the reaction, the cells were transformed into BL21 competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and cultured overnight at 37℃. Single colonies were selected to obtain mutant transformants. Following step 2.1, the BL21 / pET-28a-MATM3 recombinant mutant expression strain was obtained. The amino acid sequence of the MATM3 mutant is shown in SEQ ID NO:1, and the nucleotide sequence is shown in SEQ ID NO:3.

[0060] Example 2: Preparation of acetylated naringenin-7-O-glucoside

[0061] Seed culture and fermentation induction

[0062] Culture medium preparation:

[0063] Prepare 2L LB liquid culture medium, dispense into 4 1L Erlenmeyer flasks (500 mL each), sterilize at 121℃ for 20 min, cool to room temperature, add 500 μL kanamycin stock solution (final concentration 0.1 mg / mL) to each Erlenmeyer flask, mix well and set aside.

[0064] Single colony inoculation and pre-culture:

[0065] Inside the clean bench, pick one single colony and add it to 20 mL of LB+KAN medium as the primary seed culture. Inoculate the primary seed culture at 1% into 2 L of LB+KAN liquid medium (divided into four 500 mL portions). Incubate at 37℃ and 200 rpm for 3-4 h using a shaker. Take samples and measure the OD600 using a spectrophotometer until the OD600 reaches 0.7.

[0066] IPTG-induced expression:

[0067] Add IPTG stock solution to each conical flask (calculated at a final concentration of 0.02 mM: 10 μL of 1M IPTG is needed for 500 mL of culture medium), mix gently, and incubate at 20°C and 150 rpm for 17 h.

[0068] 3. Centrifugation and concentration of bacterial cells:

[0069] Bacterial cell centrifugation:

[0070] After induction, the fermentation broth in the four conical flasks was centrifuged at 6000 rpm for 10 min, the supernatant was discarded, and the bacterial precipitate was collected.

[0071] concentrate:

[0072] Resuspend the cells in phosphate buffer at a 5:1 concentration ratio: resuspend the cells corresponding to 500 mL of the original fermentation broth in 100 mL of phosphate buffer (400 mL of phosphate buffer is required for 2 L of fermentation broth), and vortex until there is no obvious precipitation.

[0073] 4. Substrate preparation and reaction initiation:

[0074] Weigh 120 mg of naringenin monoglucoside and dissolve it in 1 mL of DMSO. Add glucose (final concentration 35 mM, 2.52 g glucose is required for a 400 mL system) to the resuspended bacterial cell solution (wet weight 60 mg / mL, 400 mL). Stir to dissolve and then add the above substrate-DMSO solution. Mix gently and react in a shaker at 40 °C and 200 rpm for 20 h.

[0075] 5. Product extraction and detection

[0076] Centrifugation and sampling of the reaction solution:

[0077] After the reaction was completed, 400 mL of the reaction solution was dispensed into 50 mL centrifuge tubes and centrifuged at 8000 rpm for 10 min at 4 °C. The supernatant was collected, and 1 mL of the supernatant was filtered through a 0.22 μm filter membrane and labeled as “reaction solution sample” for liquid chromatography detection.

[0078] Ethyl acetate extraction:

[0079] The remaining supernatant was transferred to a 1 L separatory funnel, an equal volume of ethyl acetate was added, the mixture was shaken, and extracted twice. After extraction, the ethyl acetate phase was collected.

[0080] 6. Concentration and drying:

[0081] The ethyl acetate phase was transferred to a rotary evaporator and dried under reduced pressure. The white solid remaining after rotary evaporation was dissolved in methanol (chromatographic grade). Finally, the mixture was dried in a vacuum drying oven (to avoid methanol residue) to obtain the crude extract.

[0082] 7. Liquid chromatography:

[0083] The dried crude extract was dissolved in methanol, filtered through a 0.22 μm filter membrane, and loaded onto a liquid chromatograph. The crude extract was compared with the standard to confirm that it was acetylnaringenin-7-O glucoside and its purity.

[0084] Example 3: Evaluation of lipid-lowering effect

[0085] 1. Instruments and Reagents: Analytical balance, clean bench, cell culture incubator, microplate reader, mouse embryonic fibroblasts (3T3-L1), DMEM high-glucose medium, trypsin, serum, penicillin and antibiotics, anti-mycoplasma clearance reagent, PBS, 48-well plates, differentiation induction medium components (isobutyl-methyl-xanthine, dexamethasone, insulin), 4% paraformaldehyde, isopropanol, Oil Red O, ultrapure water, trichloroacetic acid, acetic acid, sulfonylrhodamine B, Tris-Base

[0086] Test methods

[0087] Test substance preparation

[0088] Prepare a stock solution of the test substance to 100 mM using dimethyl sulfoxide (DMSO). Dilute with culture medium according to the actual drug concentration. The concentration of the solvent in the test solution should not exceed 0.5%.

[0089] The lipid-lowering activities of naringin, naringenin-7-O-glucoside (referred to as "naringenin monoglucoside"), acetylated naringenin monoglucoside, and naringenin were determined using a 3T3-L1 cell model.

[0090] 2. Cocktail method for inducing differentiation of 3T3-L1 cells

[0091] 3T3-L1 cells cultured in high-glucose DMEM medium containing 10% newborn calf serum (NBS) were cultured at 5.0 × 10⁶ cells / year. 4 Cells were evenly seeded in 48-well plates, and the medium was replaced with high-glucose DMEM containing 10% fetal bovine serum (FBS). The cells were then placed in a cell culture incubator and cultured statically. The medium was changed every 3 days until the cells were completely confluent (Day 0), which caused cell growth to stop and facilitated the differentiation stage.

[0092] Once the cells were fully fused, the non-differentiation group (Blank) was replaced with high-glucose DMEM medium containing 10% FBS, the differentiation-inducing control group (Ctrl) was replaced with differentiation induction solution I (0.5 mM isobutyl-methyl-xanthine, 1 μM dexamethasone, 10 μg / mL insulin), and the compound group (Compd.) was treated with differentiation induction solution I diluted to the corresponding concentration. The cells were then incubated statically in an incubator for 3 days (Day 3), which is the differentiation induction phase (Day 0-3). During this period, the cells underwent mitotic clonal proliferation, the number of cells increased, the cell morphology became shrunken, and small lipid droplets were sporadically visible in some areas.

[0093] Three days later, the Blank group was replaced with high-glucose DMEM medium containing 10% FBS, the Ctrl group was replaced with differentiation induction solution II (10 μg / mL insulin), and the compound group was diluted with differentiation induction solution II to the corresponding concentration. They were then cultured statically in the incubator for another 3 days (Day 6), which is the differentiation induction stage (Day 3-6). At this time, the cells began to generate a large number of lipid droplets. Cells with vigorous lipid droplet growth became rounder and less attached to the wall, and had a three-dimensional appearance.

[0094] Three days later, the Blank and Ctrl groups were replaced with high-glucose DMEM medium containing 10% FBS (differentiation induction solution III). The compound group was diluted with differentiation induction solution III to the corresponding concentration and continued to be cultured statically in the incubator for 3 days (Day 9), which is the differentiation induction stage III (Day 6-9). At this time, lipid droplets accumulated in the cells, which is the terminal differentiation stage of 3T3-L1 cells.

[0095] Cells differentiated to day 9 were fixed with 4% paraformaldehyde and stained with Oil Red O for lipid quantification.

[0096] 3. Oil Red O staining and quantification

[0097] Carefully discard the culture medium, add 200 μL / well of 1×PBS for washing, discard the 1×PBS, gently add 100 μL / well of 4% paraformaldehyde, and fix at room temperature for 30 min. Discard the fixative, add 100 μL / well of 60% isopropanol for rinsing, discard the fixative, then add 100 μL / well of Oil Red O working solution, and stain at room temperature in the dark for 30 min. Discard the staining solution, wash away the staining solution with ultrapure water, repeat 2-3 times. Discard the ultrapure water, add 100 μL / well of 60% isopropanol, and wash slowly with shaking for 5 min in the dark until no floating color remains. Discard the washing solution, place in a fume hood to dry, add 100 μL / well of isopropanol for extraction, seal tightly with sealing film, and shake rapidly for 5 min. Take 80 μL / well of the extract into a 96-well plate and measure the absorbance at 510 nm (including the OD (None) of the empty well plate) to calculate the lipid-lowering rate or triglyceride level.

[0098]

[0099]

[0100] Example 4: Cytotoxicity Detection

[0101] Cells that have undergone Oil Red O quantification in 48-well plates (before refixation, thoroughly wash away Oil Red O dye with excess isopropanol and evaporate the solvent) are fixed with 100 μL / well of 10% trichloroacetic acid at room temperature for 1 h. The fixative is discarded, and the cells are washed three times with 200 μL / well of dimethyl aqueous solution and dried at room temperature. 50 μL / well of 0.4% SRB is added, and the cells are stained in the dark for 30 min. The staining solution is discarded, and the cells are washed at least three times with 200 μL / well of 1% acetic acid until no obvious staining remains. The cells are dried at room temperature. 50 μL / well of 10 mM Tris-Base is added to dissolve the SRB, and the cells are shaken for 5–10 min. The absorbance is measured at 515 nm, and the cytotoxicity or mitotic clonal proliferation efficacy (MCE) is calculated. When the MCE efficiency is close to 100%, it indicates that the compound does not affect the normal mitotic clonal proliferation process of 3T3-L1 cells. When the MCE efficiency is less than 0, it indicates that the compound not only inhibits the normal mitotic clonal proliferation process of 3T3-L1 cells, but also has toxicity to the background cells.

[0102]

[0103]

[0104] result

[0105] Preparation results of acetylargine monoglucose

[0106] from Figure 1 As can be seen from the liquid phase diagram, under the preparation method of Example 1 above, naringenin monoglucan was converted into acetylated naringenin monoglucan, and the content of acetylated naringenin monoglucan was 85%.

[0107] lipid-lowering effect and cytotoxicity test

[0108] like Figure 2 As shown, among naringin, naringenin monoglucan and naringenin, naringenin, as an aglycone, has better lipid-lowering activity and is concentration-dependent. However, high concentrations (400 μM) of naringenin have certain cytotoxicity and can damage the baseline cell count. Low concentrations (100 and 200 μM) of naringenin mainly exert lipid-lowering activity by inhibiting the mitotic clonal proliferation of 3T3-L1 cells.

[0109] Depend on Figure 3It can be seen that naringenin monoglucan has weak lipid-lowering activity, with a lipid-lowering rate of 15.79% at 100 μM, 10.52% at 200 μM, and 24.09% at 400 μM. Acetylated naringenin monoglucan improved the lipid-lowering activity, with a lipid-lowering rate of 43.84% at 100 μM, 32.53% at 200 μM, and 80.47% at 400 μM. At the same concentration (from low to high), the lipid-lowering rate of acetylated naringenin monoglucan was 2.78 times, 3.09 times, and 3.34 times that of naringenin monoglucan, respectively.

[0110] The results above show that naringin monoglucan has relatively weak lipid-lowering activity, but acetylated naringin monoglucan significantly enhances this activity. Furthermore, it exhibits no cellular toxicity at high concentrations. Therefore, it shows great potential for development in the preparation of weight-loss products.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of a recombinant expression strain, characterized in that The recombinant expression strain is used for converting naringenin-7-O-glucoside into acetylated naringenin-7-O-glucoside, and the recombinant expression strain contains a maltose-O-acyltransferase mutant MATM3, the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is obtained by mutating glutamic acid at position 125 of the wild-type maltose-O-acyltransferase (MAT) amino acid sequence shown in SEQ ID NO: 2 into alanine, the amino acid sequence of the maltose-O-acyltransferase mutant MATM3 is shown in SEQ ID NO: 1, and the base sequence of the maltose-O-acyltransferase mutant MATM3 gene is shown in SEQ ID NO: 3; wherein the host cell of the recombinant expression strain is a competent expression Escherichia coli BL21.

2. Use of a recombinant expression strain according to claim 1, characterized in that The preparation method of the recombinant expression strain comprises the following steps: S1, obtaining and amplifying the gene of the wild-type maltose-O-acyltransferase shown in SEQ ID NO: 4, purifying the amplification product to obtain a MAT PCR product; S2, using double enzyme digestion technology to connect the purified MAT PCR product into a pMD18-T vector to obtain a recombinant pMD18-T-MAT vector; S3, transforming the recombinant pMD18-T-MAT vector into a competent Escherichia coli DH5α, screening positive clones, extracting the plasmid of the positive clones, and performing enzyme digestion treatment on the expression vector pET-28a; S4, performing enzyme digestion on the recombinant pMD18-T-MAT vector to release an insert fragment containing the nucleotide sequence shown in SEQ ID NO: 4, introducing the insert fragment into the enzyme-digested pET-28a expression vector through a ligation reaction to obtain a pET-28a-MAT recombinant expression vector; S5, designing a site-directed mutation primer, taking the pET-28a-MAT recombinant expression vector as a template, adding the site-directed mutation primer, and introducing a mutation site into the expression vector through PCR amplification of the maltose-O-acyltransferase mutant MATM3 to obtain a BL21 / pET-28a-MATM3 mutant enzyme expression vector containing the maltose-O-acyltransferase mutant MATM3 of claim 1; wherein the site-directed mutation primer is used for mutating glutamic acid at position 125 of the maltose-O-acyltransferase into alanine; S6, transforming the pET-28a-MATM3 mutant enzyme expression vector into a competent expression Escherichia coli BL21 to obtain a BL21 / pET-28a-MATM3 recombinant expression strain, which is the recombinant expression strain.

3. Use of a recombinant expression strain according to claim 2, characterized in that The mutation primer in the preparation step S5 of the recombinant expression strain is: M3-F: GGTGCTGCGCTGGGGAAACCCGTCACCATC; M3-R: CCCCAGCGCAGCACCGCTATTACGTGCTAC.

4. A process for the preparation of acetylated naringenin-7-O-glucoside, characterized in that, The method comprises the following steps: (1) Strain culture and induction: the recombinant expression strain of claim 1 is cultured to OD 600 =0.6-0.8, IPTG is added to induce expression at 16-20℃, and the culture liquid is obtained; (2) Bacterial body concentration and biological transformation: centrifuging the culture liquid, collecting bacterial bodies, resuspending to obtain a bacterial body solution, adding a substrate naringin-7-O-glucoside, DMSO and a carbon source to perform stirring reaction to obtain a reaction liquid; wherein the wet weight of the bacterial bodies in the bacterial body solution is 50-100 mg / mL, the ratio of naringin-7-O-glucoside to the bacterial body solution is (0.2-0.4) mg:1 mL, the stirring reaction temperature is 35-45℃, the stirring speed is 100-300 rpm, and the stirring time is 18-24 h; (3) Product extraction and purification: centrifuging the reaction liquid, taking the supernatant, extracting the supernatant with ethyl acetate, removing the solvent by rotary evaporation under reduced pressure, dissolving in methanol and vacuum drying to obtain the acetylated naringin-7-O-glucoside.

5. Use of acetylated naringenin-7-O-glucoside in the preparation of a health care product for reducing fat, characterized in that, The acetylated naringin-7-O-glucoside is prepared by the preparation method of the acetylated naringin-7-O-glucoside according to claim 4.

Citation Information

Patent Citations

  • Method for enzymatic synthesis of acetyl coenzyme A by using diacerein donor

    CN116348606A

  • Acetyltransferase mutant and application thereof

    CN116656643A