Infectious clone expression vector pBCMV-DY9 of bean common mosaic virus as well as construction method and application of infectious clone expression vector pBCMV-DY9
By inserting introns into the HC-PRO and CI regions of common bean mosaic virus, and constructing the pBCMV-DY9 vector using seamless cloning and homologous recombination technology, the problems of genetic stability and operational difficulty of infectious cloning vectors of common bean mosaic virus were solved, enabling efficient virus expression and research applications.
Patent Information
- Application Number
- CN202511212159.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2025-12-05
AI Technical Summary
Existing technologies make it difficult to construct stable and efficient infectious cloning vectors for common bean mosaic virus, especially since its genome is large and contains prokaryotic promoter-like elements, which leads to the expression of toxic proteins in prokaryotes, affecting the genetic stability of the clone and increasing the difficulty of operation.
Using seamless cloning and homologous recombination technology, introns were inserted into the HC-PRO and CI regions of common bean mosaic virus to construct the infectious cloning expression vector pBCMV-DY9. Fragment fusion and recombination were performed using overlap PCR technology to ensure the genetic stability and expression efficiency of the vector.
Genetic stability and expression efficiency of common bean mosaic virus in the host system were achieved, supporting further research on the virus-host interaction mechanism.
Smart Images

Figure CN121065262A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of genetic engineering, and in particular to a bean common mosaic virus (BCMV) infectious clone expression vector pBCMV-DY9 and a construction method and application thereof. BACKGROUND
[0002] Bean common mosaic virus (BCMV) belongs to the Potyvirus genus of the Potyviridae family and is distributed worldwide. In 1917, Stewart and Reddick isolated a virus causing bean mosaic from a bean plant; in 1934, Pierce officially named the virus BCMV. Since its discovery in 1917, the occurrence and distribution of BCMV in many regions of the world have been reported by many studies. BCMV has various transmission modes, mainly through seed, mechanical inoculation and various aphids in a non-persistent manner, and has a wide host range. It is one of the most harmful viruses that can naturally infect legume plants, and bean (Phaseolus vulgaris) is its main host. BCMV can cause symptoms such as mosaic, deformation, yellowing, growth retardation and even local or systemic necrosis and even plant death after infecting beans.
[0003] BCMV has high variability and frequent intra- and inter-species recombination, resulting in a large number of strains. At present, many BCMV isolates of different geographical origins have been reported at home and abroad, and a lot of whole genome sequence information of the isolates has been obtained. However, the means of classification and identification of BCMV strains at home and abroad have not been unified. Biological characteristics on differential hosts, serological reactions, reverse-phase high-pressure liquid chromatography (HPLC) peptide maps and molecular biology methods have all been used as the basis for distinguishing BCMV strains. In terms of pathogenic type classification, BCMV isolates are divided into eight pathogenic types according to their differences in response to 12 to 14 bean plants carrying known resistance gene combinations. Among them, PGI to PGVII are divided by Drijfhout et al., and PG VIII is identified by Feng et al. Among them, the RU1 isolate has been reported to be described as a BCMV strain with pathogenic type PGVI, and the main members of pathogenic types PGIII and PGVI are bean common mosaic necrosis virus (BCMNV). BCMNV and BCMV are closely related viruses of the same genus.
[0004] Plant virus full-length cDNA infectious clone is an essential reverse genetics tool in plant virus research. At present, researchers have successfully constructed a variety of virus infectious clone vectors with high efficiency and strong pathogenicity, and widely applied to the research of pathogenesis analysis and disease-resistant variety screening. For the construction of Potyvirus infectious clone, due to the large genome (about 10 kb) and complex structure of the family, there are prokaryotic promoter-like elements in the genome, which will guide the expression of toxic products when propagated in prokaryotes, and have obvious toxicity to the growth of prokaryotes. Therefore, it is easy to recombine with the sequence of prokaryotic bacteria itself or other foreign genes, resulting in plasmid instability or loss of clone activity, thereby increasing the difficulty of constructing infectious clone. In order to cope with these challenges, scholars have studied a variety of strategies, including the use of low copy number vectors, intron insertion, yeast homologous recombination and in vitro ligation before inoculation. At present, although the virus infectious clone technology has made significant progress, the establishment of a universal cloning strategy is still a technical bottleneck to be overcome in this field. At the same time, for Potyvirus with complex genome structure, the construction of infectious clone faces double technical challenges: on the one hand, the genome length of about 10 kb significantly increases the difficulty of cloning operation; on the other hand, the expression of toxic proteins driven by the hidden promoter in the genome leads to genetic instability of the intermediate clone in the E. coli system. In the previous study, the inventors found that the insertion of intron in P3 gene solved the problem of genetic stability in the host system, but led to the failure of the virus to complete gene expression and infection process in the tobacco host. SUMMARY
[0005] Therefore, the application provides a bean common mosaic virus infectious clone expression vector and a construction method and application thereof to solve the above problems.
[0006] In order to achieve the above application purposes, the application provides the following technical solutions.
[0007] The application provides a bean common mosaic virus infectious clone expression vector pBCMV-DY9, and the nucleotide sequence of the vector is shown as SEQ ID NO. 50.
[0008] The application further provides a preparation method of the bean common mosaic virus infectious clone expression vector pBCMV-DY9, including the following steps.
[0009] S1. Extracting the RNA of the bean common mosaic virus, and obtaining the full-length cDNA sequence of the bean common mosaic virus by RT-PCR;
[0010] S2. Using cDNA of bean common mosaic virus BCMV-DY9 as a template, and using pDY9-5'F / DY9-2431-Intron-R, DY9-Intron-2431-F / DY9-4240R, DY9-Intron-4240F / DY9-7228R and DY9-7203F / pDY9-3'R as primers, fragments with lengths of 2473 bp, 1829 bp, 2989 bp and 2834 bp are amplified, which are fragment I, fragment II, fragment III and fragment IV in sequence;
[0011] S3. Using overlap PCR technology, fragment I and intron 2 are fused and amplified to obtain fusion product 1;
[0012] S4. Using ClonExpress MultiS recombination reaction system, fusion product 1, fragment II and linearized vector pCB301 are used to construct a first subclone pBCMV-DY9-3A;
[0013] S5. Using overlap PCR technology, intron 1 and the first subclone pBCMV-DY9-3A are fused and amplified to obtain fusion product 2;
[0014] S6. Using homologous recombination, fusion product 2, fragment III, linearized vector pCB301 are used to construct a second subclone pBCMV-DY9-3B;
[0015] S7. Using seamless cloning, fragment IV, the second subclone pBCMV-DY9-3B and linearized vector pCB301 are recombined to obtain pBCMV-DY9 full-length clone.
[0016] Preferably, the nucleotide sequences of the primer pair pDY9-5'F / DY9-2431-Intron-R are shown in SEQ ID NO. 46 and SEQ ID NO. 47; the nucleotide sequences of the primer pair DY9-Intron-2431-F / DY9-4240R are shown in SEQ ID NO. 48 and SEQ ID NO. 49; the nucleotide sequences of the primer pair DY9-Intron-4240F / DY9-7228R are shown in SEQ ID NO. 42 and SEQ ID NO. 43; and the nucleotide sequences of the primer pair DY9-7203F / pDY9-3'R are shown in SEQ ID NO. 44 and SEQ ID NO. 45.
[0017] Preferably, the nucleotide sequence of intron 1 is shown in SEQ ID NO. 30; and the nucleotide sequence of intron 2 is shown in SEQ ID NO. 31.
[0018] Preferably, the insertion site of intron 1 is the 4240 site of the CI gene; the insertion site of intron 2 is the 2431 site of the HC-PRO gene.
[0019] Preferably, the linearized vector pCB301 is obtained by using the pCB301-2F and pCB301-1R primers to amplify the pCB301 carrier plasmid as a template.
[0020] The application also provides a kind of agrobacterium with bean common mosaic virus infectious clone expression vector pBCMV-DY9, which is transformed into agrobacterium by the bean common mosaic virus infectious clone expression vector pBCMV-DY9.
[0021] The application also provides the application of the bean common mosaic virus infectious clone expression vector pBCMV-DY9 in the research of the bean common mosaic virus.
[0022] By adopting the above technical scheme, the application has the following beneficial effects: the application inserts intron in the AG-GT region of HC-PRO (2431) and CI (4240), thereby constructing pBCMV-DY9, and the full-length sequence of the bean common mosaic virus infectious clone expression vector pBCMV-DY9 is shown in SEQ ID NO. 51. The bean common mosaic virus infectious clone expression vector constructed by using seamless cloning, homologous recombination and other methods will contribute to the research on the mechanism of virus-host interaction at the molecular level. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 The schematic diagram for constructing the bean common mosaic virus infectious clone expression vector pBCMV-DY9.
[0024] Figure 2 The bean disease sample infected with BCMV virus, small RNA sequencing results and RT-PCR verification results, wherein A is a bean disease sample infected with BCMV virus; B is the Cleanreads sequence length distribution of five mixed samples obtained from high-throughput siRNA deep sequencing analysis, and different colored columns represent different length reads (ranging from 15 nt to 34 nt); C is the verification result of virus RT-PCR in a single sample.
[0025] Figure 3 The phylogenetic tree of nucleotides and amino acids constructed using the complete genome sequences of BCMV-DY9 and other related viruses; wherein A is the phylogenetic tree of nucleotide sequences of BCMV-DY9 and other related viruses based on the adjacent connection method; B is the phylogenetic tree of amino acid sequences of BCMV-DY9 and other related viruses based on the adjacent connection method.
[0026] Figure 4 Strategy for constructing the BCVM infectious clone containing introns; wherein A is the schematic diagram of the BCVM-DY9 genome structure and the strategy for inserting introns at different positions; B is the strategy for segmentally amplifying the bean common mosaic virus (BCMV) genome for constructing the infectious clone pBCMV-DY9.
[0027] Figure 5 Verification results for detecting the biological activity of Nicotiana benthamiana plants inoculated with wild type and recombinant BCMV-DY9 clones; wherein A is the RT-PCR detection results of pBCMV-DY9 in tobacco leaves after 2 weeks of inoculation; B is the expression results of the CP gene in tobacco leaves infected with wild type BCMV-DY9 and pBCMV-DY9 after 2 weeks and 6 weeks of infection by qPCR analysis; C is the results of western blot analysis of BCMV protein in plants specific to anti-BCMV CP protein; D is the virus particles observed in the systemic leaves of N. benthamiana infected with BCMV under a transmission electron microscope.
[0028] Figure 6 Symptoms and RT-PCR detection results of beans inoculated with BCMV; wherein A is the RT-PCR detection results chart of bean leaves inoculated with BCMV for 3 weeks; B is the symptom chart of infected plants inoculated with BCMV; C is the symptom chart of non-infected plants inoculated with BCMV. DETAILED DESCRIPTION
[0029] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.
[0030] The kits or reagents used in the present application are shown in Table 1.
[0031] Table 1 Reagents and kits
[0032]
[0033]
[0034] All primers of the present application are synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.
[0035] Example 1. Construction of a bean common mosaic virus infectious clone expression vector
[0036] 1. Sample collection
[0037] In the National Characteristic Coarse Grain Crop Germplasm Repository of Shanxi Province, 20 samples of beans suspected to be infected with BCMV showing symptoms such as leaf curling, wrinkling, and yellowing were collected. Figure 2A) in which 8 parts of beans, 4 parts of cowpea, 4 parts of red beans and 4 parts of green beans were mixed. The field collected samples were promptly frozen in dry ice, and then brought back to the laboratory and stored in a -80°C ultra-low temperature refrigerator for standby use.
[0038] 2. Small RNA sequencing and splicing
[0039] The collected 4 kinds of beans were mixed as one group with 4 sample numbers, and divided into groups I-V. After the RNA was extracted by Trizol method, the samples were entrusted to Beijing Baimaikes Technology Co., Ltd. for small RNA sequencing. The results are shown in Table 2. The diseased leaf samples produced 96526571 reads, and after filtering, 88008021 high-quality reads between 18-35 nt were obtained, accounting for about 91.17% of the total sRNA reads. The proportion of Clean reads of 21 nt small RNA in the 5 samples was the highest. Figure 2 The length distribution of the obtained small RNA shows that the sequencing and splicing quality is reliable.
[0040] The sRNA of 18-35 nt was sequenced and spliced by using Velvet software, and the k-mer value was set to 17. The contigs were obtained and compared and screened by virus database, and the effective contigs were mainly compared with the genome sequences of BCMV and CMV. The number of effective contigs of BCMV and CMV in the 5 mixed samples is shown in Table 2. The results of small RNA sequencing and overlapping group annotation information of the mixed samples are shown in Table 2.
[0041] Table 2: Summary of small RNA sequencing results and number of effective contigs of BCMV and CMV in mixed samples
[0042]
[0043] The results show that, except for the cowpea sample, the number of contigs of CMV and BCMV is similar, and in other mixed samples, the number of effective contigs of BCMV is significantly higher than that of CMV, indicating that BCMV is the main viral population on field legume crops.
[0044] 3. RT-PCR
[0045] In order to further verify the accuracy of the small RNA sequencing results and the virus carrying situation of individual plants, specific primers were designed by using the spliced BCMV and CMV contigs sequences (Table 3), and RT-PCR was performed on the collected individual samples.
[0046] Table 3: RT-PCR primers
[0047] Primer name Primer sequence Sequence number CMV1-F CCGAACTCATTCGACATTG SEQ ID NO. 1 CMV1-R CCATCGGTAACAGCCTGCG SEQ ID NO. 2 CMV2-F CTGTGGATGTCAGCGAGAGT SEQ ID NO. 3 CMV2-R ATACGTTCTCGAAGGCATC SEQ ID NO. 4 CMV3-F CATCTATTACCCTAAAGCC SEQ ID NO. 5 CMV3-R CCACGACTGACCATTTTAGC SEQ ID NO. 6 BCMV-det-F CGGTAGAAGGCAATCTC SEQ ID NO. 7 BCMV-det-R GCACAGATTCTCCGCATCC SEQ ID NO. 8
[0048] Total RNA was extracted from leaves using the Trizol method, and cDNA was synthesized using the Biomed M-MLV4 First-Strand cDNA Synthesis Kit. PCR amplification was then performed using the Real-Times Taq DNA Polymerase Kit. All procedures were strictly performed according to the kit instructions.
[0049] RT-PCR results showed that samples 19 / 20 were all infected with a mixture of BCMV and CMV. Figure 2 Of the samples tested (C), only the DY9 sample did not show any CMV detection. Subsequent tests for other common field viruses (SMV, BYMV, and CABMV) on this sample were all negative, further confirming that the DY9 sample was independently infected by BCMV. This sample was named BCMV-DY9 and propagated on Nicotiana benthamiana for subsequent studies.
[0050] 4. BCMV whole genome sequencing
[0051] To obtain the full-length viral genome sequence, BCMV-specific primers (Table 4) were designed to amplify the genomic RNA of the DY9 isolate in segments (a total of 9 fragments).
[0052] Table 4. RT-PCR-specific primers for detecting BCMV-DY9 strain
[0053]
[0054] Each target fragment is 1000bp to 2000bp in length, and adjacent fragments are designed with overlapping regions to ensure subsequent sequence assembly. The 3' end sequence is amplified by RT using N1T primers, followed by PCR amplification using N1 primers combined with F primers to obtain the complete 3' end sequence; the 5' end sequence is amplified using a 5' RACE kit (Accurate), and the product is cloned into... -T Easy vector (Promega). The target band of the amplified or cloned product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared with the sequences reported in the GenBank database using BLAST. The sequencing results of the entire DY9 genome (including the 5' / 3'-UTR) were assembled using SeqMan software. Open reading frames were predicted using ORFFinder and SanpGene to obtain the complete genome sequence of common bean mosaic virus BCMV-DY9, which is 10,022 nucleotides in length and encodes 3,319 amino acids.
[0055] AATTAAAACAACTCGAAAAGACACATACAGACACAACGCGACTAAAACTCTCTTTCAACTTTCAACAACTTTTCACTCAATCATTGTT
[0056] CAGTTACAACTTTCAAATCTCACTTCTTTCTTCCCGTTATCTCAACAGACCAATGGCTTCAATTATGATTGGCACAATCACTGTACCGCTCGC
[0057] TGGATACGAATGTAACTATAAGGATGTTGAAGAGCTCATAGAAGTTGAGACACAAGAGCGTGTCTATATAAACCCGAAACCTACCTCTGCA
[0058] CGAAAGCGGAACCTGTGCTTTTGTGACGATGATGATGATGGCCACTACCACTGCCACTTTTGTGATTGTGAGTGTGATTCCAAGAATCATT
[0059] TGGAAGAACACGAACGCGATATTTGTGAAGACGCATATTCAGTGCGTGCATTTGGGTACAAGCTGGTTCCAAGGATTGAAATTAAAAAGA
[0060] TCATCAAGAGAGTACCATGTGTAGCCACTAAAATAGTGCAACCAATGGTGGTTGCAACTCCCAAAAATAATGTCTGCGAAACCGCTGTGC
[0061] AGACAAAGGTGGCAAACAACGTTGTCACTAAAGATATGATGGCGAAATCTGGGCCATCATTGAAGCAAATCAGCCGTGCTCTAGTGCTGG
[0062] CTGGTAGGAAGGAAGTTATTAACTATAACTTGGCCACCAAAAGGATGGATGATGCGATGAACCAAAACTCTGCACTCCAAAGAAGGCTGT
[0063] TCATTCAACAGCATAGTACCATTAAACAGCAACCTAAGGGGGCTGTTCAGCTGAATTTGTGCTCGTATGAGCAAGCAAAGGAACGCGTTA
[0064] AATTGGCACGTAAGAAGCATGAAGAAGAAGAGGCTTTTCTTCAAGGAACGTATGAACAGAAGGAATACATCGGCAAAGTGCTGGAGCCG
[0065] ATGGCTATTCAAAGAGGACAGAGCATTGGTTTCAAGAGCCCCTACTGGCATAGGAGCTTTAAGAAATCGACCAACAATCCACCTAGGAGG
[0066] AAGGTGGAACCACCAACAAGAGTATTACGCGAAATTCTGAGCGTGATACGTGACAAGGGTGTGAGCATTGAATTCATTGGTCGTGGAACA
[0067] AAAAGACTCACAGCCCGATACGTGAGTAAAGGCAGCTCTGTGATCCCAAAGGTCATCTTGCCACATGAAAATGGTAAATACAAGAAGCAG
[0068] GAACTGGACATCAATCTTTACAAGCAATGTCTAGCAGCTTTGTGCGCACATGGCACATATAGACATTTGAACAATGGAGAGATTAAGCCAG
[0069] GAGACAGTGGACTAGTATTTGATAAGAGGTCATCTCTCACAGCTGATCACACTCAACGGCCTTTCATGATCATTAGAGGGAGACTGAATGG
[0070] AAAGTTGGTAAATGCACTAGATGAACAGCAGGATATTTACTCAATCCACCACTATTCCCAGAGTCCTGAATTACAATTCTTTAGTGGGTGGC
[0071] GTGACAAGTTCAACAAGCTGGTTCCGCACGTTCAACAGCATGATTGTAGCGTCAGTTTTGATAATGAGCAGTGTGGGCAGTTTGCTGCTAT
[0072] TATGAGCCAAATGCTTTATCCAGTTAAGAAATTGTCTTGTATCCAATGCAGACAACACATTCAATCTTTGAGCTGGGATGAGTATAGGCAAT
[0073] TGATAGCTGCGAATATTGGTTGTCATGAGAGCACCCTAAGTGAATCTAATAGCATTATGGGCTTAGACATGGTTCGAAAGCTTGTTGAACGA
[0074] GCCACCAGTGAAAATTTGAATTTGACAACATCAATGGAAATTATGAAGTTAACTCACAACAATAAAAGTACAGTGATGTTACAGATTCAGG
[0075] ATATTAACAAAGCCCTTATGAAAGGCTCATCAGTGACGCAGGAAGAGTTGGATTTGGCTCTAGAGCAACTGCTACGAATGACACAGTGGT
[0076] GGAAGAATCACATGAGTTTGACAGAGGCTGATCCATTGAAAACTTTCAGAAACAAGAGGTCATCAAAAGCCCTATTGAATCCAAGTTTGT
[0077] TGTGTGATAACCAACTGGATAAGAACGGCAACTTCATATGGGGTGAGAGAGGATATCATTCAAAAAGATTCTTTTCAAACTTCTTTGATGA
[0078] GGTCATTCCTTCAGAGGGTTACAGCAAGTACAGGATCAGGAGAAATCCTAACGGGCAAAGAGAGTTAGCCATTGGATCACTAATAGTTCC
[0079] TTTGAGCCTGGAGCGTGCGCGTGCTGCTTTGCAGGGCAAATGTATTGAAACTGTTCCACTAACTCAAGCATGTATTTCAAGACAAAATGGT
[0080] AACTTTGTTTATCCCTGTTGTTGTGTCACACTGGATGATGGAACACCAATGTATTCAGAACTCAAGAGTCCAACCAAGAGGCACCTCGTGG
[0081] TTGGTACGTCTGGGGACCCAAAGTATATTGATCTTCCACAAAATGATGAGGATAGAATGTATATTTCAAAGGAAGGTTACTGTTATCTGAAT
[0082] GTTTTCTTGGCCATGCTTGTGAATGTCAATGAGAAAGAAGCAAAGGACTTCACTAAGATGGTCAGAGATGTCATTATACCAATGCTTGGAA
[0083] CTTGGCCTACAATGCAGGATCTTGCTACAGCAGTTTATATTCTTACAGTGTTTCATCCAGAAACAAGGAATGCTGAATTGCCTCGCATACTT
[0084] GTTGACCACACAAGTCAGACTATGCACGTGATAGACTCATTTGGATCCCTCACCACTGGTTACCATGTGTTAAAGGCTGGAACAATTAATC
[0085] AACTGATCAATTTTGCGGCCAATGATCTAAGTGGAGAGACGAAGCACTATAGAGTTGGAGGAGAAGAACCACTTAGAATGAGATGTGAGA
[0086] CGGCCCTCATCACTAGCATTTTTAAACCAAAGAGAATGCTCAAGATTTTGGAAAGTGACCCCTATATCCTGCTGATGGGATTGGTTTCACCG
[0087] TCACTTTTGATACACTTGTATAGAATGAGACACCTAGAGAAGGCAATTGAGGTTTGGATACACAAAGACCAGAGTGTGAGCAAAATCTTTG
[0088] TACTGTTGGAGCAACTCACCAAGAAAGTTGCAGTTTGCGAAGTTTTGAGAGACCAACTCGATACAATTAATAATTCAGCCGGTCACTTGCT
[0089] AGATATACTTAAAGATTGTCCCAGAACAATGCACTCGTATGTCCCTGCAAGTGATTTGTTGACGCTGTATCTCGAGAGACAAACTTCAAATA
[0090] GTCAACTTCTCGCAAATGGCTTCACAGACATAGATGACTTGTTCGCTGTTCAAATGGAAAAAATCTACGTAAGCCGCTTAAAGCAGGAATG
[0091] GCGCGCTTTAAGCTTGTTGGAAAAATCTTTTGCAACATGGCACTTGAAGCGATTCTCAGTGGCTACGGAAAAAGATTTGATCAAGAGAGT
[0092] CACAGAAGGAAGAGGAGGATTTTCTGTCTCCTTTGTGAGCGAGTGCTTTACAACTGCAAAGTCACACCTCAGAAGCCAAAAAGATTTAGT
[0093] TTTGCGCGCATGTGAGAACTTTAGTCGTAGCATAGTTAGAAAGTGTGTAAATATGTTGTTTTCTATTGTAAAGAAGTGTTATAGTGATATTAT
[0094] TTACTTTGTGAATGTAGTTATTATCTTTTCTTTGTTAGTCCAAATGATATCAACAATGCACAGCATGATTTTATCAGCTCAATACAATAAAGCT
[0095] TTTGTGAAGCGAGCCGAAAGAGATTCAAAAGAAAAGTCAGTTATGCACATATATGACATGTGTTGCAAGGCTACAGGAGGACCCCCAACC
[0096] AGCGATGAGTTTTTGGAACACCTTGAGAAAATCAGGCCAGATCTTATTCCCACAGCACAAGAGATGATGGCCGTAGTAACCAATGTTTCTC
[0097] TTCAAGCTAAGAACGCTACTCAGCTTCAATTTGAAAAGATAGTAGCGTTTATGGCTTTACTCACCATGGTGATTGACACTGAAAGAAGTGA
[0098] TGCCATTTTCAAAATACTCAGCAAGCTCAAGACTGTGTTTCAAACGATGGGTGAAAATGTCCATATTCAAAGCTTAGATGAAATTTTGAGC
[0099] GTGGATGAGGAGAAGAAGTTGACAATTGATTTTGACATGGAATCTAGTAAGGAAGCCACTTCAACCTCATTTGATGTTAAGTTTGGAGATT
[0100] GGTGGAACAGGCAGTTGCAGCAAAATAGGATCATTCCTCACTATAGAAGCTGTGGAAAGTTCATGGAATTTACAAGGGAAACGGCAGCAA
[0101] AAGTGGCCAATGAGATTTCAATCTCTACCGAAACAGAGTTCCTCGTGCGTGGTGCTGTAGGTTCTGGGAAATCTACAGGCCTTCCGCATCA
[0102] TTTGGCAAAGAAAGGGAAAGTGCTACTTTGTGAACCAACACGACCTCTTGCTGAAAATGTGAGCAAACAGTTGAGTAAAGATCCATTCTA
[0103] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0104] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0105] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0106] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0107] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0108] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0109] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0110] TGAACAACCCACAACAATTGAGTGACTTCGATTTCATTATTTTTGATGAGTGTCATGTTATGGATTCTTCGGCAATTGCATTCAACTGTGCTC
[0111] GAGAAAGGAGTTGAGGAGATAACCGAATTCATAGCCACAGAAGCAGCGTTCCTCTCATTTGCATATGGACTGCCTGTCACAACGCAAGGT
[0112] GTCACCACAAACATGCTGTCGCAATGTACAGTGAAGCAAGCAAAGAGTGCTCTGAATTTTGAACTTACTCCGTTGTTCACAACACATTTTG
[0113] TCAAGTATGATGGAACTATGCACCCTGAAATTCACAGAATTCTCAAGGCCTTCAAGCTTAGAGAGTCAGAAATGGTGCTGAACAAGTTGG
[0114] CAATTCCACATCAGTATACTGGCCAGTGGATTTCAGTTAATGAATACGAGAGGATGGGGGTTCATATACATTGTGATGGCAAGACAAGGATT
[0115] CCTTTCTATGTCAATGGCATTCCTGACAAGATTTTCGAGATGCTTTGGGAAACAGTTTGTAAATACAAGAGTGATGCTGGTTTTGGAAGACT
[0116] CACAAGTGTAAATGCAACAAAAATTAGTTATACACTTAGTACGGATCCAAATGCACTTCCCAGGACAATCGCAATCATAGACCATCTCATTG
[0117] GTGAGGAAATGATGAAAAAGAGCCATTTTGATACAATGAGTTCCGCAATCACAGGACACTCGTTTTCATTGAATGGTATTACAGAGGCCAT
[0118] TAGGAAGCGTTATTTAAGGGACTACACACAGCAAAATATAGAAATACTGCAGCGGGCAAAGGCACAATTGTTAGAATTCTCAAACACAAA
[0119] AGTTGACATCAACGACCTGAGCACACTCGGGGATTTGGGGGTTCTAAACACAGTTAGACTGCAAGGAAAAGAAGAGGTAGTCAAGTTTC
[0120] TGGGTCTCAAAGGAAAGTGGGATGGAAAGAAATTTATGAACGATGCCATCCTAGCTGTGTTTACACTACTTGGTGGTGGCTGGATGATGTG
[0121] GGAATATTTCAGCAAGAAGATGCAAGAAAGTGTCACCACACAAGGAAAGAAGCGCATGCTACAAAAGCTCAAGTTCAGGGATGCTTTTG
[0122] ACAGGAAGGTTGGCCGTGAGGTATATGCTGATGACTACACAATGGAACACACATTTGGTGAAGCATATACCAAGAAAGGCAAACAGAAAG
[0123] GAAGCACAAAAACAAAAGGAATGGGACGGAAGACAAGGAATTTCACACATATGTATGGGGTTGAGCCTGAAAACTATAGCATGATTCGGT
[0124] TTGTTGATCCACTCACTGGTGCAACTTTGGATGAAGGCACAAGGGTGGATATAAGACTCGTGCAGGATGAATTCGGTGAGATCAGGAAAC
[0125] AAAAGATCGCAGATGACGAACTCAGTTGTGATGCAGTCAGGAGCAACCCCGAAATTCAAGCCTATTTCATCGGCAGAAATGCAGAAGAA
[0126] GCACTTAAGGTCGATCTAACCCCACATAGACCAACGCTTTTGTGTATGAATAGCAATGCAATCGCTGGTTTCCCTGAAAGAGAGGATGAGC
[0127] TCAGGCAGACAGGCCTCCCAGTGCGTATCAAGAGAAGTGAAGTGCCCGAACCAAATGAAGAGGTAGCCGTTGAAAGCAAGTCAATTTAC
[0128] AAGGGACTTCGTGATTATAATGGCATTTCAAGTTTGGTTTGTCAACTCACAAACATTTCAGATGGGCATAGTGAAACAATTTTTGGCATAGG
[0129] TTATGGCTCGTACATCATCACAAATGGGCACTTGTTCAAGCGCAATAATGGTGTGCTCACCATTCGGACATGGCATGGCGAGTTTGAGATAA
[0130] AGAATACAACACAGATCAAAATTCACTTCATTGAAGGGAAGGATGCAATACTCATTCGCATGCCAAAGGATTTTCCACCATTTGCAAAGAG
[0131] GAGCTTGTTCAGGCCACCTATTAAAGAGGAAAGAGTATGCATGGTGGGAACGAATTTTCAAGAGAAAAGCCTCAGAGCAACAGTATCTGA
[0132] ATCCTCAATGGTACTGCCTGAGGGAGTTGGATCCTTCTGGATACACTGGATCACAACACAAGACGGGTATTGTGGGCTACCCTTGGTTTCA
[0133] GTTAATGATGGGTTCATAGTTGGATTTCATGGCTTGACTTCAAATGACTCAAACAAGAACTTTTTCGTACCATTCTGCGAAGATTTTGAGAA
[0134] TAAGTATCTTAAGAGTGCTGAATCATTGACATGGGACAAACACTGGTTTTGGCAACCAGACAAGATAGCATGGGGGTCTTTGAATCTTGTA
[0135] AGTGACCAACCGAAAGAGGAGTTTAAAATTTCAAAACTCATTTCAGATCTCTTTGGTGATACAGTGGCAACACAGAGCAAGCAACAGTG
[0136] GGTTTTAGAATCGGTAGAAGGCAATCTCAAGGCATGTGCACGAGCTGATAGTGCATTGGTGACAAAACATGTAGTGAAGGGTAAGTGTCC
[0137] ATATTTTGAACAGTACTTGAGAGAGAGGAGTGAAGCAGCAGCCTTTTTCAGACCTCTGATGGGATCGTATCAACCAAGCAAACTAAACAA
[0138] AGAAGCCTTCAAAAAGGACTTCTTTAAGTACAACAAGGTTGTAACATTGAACGAGGTTTGCTATGAAGCATTCGAAGCAGCATTCAACGG
[0139] AGTGATAACAATGATGATAGAACACGGTTTTTCTGAGTGTTCTTATGTCACAGACCCGGAGGAGATATACTCATCACTGAATCTGAAGGCA
[0140] GCAGTTGGAGCACAATACAAAGGGAAGAAGCAGGATTATCTTTGTGACATGGATGAATTTGATAAGGAAAGACTTCTGTACCTGAGTTGT
[0141] GAAAGGTTGTTCTATGGCAAGAAGGGGCTTTGGAATGGTTCATTGAAAGCAGAATTGAGACCACTGGAGAAAGTTGAGGCCAATAAAAC
[0142] ACGCACTTTCACAGCTGCTCCCATAGACACATTGCTTGGAGCGAAGGTCTGCGTAGATGATTTTAACAATCAATTTTACAGTCTCAATCTGG
[0143] AGTGTCCATGGACTGTTGGAATGACAAAGTTCTATGGAGGATGGGATACTCTCATGAGAAAATTGCCTGATGGATGGATTCACTGTCACGC
[0144] AGACGGTTCTCAATTTGATAGCTCATTAACACCACTACTACTTAACTCAGTGCTTGGAATCAGAAGATTCTTCATGGAGGATTGGTGGGTTG
[0145] GTGAAGAAATGCTTGAGAATTTGTATGCTGAGATAGTGTATACACCCATTTTGGCACCTGATGGAACAGTGTTTAAAAAGTTTAGAGGGAA
[0146] TAACAGTGGACAACCTTCCACAGTCGTTGACAACACACTCATGGTTGTAATGTCAGTCTATTACTCATGTCACAAAGTGGGGTGGAGCGAT
[0147] GAAGACATACAAGAGCGTCTGGTTTTCTTTGCAAATGGAGATGACATCATACTCTCCATACAAGAGATGGATTTATGGGTTCTTGACACATT
[0148] CGCTGCATCGTTTAGAGAGCTGGGATTGAACTACAATTTTGATGAGAGGACAAGGAAGAGAGAGGACCTCTGGTTCATGTCGCACTGTGC
[0149] GATCGAAGTGGACGGAATTTACATTCCAAAGCTAGAGCCAGAGCGTGTGGTTTCAATTTTGGAGTGGGATAGGAGCAAGGAGATGATGCA
[0150] CAGGACTGAGGCAATTTGTGCAGCCATGATTGAAGCATGGGGTTATCCTGAACTTCTCCAAGAAATCAGGAAGTTTTATTTGTGGCTGCTT
[0151] GAAAGAGATGAGCTGCGAGAGATTGCAGCTAGTGGAGGAGCCCCATACATAGCAGAATCAGCACTCAAAACTCTGTACACCAATAAGAA
[0152] AACAAGGATTGAAGAGTTAGCAAAATATCTTGAAGTGCTTGACTTTGACTATGAAGTAGGATGCGGAGAATCTGTGCACCTACAATCAGG
[0153] AACTGGACAGCCACAACCACCAATAGTGGATGCTGGTGTAGAAGCTGGAAAGGATAAGAAAGAGAAAAACAACAAAGGAAAGGATCCT
[0154] GAAAACAGGGAAGGGTCAGGAAGTAATAGTCGTGGCACAGGGAATTCGGCAATGAGAGACAAGGATGTGAATGCCGGTTCCAAAGGGA
[0155] AGGTTGTTCCTCGGCTTCAAAAGATCACAAAAAGGATGAACCTGCCCATGGTGAAAGGGAATGTGATCTTGAATTTAGATCATCTGTTGGA
[0156] TTACAAGCCAGAGCAAACTGATCTTTTCAACACAAGAGCAACAAAGATGCAGTTTGAAATGTGGTACAATGCTGTGAAGGGTGAGTATGA
[0157] GATTGATGATGAACAGATGTCAATTGTTATGAACGGCTTTATGGTGTGGTGCATTGACAATGGTACTTCACCGGATGTAAATGGCACTTGGG
[0158] TGATGATGGATGGAGATGAGCAAGTGGAGTACCCACTTAAGCCAATGGTTGAAAATGCAAAGCCAACACTCCGCCAAATCATGCACCATT
[0159] TCTCAGATGCAGCTGAAGCATACATTGAGATGAGAAATTCTGAGAGGCCGTACATGCCTAGGTACGGACTACTTCGGAATTTGAGGGATAA
[0160] AAATCTAGCTCGCTACGCTTTTGATTTCTATGAAGTGACATCCAAAACATCGGATCGAGCGAGAGAAGCAGTAGCACAGATGAAGGCAGC
[0161] AGCCCTCAGCAACGTTAGCAGCAAGTTGTTCGGACTTGATGGCAACGTGGCAACAACCAGCGAGAATACTGAAAGGCACACTGCGAGGG
[0162] ACGTCAATCAAAACATGCACACACTTCTTGGCATGGGTTCCCCGCAGTAAAGGTTGGGTCAACCGATCACAGTTAGCATCTCGCGTCGCT
[0163] GAATAATTTCATATAGTAATCTTTTATGTTCTCTTTAGTTCCAGTGTGGTTTTACCACCTTTGTGTTACTATTGTGATAGTGTGGCTGGACCAC
[0164] CAACATATTGTGAGTACTTTATGTTTACGAGTAAGCCGGAAGAACCATTGCAATGGCGAGGGCATGCAGAGTGGTGTTATCACGCGTCATGAGATAGCTACGGCAATGTTTGTTGTTCCTAAAAAAAAAAAAAAAAAAA (SEQ ID NO. 29).
[0165] After whole genome sequencing of the strain, sequence alignment was performed through the NCBI website. The highest similarity of the non-coding region and each gene 5'-UTR, 3'UTR, P1, HC-Pro, P3, P3N-PIPO, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and CP to the nucleotide sequence of BCMV was 93.75%, 94.58%, 94.64%, 92.34%, 93.09%, 97.84%, 94.23%, 93.11%, 93.71%, 88.75%, 94.65%, 94.96%, 99.42% respectively. Nucleotide sequence homology and similarity analysis of the whole genome of BCMV-DY9 and 20 BCMV isolates from different sources was performed, and the results are shown in Table 5.
[0166] Table 5 Comparison of nucleotide sequence and CP gene sequence homology of BCMV-DY9 and other BCMV and BCMNV isolates
[0167]
[0168]
[0169] The results showed that DY9 had the highest nucleotide homology with BCMV-22Huhe (accession number: OR778613.1) and BCMV-HY strain (accession number: LC582403.1) in China, which were 91.61% and 90.57% respectively, followed by BCMV-HXH-2 strain (accession number: MF405191.1) in Tanzania, which was 90.56% in nucleotide homology; at the amino acid level, DY9 had the highest amino acid homology with US10 strain (accession number: AIC83445.1) in the United States, which was 92.60%, followed by TZ strain (accession number: AWX66774.1) in Tanzania, which was 92.13% in amino acid homology.
[0170] 5. Nucleotide, amino acid and phylogenetic analysis
[0171] The DY9 sequence was compared with the nucleotide and amino acid similarity of the BCMV isolates reported in NCBI. The whole genome sequences of 20 BCMV isolates from different countries and regions and different hosts were downloaded from the GenBank database, the sequences were aligned using MUSCLE in MEGA 11, then the phylogenetic tree of DY9 and other related BCMV isolates was constructed by the Neighbor-Joining (NJ) method, and the phylogenetic analysis was performed, with the Bootstrap test number set to 1000 times, and the results are shown in Table 6. Figure 3
[0172] The results showed that 21 BCMV isolates, 6 BCMNV isolates and 3 PVY isolates could be divided into 3 groups, in which the hosts of BCMV were mostly Phaseolus vulgaris, which indicated that the BCMV with Phaseolus vulgaris as host had a high genetic relationship. At the nucleotide level, BCMNV and PVY were clustered into one cluster, and BCMV-DY9 was clustered with BCMV, which had the closest genetic relationship and nucleotide homology; the phylogenetic analysis based on the amino acid sequence of BCMV-DY9 showed that it was clustered with BCMV-22Huhe (accession number: XNX46337.1) from China, BCMV-HXH-2 (accession number: AWX66775.1) from Tanzania and BCMV-NL7n (accession number: APU54684.1) from India, which had a closer genetic relationship, and the genetic relationship between BCMV-DY9 and BCMV-22Huhe was the closest. The results of the phylogenetic analysis based on the amino acid sequence of BCMV-DY9 showed that it was clustered with BCMV-22Huhe (accession number: XNX46337.1) from China, BCMV-HXH-2 (accession number: AWX66775.1) from Tanzania and BCMV-NL7n (accession number: APU54684.1) from India, which had a closer genetic relationship, and the genetic relationship between BCMV-DY9 and BCMV-22Huhe was the closest. Figure 3 It can be concluded that the genetic relationship of BCMV does not show obvious regional correlation.
[0173] 6. Pathogenic type differentiation
[0174] Under the standard growth conditions, 11 Phaseolus vulgaris varieties with different genetic backgrounds were planted, and when the first pair of true leaves was fully extended (7-8 days later), 0.5 g of Phaseolus vulgaris leaf samples infected with BCMV were taken, 5 mL of 1xPBS (leaf: buffer = 1:10) was added, and the homogenate was ground in a mortar. The healthy control was only rubbed with 1xPBS Phaseolus vulgaris, a little quartz sand was sprinkled on the 11 Phaseolus vulgaris varieties inoculated, and then the virus juice was gently rubbed on the leaves with gloves. After inoculation, the plants were cultured in the standard growth conditions in the greenhouse (daylight cycle of 16 h, day and night temperature of 25 / 20℃, relative humidity of 60%) for subsequent research. After 3 weeks of inoculation, RT-PCR detection and symptom observation were performed, and the pathogenic type of the BCMV strain was finally determined. Each variety had three biological replicates, and the pathogenicity test was repeated three times. The identification results are shown in Table 6.
[0175] Table 6. BCMV pathogen type list and identification of DY9 pathogen type
[0176]
[0177] After screening on 11 Phaseolus vulgaris varieties with different genetic backgrounds, BCMV-DY9 caused typical mosaic, leaf deformation and usually accompanied by growth retardation on susceptible varieties (DW, SGR, Sanilac). The presence of BCMV in inoculated plants was confirmed by RT-PCR technology, and the results were consistent with the biological detection. Based on the pathogenicity spectrum exhibited by the resistance difference between Phaseolus vulgaris varieties, BCMV-DY9 was classified as PG-III.
[0178] 7. Construction of pBCMV-DY9 full-length cDNA infectious clone
[0179] Based on the full-length sequence information of the BCVMV-DY9 genome, three cloning structures were constructed during the construction of the invasive clone, and the schematic diagram is shown as Figure 4 .
[0180] Because there may be potential hidden prokaryotic promoters in the sequence of the virus itself, when propagated in prokaryotes, it will guide the expression of toxic products, which will have a significant toxic effect on its growth, and it is easy to recombine with the sequence of the prokaryotic bacteria itself or other foreign genes, resulting in plasmid instability or loss of cloning activity. Therefore, the method of inserting an intron is adopted to avoid this situation, the insertion of the intron will not cause changes in the virus sequence, only the cloned cDNA under the control of the activated promoter and terminator in vivo, so that it can be normally replicated and translated in E. coli cells, the intron interrupts the potential toxic sequence to make it not produce toxic proteins, (there are multiple stop codons in the intron) thereby reducing the toxicity of the virus genome to E. coli, and at the same time, the virus genome containing the intron constructed on the vector can be transcribed in eukaryotic host cells, and the intron can be recognized and spliced by the host cells to produce offspring viruses with complete virus genome sequences, and the clone can be normally expressed in plants without affecting the invasive activity of the cDNA.
[0181] The present application firstly constructs two clones pBCMV-DY9-1 and pBCMV-DY9-2 by inserting a single intron at the 4240th site of the CI gene of the common bean mosaic virus BCMV-DY9 and inserting double introns at the 2955th site of the P3 gene and the 4240th site of the CI gene. Sequencing of pBCMV-DY9-1 shows that the recombinant plasmid has a high frequency of mutation, and the mutation region occurs mainly in HC-PRO. Although pBCMV-DY9-2 constructed by double introns obtains a stable recombinant plasmid without mutation, it loses the invasive activity. In combination with the sequencing results of pBCMV-DY9-1, it is finally found that the intron is inserted at the AG-GT region of the 2431th site of the HC-PRO gene and the 4240th site of the CI gene, thereby constructing pBCMV-DY9-3 (hereinafter uniformly marked as pBCMV-DY9).
[0182] The intron 1 (Intron 1) used in the present application is from the potato STLS1 gene, which is 189 bp in total, and its sequence is shown as SEQ ID NO. 30:
[0183] GTTTGTTTCTGCTTCTACCTTTGATATATATATAATAATTATCATTAATTAGTAGTAATATAATATTTCAAATATTTTTTTCAAAATAAAAGAATGTAGTATATAGCAATTGCTTTTCTGTAGTTTATAAGTGTGTATATTTTAATTTATAACTTTTCTAATATATGACCAAAACATGGTGATGTTTAG (SEQ ID NO. 30).
[0184] Intron 2 is from the NiR gene of bean, 221 bp in total, and its sequence is shown as SEQ ID NO. 31:
[0185] GTAAGTATGCACTTAAAGAGTATGTGTGGAAAAAGTTCTTCATAACCACTTCTAGTAGAAAAAAATAACAAGGAAACATGAAGCTATTTCCTACTAGCTTGTCCAAAATCTTATTTTTTAACTCAAACTAATTTTAACTTGTGGAAGAAAACAACTTCTTTACATTTTATAATCTGAGCATTGGTGTGGGGTCCTTAGGTTCAATCTTTGAAATTGTGCAG (SEQ ID NO. 31).
[0186] The specific steps of constructing the three infectious clones are as follows:
[0187] The first infectious clone pBCMV-DY9-1 divides the viral genome into two overlapping fragments for amplification:
[0188] 1. The RNA extracted from the leaves of bean common mosaic virus BCMV-DY9 is reverse transcribed into cDNA, and the cDNA is used as a template to amplify a 4477 bp fragment with pDY9-5'F / DY9-4240R as the fragment I;
[0189] pDY9-5'F: catttcatttggagaggAATTAAAACAACTCGAAAAGACACA (SEQ ID NO. 32); DY9-4240R: GTTCCTCGTGCGTGGTGCTGTAG (SEQ ID NO. 33);
[0190] 2. RNA was extracted from leaves of bean common mosaic virus (BCMV-DY9) and reverse-transcribed into cDNA. The cDNA was used as a template to amplify a 5798 bp fragment with DY9-4240F / pDY9-3'R, which was fragment II;
[0191] DY9-4240F: GTTCTGGGAAATCTACAGGCCTTC (SEQ ID NO. 34);
[0192] pDY9-3'R: cgatcggggaaattc TTTTTTTTTTTTTTTTTTTAGGAACAACAAACATTG (SEQ ID NO. 35);
[0193] The full-length sequence of the binary vector pCB301 was amplified at the same time. The pCB301 vector plasmid was used as a template, and F: pCB301-2F / R: pCB301-1R was used as primers to obtain the linearized vector pCB301 with a length of 7417 bp.
[0194] pCB301-2F: gaatttccccgatcgttcaaacatttg (SEQ ID NO. 36);
[0195] pCB301-1R: cctctccaaatgaaatgaacttccttatatagaggaagg (SEQ ID NO. 37).
[0196] The fragment I was fused with Intron 1 by using overlap PCR. The fusion product, fragment II, and linearized vector pCB301 were used for seamless ligation by using ClonExpress MultiS multi-fragment recombination system to construct the clone pBCMV-DY9-1.
[0197] The second infectious clone pBCMV-DY9-2 used a step-by-step recombination strategy to divide the genome into four overlapping fragments:
[0198] 1. The cDNA of bean common mosaic virus (BCMV-DY9) was used as a template, and pDY9-5'F / DY9-2955-Intron-R was used as primers to amplify a 2991 bp fragment, which was fragment I;
[0199] pDY9-5'F: catttcatttggagagg AATTAAAACAACTCGAAAAGACACA (SEQ ID NO. 38);
[0200] pDY9-2955-Intron-R: cctctccaaatgaaatgaacttccttatatagaggaagg (SEQ ID NO. 39).
[0201] DY9-2955-Intron-R): ctctttaagtgcatacttac CTCAATTGCCTTCTCTAGGT (SEQ ID NO. 39);
[0202] 2. The cDNA of BCMV-DY9 as template, DY9-Intron-2955-F / DY9-4240R as primers, the fragment of 1305bp as fragment II was amplified;
[0203] DY9-Intron-2955-F: caatctttgaaattgtgcag GTTTGGATACACAAAGACCA (SEQ ID NO. 40);
[0204] DY9-4240R: GTTCCTCGTGCGTGGTGCTGTAG (SEQ ID NO. 41);
[0205] 3. The cDNA of BCMV-DY9 as template, DY9-Intron-4240F / DY9-7228R as primers, the fragment of 2989bp as fragment III was amplified;
[0206] DY9-Intron-4240-F:
[0207] AAACATGGTGATGTTTAGGTTCTGGGAAATCTACAGGCCT (SEQ ID NO. 42);
[0208] DY9-7228R: GGTTGCCAAAACCAGTGTTTGTCCC (SEQ ID NO. 43);
[0209] 4. The cDNA of BCMV-DY9 as template, DY9-7203F / pDY9-3 'R as primers, the fragment of 2834bp as fragment IV was amplified;
[0210] DY9-7203F: GGGACAAACACTGGTTTTGGCAACC (SEQ ID NO. 44);
[0211] pDY9-3 'R:
[0212] cgatcggggaaattc TTTTTTTTTTTTTTTTTTTAGGAACAACAAACATTG (SEQ ID NO. 45).
[0213] Firstly, fragment I was fused with Intron 2 by overlap PCR, and the fusion product, fragment II and linearized vector pCB301 were ligated by using ClonExpress MultiS recombination reaction system to construct subclone pBCMV-DY9-2A (4460 bp, containing I + Intron2 + II), then Intron 1 was fused with pBCMV-DY9-2A (4649 bp) by using overlap PCR, and the fusion product (4649 bp), fragment III and linearized pCB301 were homologously recombined by using ClonExpress MultiS recombination reaction system to obtain subclone pBCMV-DY9-2B (7638 bp, I + Intron2 + II + Intron1 + III). Finally, fragment IV was recombined with pBCMV-DY9-2B (7638 bp) and linearized vector pCB301 by seamless cloning to obtain pBCMV-DY9-2 full-length clone (10432 bp, I + Intron2 + II + Intron1 + III + IV).
[0214] The third infectious clone pBCMV-DY9 adopts a step-by-step recombination strategy to divide the genome into four overlapping fragments:
[0215] 1. The cDNA of bean common mosaic virus BCMV-DY9 was used as a template, and pDY9-5'F / DY9-2431-Intron-R was used as a primer to amplify a fragment of 2473 bp as fragment I;
[0216] pDY9-5'F: catttcatttggagaggAATTAAAACAACTCGAAAAGACACA (SEQ ID NO. 46);
[0217] DY9-2431-Intron-R: cacatactctttaagtgcatacttacCTTCCTTTGAAATATACATTC (SEQ ID NO. 47);
[0218] 2. The cDNA of bean common mosaic virus BCMV-DY9 was used as a template, and DY9-Intron-2431-F / DY9-4240R was used as a primer to amplify a fragment of 1829 bp as fragment II;
[0219] DY9-Intron-2431-F:
[0220] caatctttgaaattgtgcagGTTACTGTTATCTGAATGTTTTC (SEQ ID NO. 48);
[0221] DY9-4240R: GTTCCTCGTGCGTGGTGCTGTAG (SEQ ID NO. 49);
[0222] 3. Using the cDNA of Bean Common Mosaic Virus BCMV-DY9 as a template, DY9- Intron-4240F / DY9-7228R as primers, a 2989bp-length fragment was amplified as Fragment III;
[0223] 4. Using the cDNA of Bean Common Mosaic Virus BCMV-DY9 as a template, DY9- 7203F / pDY9-3'R as primers, a 2834bp-length fragment was amplified as Fragment IV;
[0224] Firstly, the fragment I of DY9 and Intron 2 were fused and amplified by using overlap PCR technology. The fusion product, fragment II, and linearized vector pCB301 were used to construct the first subclone pBCMV-DY9-3A (4460bp, fragment I+Intron2+II) by using ClonExpress MultiS recombination reaction system (Vazyme). On this basis, Intron 1 was fused and amplified with the fragment (4460bp) of pBCMV-DY9-3A again by using overlap PCR technology, and the fusion product (4649bp), fragment III, and linearized vector pCB301 were homologously recombined to construct the second subclone pBCMV-DY9-3B (7638bp, I+Intron2+II+Intron1+III). Finally, fragment IV was recombined with the fragment (7638bp) of pBCMV-DY9-3B and linearized vector pCB301 by using seamless cloning to obtain pBCMV-DY9 full-length clone (10432bp, I+Intron2+II+Intron1+III+IV). The sequence of pBCMV-DY9 full-length clone is shown as SEQ ID NO. 50:
[0225]
[0226] PCR amplification was performed using 2x HiFi Plus PCR Master Mix high-fidelity system (Biosharp) in the experiment, and the PCR products were recovered using a general DNA purification and recovery kit (Biosharp). After detecting the concentration of the recovered products by NanoDrop spectrophotometer, the amount of multi-fragment and linearized vector was calculated according to the ClonExpress MulitiS (Vazyme) seamless cloning kit instructions and transformed into E. coli XL10-Gold competent cells (REBIO). After 37°C overnight culture of all recombinant structures, positive clones were screened, verified by 9 pairs of specific primers for segment amplification, and sequenced by full-length genome. The clone sequence was completely consistent with the wild type control of BCMV-DY9 containing intron sequence, and no mutation site was detected.
[0227] Example 2. pBCMV-DY9 infectious clone transformation of Agrobacterium and infection of tobacco
[0228] 1. Agrobacterium transformation
[0229] The stable mutant-free E. coli plasmid was transformed into Agrobacterium, and the recombinant plasmid pBCMV-DY9 was inoculated into N. benthamiana by Agrobacterium-mediated method. Healthy N. benthamiana inoculated with pCB301 empty vector was used as a negative control, and the transformation steps were as follows:
[0230] The recombinant plasmid was introduced into Agrobacterium GV3101 competent cells by Bio-Rad micro-pulse electroporation instrument. Positive clones were screened by colony PCR verification, and after amplification and culture, an appropriate amount of bacterial solution was inoculated into 20 mL LB medium containing Kan+Rif. The initial OD 600 was adjusted to about 0.1; the bacterial solution was continuously cultured until the OD 600 was 0.5; the bacterial solution was collected; resuspended in cell suspension buffer (100 μmol / L acetyl-syringone, 10 mmol / L MES, pH 5.6, 10 mmol / L MgCl2) to a final OD 600 of 1.0; and incubated at room temperature for 3 h in the dark. N. benthamiana seedlings with good growth and 4-6 true leaves were selected, and 1 mL needle-free sterile syringe was used for vacuum infiltration inoculation, 2-4 true leaves per plant, a total of 10 independent plants. Agrobacterium carrying pCB301 empty vector was used as a negative control, and the inoculated plants were incubated under standard growth conditions.
[0231] After 2 weeks of Agrobacterium-mediated transformation of N. benthamiana, no obvious symptoms of viral infection were observed on N. benthamiana, which was consistent with the biological phenotype of conventional BCMV on N. benthamiana. Total RNA was extracted from system leaves and subjected to RT-PCR detection, and the results are shown inFigure 5 Figure 2B shows that pBCMV-DY9 has infection activity on N. benthamiana.
[0232] 2. RT-qPCR analysis
[0233] The system leaves of N. benthamiana inoculated with pCB301 empty, pBCMV-DY9 and wild-type BCMV-DY9 were sampled and the relative quantification of virus was analyzed at 2 weeks and 6 weeks, respectively. The samples were ground in liquid nitrogen and total RNA was extracted, and the RNA concentration and purity were determined using Nanodrop. Then the first strand cDNA was synthesized using All-in-One First-Strand Synthesis Master Mix (with dsDNase) One-Strand cDNA Synthesis Kit (BestEnzymes); Taq Green qPCR Premix (BestEnzymes) was used for real-time fluorescent quantitative polymerase chain reaction on the QuantStudio platform. NtUBI was used as the internal reference gene to normalize gene expression. The experimental data was analyzed for significant difference by GraphPad Prism 9, and the significance was obtained by multiple comparisons of two-way ANOVA of general linear model, the standard error of the mean was calculated using the pooled error term in the analysis of variance table, and was represented by error bars in the figure. The relative expression of the target gene in N. benthamiana samples was calculated using the formula: relative expression = 2 -ΔΔCt Each treatment had three biological replicates, and the experiment was repeated three times.
[0234] The results are shown in Figure 2B, which shows that the clone can normally replicate on system leaves, and the expression of the virus is basically the same as that of the wild-type virus DY9. The expression of the virus increases rapidly from 2 weeks to 6 weeks. Figure 5
[0235] 3. Western blot analysis
[0236] Take the system leaf samples of 0.1 g collected in the last step, grind into fine powder in liquid nitrogen, add protein lysate 150 μL, β-mercaptoethanol 20 μL, shake well for about 1 min to extract total protein; take a suitable amount of protein sample and perform electrophoresis separation by 8% separation gel and 5% concentration gel (80V, 30min; 120V, 1.5h), then transfer the protein from the gel to the nitrocellulose filter membrane (Boster, Wuhan, China) by wet transfer instrument. After the transfer is completed, place the NC membrane in 1xTBST buffer containing 5% skimmed milk powder, and shake at 60 rpm for 2h. Use 1:15k dilution of BCMV-CP specific antibody R27 (donated by Dr. Karasev, University of Idaho, USA) 4℃ rotary incubation overnight; then transfer the NC membrane to the solution containing horseradish peroxidase (HRP) labeled goat anti-rabbit secondary antibody (diluted at 1:15k; Sangon, Shanghai, China), and rotary incubate for 2h for immunoblotting, and finally use ECL chemiluminescence detection kit (absin, Shanghai, China) to visualize the blot signal.
[0237] The results are shown as C in Figure 5 The system leaves of pBCMV-DY9 clone can be clearly observed a main band of about 36kDa, which is close to the size of CP protein, and the accumulation of viral protein is higher than that of wild type, from 2 weeks to 6 weeks, the accumulation of viral protein is significantly increased, which is consistent with the quantitative analysis results.
[0238] 4. Transmission electron microscope
[0239] Finally, take the pBCMV-DY9 inoculated with Agrobacterium of Nicotiana benthamiana, and after crude extraction of virus particles, observe the virus particles of the infectious clone under transmission electron microscope by negative staining method, as follows:
[0240] Put the diseased leaves into 0.2 mol·L -1 PBS buffer containing 1% β-mercaptoethanol at 4℃, add 10% chloroform: n-butanol at a ratio of 1:1, continue to stir for 15 min in ice bath, centrifuge at 4℃, 10000 rpm for 20 min; take the supernatant, add 4% sodium chloride and 4% polyethylene glycol (PEG 6000), stir for 1.5h in ice bath, centrifuge at 4℃, 10000 rpm for 15 min; keep the precipitate, add 0.01 mol·L -1The virus particles were purified from the pBCMV-DY9 infectious clone, and the purified virus particles were observed under a JEM-1400 Flash transmission electron microscope by using negative staining method.
[0241] The virus particles were purified from the pBCMV-DY9 infectious clone, and the purified virus particles were observed under a JEM-1400 Flash transmission electron microscope by using negative staining method.
[0242] The results show that the pBCMV-DY9 is a typical flexuous virus particle, which further proves that the virus particles of the pBCMV-DY9 infectious clone are normally expressed. The clone not only maintains the stability of the genome, but also realizes normal expression in tobacco. It is proved that the pBCMV-DY9 infectious clone structure with complete biological function is successfully established.
[0243] Example 3. Biological activity of the progeny virus produced by the pBCMV-DY9 infectious clone
[0244] The virus inoculum was rubbed on 11 bean varieties with different genetic backgrounds. Figure 6 After 3 weeks of inoculation, the typical symptoms of BCMV infection appeared on the bean varieties DW, SGR and Sanilac, including mosaic, yellowing, malformation and dwarfing of the plants; after 6 weeks of inoculation, the diseased plants grew slowly, the diseased leaves were curled and deformed, and the pods were few or almost none, which was consistent with the wild type symptoms; the remaining bean varieties did not show obvious symptoms, which was consistent with the biological phenotype of the healthy control. Through RT-PCR detection, BCMV was detected only in the diseased leaves, which was consistent with the observed biological phenotype, proving that the pBCMV-DY9 infectious clone was consistent with the wild type pathogenic type and did not change the biological infection activity.
[0245] From the above examples, it can be seen that the present application provides the bean common mosaic virus infectious clone expression vector pBCMV-DY9 and its construction method and application, which lays a foundation for the research of the bean common mosaic virus.
[0246] The above description is only the preferred embodiments of the present application, and it should be pointed out that for ordinary skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which should be considered as the protection scope of the present application.
Claims
1. An infectious clone expression vector of Bean Common Mosaic Virus, pBCMV-DY9, characterized in that, The nucleotide sequence is shown as SEQ ID NO.
50. 2. A process for the preparation of the Bean Common Mosaic Virus Infectious Clone Expression Vector pBCMV-DY9 according to claim 1, characterized by, The method comprises the following steps: S1. Extracting RNA of bean common mosaic virus, and obtaining cDNA full-length sequence of the bean common mosaic virus by RT-PCR; S2. Taking the cDNA of the bean common mosaic virus BCMV-DY9 as a template, and taking DY9-5'F / DY9-2431-Intron-R, DY9-Intron-2431-F / DY9-4240R, DY9-Intron-4240F / DY9-7228R and DY9-7203F / pDY9-3'R as primers, fragments with lengths of 2473bp, 1829bp, 2989bp and 2834bp are amplified, which are fragment I, fragment II, fragment III and fragment IV in sequence; S3. The fragment I and intron 2 are fused and amplified by using overlap PCR technology to obtain fusion product 1; S4. The fusion product 1, the fragment II and the linearized vector pCB301 are used to construct a first subclone pBCMV-DY9-3A by using ClonExpress MultiS recombination reaction system; S5. The intron 1 and the first subclone pBCMV-DY9-3A are fused and amplified by using overlap PCR technology to obtain fusion product 2; S6. The fusion product 2, the fragment III, the linearized vector pCB301 are homologously recombined to construct a second subclone pBCMV-DY9-3B; S7. The fragment IV, the second subclone pBCMV-DY9-3B and the linearized vector pCB301 are recombined by using seamless cloning to obtain the pBCMV-DY9 full-length clone.
3. The production method according to claim 2, characterized by, The nucleotide sequences of the primer pair pDY9-5'F / DY9-2431-Intron-R are shown as SEQ ID NO. 46 and SEQ ID NO. 47; the nucleotide sequences of the primer pair DY9-Intron-2431-F / DY9-4240R are shown as SEQ ID NO. 48 and SEQ ID NO. 49; the nucleotide sequences of the primer pair DY9-Intron-4240F / DY9-7228R are shown as SEQ ID NO. 42 and SEQ ID NO. 43; and the nucleotide sequences of the primer pair DY9-7203F / pDY9-3'R are shown as SEQ ID NO. 44 and SEQ ID NO.
45.
4. The production method according to claim 2, characterized by, The nucleotide sequence of the intron 1 is shown as SEQ ID NO. 30; and the nucleotide sequence of the intron 2 is shown as SEQ ID NO.
31.
5. The preparation method according to claim 2, characterized in that, The insertion site of the intron 1 is the 4240th site of the CI gene; and the insertion site of the intron 2 is the 2431th site of the HC-PRO gene.
6. The preparation method according to claim 2, characterized in that, The linearized vector pCB301 is obtained by taking the pCB301 vector plasmid as a template and using pCB301-2F and pCB301-1R primers for amplification.
7. Agrobacterium carrying the bean common mosaic virus infectious clone expression vector pBCMV-DY9, characterized in that, The pBCMV-DY9 is obtained by transforming the infectious cloning expression vector pBCMV-DY9 of the bean common mosaic virus of claim 1 into Agrobacterium.
8. Use of the bean common mosaic virus infectious clone expression vector pBCMV-DY9 of claim 1 in the study of bean common mosaic virus.