Composition for detecting minimal residual focus of esophageal cancer in vitro and application thereof
By constructing a combination of esophageal cancer-specific methylation biomarkers, and using a qPCR platform, target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes were screened. This solved the problem of insufficient sensitivity in postoperative MRD detection for esophageal cancer, achieving highly sensitive and specific MRD detection and providing a theoretical basis for personalized treatment and dynamic monitoring.
Patent Information
- Application Number
- CN202511113385.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-12-05
AI Technical Summary
Existing methods for detecting minimal residual disease (MRD) after surgery in esophageal cancer patients lack sensitivity and are difficult to provide early warning of recurrence at the molecular level. In particular, due to the high heterogeneity of esophageal cancer, the abundance of ctDNA released into the blood by tumor cells is low and the fragmentation is complex. Existing detection methods face challenges such as clonal hematopoietic interference and difficulties in individualized site screening.
A combination of methylation biomarkers specific to esophageal cancer was constructed. Based on the qPCR platform, target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes were screened. By detecting the methylation status of these genes, nucleic acid amplification and hybridization were performed using primers and probes to achieve highly sensitive and specific MRD detection.
It achieves sensitive and specific detection of minimal residual lesions in esophageal cancer, can stably detect methylation features in peripheral blood, reduces the harm of invasive testing, provides a theoretical basis for personalized treatment and dynamic monitoring, and improves the accuracy and reliability of detection.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_4
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular biology and relates to gene detection, specifically to a composition for in vitro detection of minimal residual disease in esophageal cancer and its use. Background Technology
[0002] Among existing esophageal cancer patients, squamous cell carcinoma is the predominant pathological type, accounting for approximately 86% of all esophageal cancers. Surgical treatment is the primary treatment for patients with resectable esophageal cancer; however, even after radical resection, the distant metastasis rate in lymph node-positive patients is as high as 19.8%–61.3%. For patients with locally advanced ESCC who are not suitable for surgery, intensive chemoradiotherapy (CRT) is recommended. Although comparable long-term survival and survival benefits to surgery have been achieved, clinical trial data still show that the final 3-year overall survival (OS) after CRT is <50%.
[0003] Current clinical monitoring relies on imaging follow-up, endoscopic biopsy, and traditional tumor markers (such as SCC and CEA), but the detection sensitivity for minimal residual disease (MRD) is insufficient, making it difficult to achieve early recurrence warning at the molecular level.
[0004] In recent years, the development of circulating tumor DNA (ctDNA) detection technology has provided new insights for MRD monitoring. Studies have shown that postoperative ctDNA status is significantly associated with the recurrence risk of various solid tumors (such as gastric cancer and colorectal cancer). In a study on gastric cancer MRD, the sensitivity of ctDNA MRD prediction for recurrence after adjuvant therapy for gastric cancer reached 77.8%, and the specificity reached 90.6%. However, due to the high heterogeneity of esophageal cancer, the abundance of ctDNA released into the blood by tumor cells is low and the fragmentation characteristics are complex. Existing detection methods based on somatic mutations face challenges such as clonal hematopoietic interference and difficulties in personalized site screening.
[0005] It is noteworthy that DNA methylation, as a stable epigenetic marker, exhibits specific alterations in the early development and progression of esophageal cancer. Recent research has confirmed that characteristic methylation features of esophageal cancer can be stably detected in postoperative peripheral blood without interference from clonal hematopoiesis, providing a theoretical basis for establishing a highly sensitive MRD monitoring system. Summary of the Invention
[0006] The purpose of this application is to construct a combination of methylation biomarkers specific to esophageal cancer, and based on the qPCR platform, to build a highly sensitive and specific model for esophageal cancer MRD detection and recurrence monitoring, providing a theoretical basis for optimizing individualized treatment and dynamic monitoring, and improving patient survival.
[0007] Therefore, the purpose of this application is to provide a composition, a kit, and the use thereof for in vitro detection of minimal residual disease in esophageal cancer, as well as the use for detecting minimal residual disease in esophageal cancer.
[0008] The specific technical solution of this application is as follows:
[0009] 1. A composition for in vitro detection of minimal residual disease in esophageal cancer, the composition comprising:
[0010] Nucleic acid used to detect the methylation status of a target gene.
[0011] The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene.
[0012] The target gene is selected from one or more of the following genes: TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1.
[0013] 2. The composition according to claim 1, wherein the target sequence of the TLX1 gene is a sequence as shown in any one of SEQ ID NOs:1-4 or contains a sequence as shown in any one of SEQ ID NOs:1-4.
[0014] 3. The composition according to any one of items 1-2, wherein the target sequence of the NID2 gene is a sequence shown in any one of SEQ ID NOs:5-8 or contains a sequence shown in any one of SEQ ID NOs:5-8.
[0015] 4. The composition according to any one of claims 1-3, wherein the target sequence of the DIDO1 gene is a sequence shown in any one of SEQ ID NOs:9-12 or contains a sequence shown in any one of SEQ ID NOs:9-12.
[0016] 5. The composition according to any one of claims 1-4, wherein the target sequence of the ECRG4 gene is a sequence shown in any one of SEQ ID NOs:13-16 or contains a sequence shown in any one of SEQ ID NOs:13-16.
[0017] 6. The composition according to any one of claims 1-5, wherein the target sequence of the ZNF132 gene is a sequence shown in any one of SEQ ID NOs:17-20 or contains a sequence shown in any one of SEQ ID NOs:17-20.
[0018] 7. The composition according to any one of claims 1-6, wherein the target sequence of the IFFO1 gene is a sequence shown in any one of SEQ ID NOs:21-24 or contains a sequence shown in any one of SEQ ID NOs:21-24.
[0019] 8. The composition according to any one of claims 1-7, wherein the nucleic acid for detecting the methylation status of the target gene comprises:
[0020] Primers, wherein the primers are fragments of at least 9 nucleotides from the target sequence of the target gene.
[0021] The fragment contains at least one CpG dinucleotide sequence.
[0022] 9. The composition according to any one of claims 1-8, wherein the nucleic acid for detecting the methylation status of the target gene comprises:
[0023] The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately or strictly controlled conditions.
[0024] The fragment contains at least one CpG dinucleotide sequence.
[0025] 10. The composition according to any one of items 1-9, further comprising:
[0026] A reagent that converts the 5th unmethylated cytosine base of the target sequence of a target gene into uracil.
[0027] 11. The composition according to claim 8, wherein,
[0028] The fragment of at least 9 nucleotides is a sequence as shown in SEQ ID NO:25 and SEQ ID NO:26, or a sequence as shown in SEQ ID NO:27 and SEQ ID NO:28, or a sequence as shown in SEQ ID NO:29 and SEQ ID NO:30, or a sequence as shown in SEQ ID NO:31 and SEQ ID NO:32, or a sequence as shown in SEQ ID NO:33 and SEQ ID NO:34, or a sequence as shown in SEQ ID NO:35 and SEQ ID NO:36.
[0029] 12. The composition according to claim 9, wherein the fragment of at least 15 nucleotides is a sequence as shown in SEQ ID NO:37, or a sequence as shown in SEQ ID NO:38, or a sequence as shown in SEQ ID NO:39, or a sequence as shown in SEQ ID NO:40, or a sequence as shown in SEQ ID NO:41, or a sequence as shown in SEQ ID NO:42.
[0030] 13. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0031] A fragment consisting of at least 9 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0032] A fragment consisting of at least nine nucleotides from SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0033] A fragment consisting of at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0034] A fragment consisting of at least 9 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0035] A fragment consisting of at least 9 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0036] A fragment of at least 9 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0037] 14. The oligonucleotide according to claim 13, further comprising:
[0038] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0039] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0040] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0041] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0042] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0043] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0044] 15. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0045] The sequences of SEQ ID NO:25 and SEQ ID NO:26.
[0046] 16. The oligonucleotide of claim 15, further comprising:
[0047] The sequence of SEQ ID NO:37.
[0048] 17. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0049] The sequences of SEQ ID NO:27 and SEQ ID NO:28.
[0050] 18. The oligonucleotide of claim 17, further comprising:
[0051] The sequence of SEQ ID NO:38.
[0052] 19. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0053] The sequences of SEQ ID NO:29 and SEQ ID NO:30.
[0054] 20. The oligonucleotide of claim 19, further comprising:
[0055] The sequence of SEQ ID NO:39.
[0056] 21. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0057] The sequences of SEQ ID NO:31 and SEQ ID NO:32.
[0058] 22. The oligonucleotide of claim 21, further comprising:
[0059] The sequence of SEQ ID NO:40.
[0060] 23. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0061] The sequences of SEQ ID NO:33 and SEQ ID NO:34.
[0062] 24. The oligonucleotide of claim 23, further comprising:
[0063] The sequence of SEQ ID NO:41.
[0064] 25. An oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer, comprising:
[0065] The sequences of SEQ ID NO:35 and SEQ ID NO:36.
[0066] 26. The oligonucleotide of claim 25, further comprising:
[0067] The sequence of SEQ ID NO:42
[0068] 27. A kit comprising the composition of any one of items 1-12 or the oligonucleotide of any one of items 13-26.
[0069] 28. The kit according to claim 27, further comprising at least one other component selected from:
[0070] Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.
[0071] 29. The kit according to item 27 or 28, wherein the samples for which the kit is used to detect include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.
[0072] 30. The kit according to any one of items 27-29, further comprising: instructions for use.
[0073] 31. Use of the composition according to any one of items 1-12 or the oligonucleotide according to any one of items 13-26 in the preparation of a kit for in vitro detection of minimal residual disease in esophageal cancer.
[0074] 32. The use according to claim 31, wherein the kit for in vitro detection of minimal residual disease in esophageal cancer detects minimal residual disease in esophageal cancer by means of a method comprising the following steps:
[0075] 1) Isolate DNA samples containing the target sequence or fragments of the target gene from the biological sample to be tested;
[0076] 2) Determine the methylation status of the target sequence of the target gene;
[0077] 3) The status of biological samples is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of minimal residual lesions of esophageal cancer.
[0078] 33. The use according to item 32, wherein the method comprises the following steps:
[0079] Extract genomic DNA from the biological sample to be tested;
[0080] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.
[0081] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;
[0082] Detection of amplification products using probes; and
[0083] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.
[0084] 34. The use according to item 33, wherein the reagent is a bisulfite reagent.
[0085] 35. A method for detecting minimal residual disease in esophageal cancer, comprising the following steps:
[0086] Isolate DNA samples containing the target sequence or fragments of the target gene from biological samples to be tested;
[0087] Determine the methylation status of the target sequence of the target gene; and
[0088] The state of a biological sample is determined by detecting the methylation status of the target sequence of the target gene, thereby enabling in vitro detection of minimal residual lesions in esophageal cancer.
[0089] The target gene is selected from one or more of the following genes: TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1.
[0090] 36. A method for detecting minimal residual disease in esophageal cancer, comprising the following steps:
[0091] Extract genomic DNA from the biological sample to be tested;
[0092] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.
[0093] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;
[0094] Detection of amplification products using probes; and
[0095] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.
[0096] The target gene is selected from one or more of the following genes: TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1.
[0097] 37. The method according to claim 35 or 36, wherein the target sequence of the TLX1 gene is a sequence as shown in any one of SEQ ID NOs:1-4 or contains a sequence as shown in any one of SEQ ID NOs:1-4.
[0098] 38. The method according to any one of items 35-37, wherein the target sequence of the NID2 gene is a sequence shown in any one of SEQ ID NOs:5-8 or contains a sequence shown in any one of SEQ ID NOs:5-8.
[0099] 39. The method according to any one of items 35-38, wherein the target sequence of the DIDO1 gene is a sequence shown in any one of SEQ ID NOs:9-12 or contains a sequence shown in any one of SEQ ID NOs:9-12.
[0100] 40. The method according to any one of claims 35-39, wherein the target sequence of the ECRG4 gene is a sequence shown in any one of SEQ ID NOs:13-16 or contains a sequence shown in any one of SEQ ID NOs:13-16.
[0101] 41. The method according to any one of items 35-40, wherein the target sequence of the ZNF132 gene is a sequence shown in any one of SEQ ID NOs:17-20 or contains a sequence shown in any one of SEQ ID NOs:17-20.
[0102] 42. The method according to any one of items 35-41, wherein the target sequence of the IFFO1 gene is a sequence shown in any one of SEQ ID NOs:21-24 or contains a sequence shown in any one of SEQ ID NOs:21-24.
[0103] 43. The method according to item 36, wherein the reagent is a bisulfite reagent.
[0104] 44. The method according to item 36, wherein the primer is:
[0105] A fragment consisting of at least 9 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0106] A fragment consisting of at least nine nucleotides from SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0107] A fragment consisting of at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0108] A fragment consisting of at least 9 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0109] A fragment consisting of at least 9 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0110] A fragment of at least 9 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0111] 45. The method according to item 36, wherein the probe is:
[0112] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0113] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0114] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0115] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0116] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0117] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0118] 46. The method according to claim 36, wherein the primer is a sequence as shown in SEQ ID NO:25 and SEQ ID NO:26, or a sequence as shown in SEQ ID NO:27 and SEQ ID NO:28, or a sequence as shown in SEQ ID NO:29 and SEQ ID NO:30, or a sequence as shown in SEQ ID NO:31 and SEQ ID NO:32, or a sequence as shown in SEQ ID NO:33 and SEQ ID NO:34, or a sequence as shown in SEQ ID NO:35 and SEQ ID NO:36.
[0119] 47. The method according to item 36, wherein the probe is a sequence as shown in SEQ ID NO:37, or a sequence as shown in SEQ ID NO:38, or a sequence as shown in SEQ ID NO:39, or a sequence as shown in SEQ ID NO:40, or a sequence as shown in SEQ ID NO:41, or a sequence as shown in SEQ ID NO:42.
[0120] 48. A methylation marker for in vitro esophageal cancer minimal residual disease, wherein the methylation marker is selected from one or more of the TLX1 gene, NID2 gene, DIDO1 gene, ECRG4 gene, ZNF132 gene and IFFO1 gene;
[0121] Preferably, the target sequence of the TLX1 gene is a sequence as shown in any one of SEQ ID NOs:1-4 or contains a sequence as shown in any one of SEQ ID NOs:1-4; and / or
[0122] The target sequence of the NID2 gene is a sequence shown in any one of SEQ ID NOs:5-8 or contains any one of SEQ ID NOs:5-8; and / or
[0123] The target sequence of the DIDO1 gene is a sequence shown in any one of SEQ ID NOs:9-12 or contains a sequence shown in any one of SEQ ID NOs:9-12; and / or
[0124] The target sequence of the ECRG4 gene is a sequence shown in any one of SEQ ID NOs:13-16 or contains a sequence shown in any one of SEQ ID NOs:13-16; and / or
[0125] The target sequence of the ZNF132 gene is a sequence shown in any one of SEQ ID NOs:17-20 or contains a sequence shown in any one of SEQ ID NOs:17-20; and / or
[0126] The target sequence of the IFFO1 gene is a sequence shown in any one of SEQ ID NOs:21-24 or contains any one of SEQ ID NOs:21-24.
[0127] This application has the following beneficial effects:
[0128] This application identified six biomarkers capable of sensitively and specifically detecting minimal residual disease (MRD) in esophageal cancer and determined the methylation regions of these biomarkers. By detecting the target sequences of methylated genes TLX1, NID2, DIDO1, ECRG4, ZNF132, or IFFO1, the methylation status of these genes can be sensitively and specifically detected, thus enabling the detection of cell-free DNA in peripheral blood. Testing of peripheral blood samples from patients with MRD and healthy controls showed that the composition and detection method described in this application can sensitively and specifically detect MRD in esophageal cancer, ensuring the accuracy and reliability of the results. Therefore, this application provides a composition, kit, and detection method for the in vitro detection of MRD in esophageal cancer, which can conveniently, rapidly, and effectively detect MRD and has significant clinical application value.
[0129] This application utilizes epigenomics and bioinformatics techniques to analyze genomic methylation data of minimal residual disease (MRD) in esophageal cancer, identifying six methylation genes associated with MRD and determining the target sequences for abnormal methylation of these genes. Furthermore, by using these target sequences of the six methylation genes, the methylation status of the genes can be sensitively and specifically detected, which can then be used for the detection of cell-free DNA in peripheral blood.
[0130] The composition described in this application is used in a non-invasive manner for screening asymptomatic individuals, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy, enabling real-time monitoring. Detailed Implementation
[0131] The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.
[0132] Unless otherwise stated, the implementation of this application will employ conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which fall within the scope of conventional techniques in the art. Such techniques are described in detail in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (MJ Gait, 1984); *Animal Cell Culture* (RI Freshney, 1987); *Methods in Enzymology* (Academic Publishing, Inc.); *Current Protocols in Molecular Biology* (FMAusubel et al., 1987, and regularly updated); and *PCR: The Polymerase Chain Reaction* (Mullis et al., 1994). The primers, probes, and kits used in this application can be prepared using standard techniques known in the art.
[0133] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0134] definition
[0135] In this application, "stringent hybridization conditions" and "highly stringent" refer to the conditions under which the probe hybridizes with its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary under different conditions. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques – Nucleic Acid Probe Hybridization, “A Review of Hybridization Principles and Nucleic Acid Assay Strategies.” Typically, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At Tm (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target sequence hybridizes uniformly with the target sequence. Stringent conditions can also be achieved by adding a destabilizing agent. For selective or specific hybridization, the positive signal is twice, preferably ten times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridization at 65°C in a solution of 5x SSC and 1% SDS, followed by washing at 65°C in a solution of 0.2x SSC and 0.1% SDS.
[0136] Furthermore, if the peptides encoded by the nucleic acids are substantially similar, the nucleic acids that cannot hybridize under stringent conditions are still substantially similar. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, “moderately stringent hybridization conditions” include hybridization at 37°C in a solution of 40% formamide, 1M sodium chloride, and 1% SDS, followed by washing at 45°C in a solution of 1xSSC. Those skilled in the art will readily obtain guidance in the prior art for achieving conditions with the same stringency. For PCR, temperatures around 36°C are typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For highly stringent PCR amplification, it is generally at 62°C, while annealing temperatures for highly stringent hybridization range from 50°C to 65°C depending on primer length and specificity. Typical cycling conditions for both high-strict and low-strict amplification include: a sustained denaturation phase of 30 seconds to 2 minutes at 90–95°C, a sustained annealing phase of 30 seconds to 2 minutes, and a sustained expansion phase of 1 to 2 minutes at approximately 72°C. Tools and instructions for low- and high-strict amplification reactions are available in the prior art.
[0137] In this application, "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides. Its precise size can depend on many factors, which in turn are determined by the final function and use of the oligonucleotide. In some embodiments, the oligonucleotide may comprise a length of 10 to 100 nucleotides. In some embodiments, the oligonucleotide may comprise a length of 10 to 30 nucleotides, or may have a length of 20 or 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.
[0138] In this application, "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of a primer extension complementary to a nucleic acid strand—namely, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a starting point for synthesis, whether it is naturally occurring in purified restriction digests or synthetically produced. Primers can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, 15, 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but they may contain fewer or more nucleotides. Factors involved in determining the appropriate primer length are well known to those skilled in the art.
[0139] In this application, "primer pair" refers to a primer pair that hybridizes with the opposite strand of the target DNA molecule or with a target DNA region flanking the nucleotide sequence to be amplified.
[0140] In this application, "primer site" refers to the region of the target DNA or other nucleic acid to which the primer hybridizes.
[0141] In this application, the term "probe," when referring to a nucleic acid sequence, is used in its usual sense to mean a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. Those skilled in the art will understand that, in certain circumstances, a probe can also be used as a primer, and a primer can be used as a probe.
[0142] In this application, "DNA methylation" refers to the addition of a methyl group to the 5th position of cytosine (C), which is typically (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. As used herein, "increased degree of methylation" or "significant degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample, or a DNA sample treated with methylation of DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.
[0143] In the implementation scheme, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using Southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), and methylation-specific microarrays (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.
[0144] In this application, "methylation assay" refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.
[0145] In this application, "detection" refers to any process of observing a biomarker or a change in a biomarker (e.g., a change in the methylation state of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or the change in the biomarker is actually detected. In other words, the act of detecting a biomarker or a change in a biomarker in a sample is "detection," even if the biomarker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation and can be based on comparison with one or more control samples.
[0146] In this application, "homology," "identity," and "similarity" refer to the sequence similarity between two nucleic acid molecules. Homology, identity, or similarity can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection available online, for example, from the National Center for Biotechnology Information (NCBI), if their sequences exhibit approximately 60% identity in the specified region, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence within a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.
[0147] In this application, "amplification" refers to the process of obtaining multiple copies of a nucleic acid from a specific locus, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known methods, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).
[0148] This application's "fluorescence-based real-time PCR" describes a method that involves adding a fluorescent group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally performing quantitative analysis of unknown templates using a standard curve. A crucial concept in this PCR technique is the cycle threshold, also known as the Ct value. C stands for Cycle, and t stands for threshold. The Ct value represents the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. For example, the fluorescence threshold can be set as follows: the fluorescence signal from the first 15 cycles of the PCR reaction is used as the fluorescence background signal, and the default setting for the fluorescence threshold is 10 times the standard deviation of the fluorescence signal from 3 to 15 cycles.
[0149] The "cut-off value" of real-time PCR in this application refers to a critical Ct value for determining the positivity or positivity of a sample for a specific biomarker. According to certain specific real-time methods in this application, "the critical Ct value (Cut-off value) is obtained based on a certain number of sample data and statistical processing," and this critical Ct value can vary depending on the required sensitivity or specificity.
[0150] In this application, "sensitivity" refers to the proportion of cancer detected in a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancers / all cancers), while "specificity" refers to the proportion of normal samples detected in a certain normal sample, and its calculation formula is: Specificity = (detected negatives / total negatives).
[0151] The “label” or “detectable part” in this application refers to a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens, and proteins that can be prepared as detectable proteins, for example, by incorporating radiolabels into peptides or antibodies for detecting peptide-specific reactions.
[0152] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides capable of amplifying target nucleic acids (e.g., oligonucleotide primers) can be used in PCR reactions. PCR methods typically include the following steps: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize with the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. Various improvements to basic PCR techniques have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). In the amplification reaction, the primer pair must anneal to the opposite strands of the template nucleic acid and should be kept at an appropriate distance from each other so that the polymerase can efficiently polymerize across regions and so that the amplification product can be easily detected, for example, by electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to facilitate the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9–30, 40, or 50 nucleotides in length (e.g., lengths of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides), but oligonucleotide primers can be longer or shorter, provided appropriate amplification conditions are used.
[0153] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label," when referring to nucleic acids, is intended to include both direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent that has directly labeled the detectable substance. Detectable substances include a variety of enzymes, prosthetic groups, fluorescent materials, cryoluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include avidin / streptin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, luciferin, luciferin isothiocyanate, rhodamine, dichlorotriazineamine luciferin, dansyl chloride, or phycoerythrin; examples of cryoluminescent materials include luminol; and examples of bioluminescent materials include luciferase, insect luciferin, and jellyfish protein. Examples of indirect labeling include end-labeling of nucleic acids with biotin, making the nucleic acid detectable using fluorescently labeled avidin streptavidin.
[0154] Overview
[0155] On one hand, this application provides a composition for in vitro detection of minimal residual disease in esophageal cancer, the composition comprising nucleic acid for detecting the methylation status of a target sequence of a target gene, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is selected from one or more of the following genes: TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1.
[0156] This application provides a set of target sequences for target genes that produce abnormal methylation in minimal residual disease lesions of esophageal cancer. The target sequences of the target genes are selected from one or more target sequences of the TLX1 gene, NID2 gene, DIDO1 gene, ECRG4 gene, ZNF132 gene, and IFFO1 gene. Specifically, the target sequence of the TLX1 gene is a sequence shown in any one of SEQ ID NOs:1-4 or contains any one of SEQ ID NOs:1-4; and / or the target sequence of the NID2 gene is a sequence shown in any one of SEQ ID NOs:5-8 or contains any one of SEQ ID NOs:5-8; and / or the target sequence of the DIDO1 gene is a sequence shown in any one of SEQ ID NOs:9-12 or contains any one of SEQ ID NOs:9-12; and / or the target sequence of the ECRG4 gene is a sequence shown in any one of SEQ ID NOs:13-16 or contains any one of SEQ ID NOs:1-14. The sequence shown in any one of NOs:13-16; and / or the target sequence of the ZNF132 gene as shown in any one of SEQ ID NOs:17-20 or containing any one of SEQ ID NOs:17-20; and / or the target sequence of the IFFO1 gene as shown in any one of SEQ ID NOs:21-24 or containing any one of SEQ ID NOs:21-24.
[0157] Those skilled in the art will also understand that the target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes are not limited to the specific sequences listed above. The target sequence of the TLX1 gene should encompass sequences containing one, two, or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:1-4, but still substantially functionally identical, and also includes sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:1-4. The target sequence of the NID2 gene should encompass sequences containing one, two, or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:5-8, but still substantially functionally identical, and also includes sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:5-8. The target sequence of the DIDO1 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:9-12, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:9-12. The target sequence of the ECRG4 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:13-16, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:13-16. The target sequence of the ZNF132 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:17-20, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:17-20. The target sequence of the IFFO1 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs:21-24, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs:21-24.
[0158] The target sequence (5'-3') of the TLX1 gene is as follows:
[0159] GCACCCTCTGGCACGCTGCACCCTCTGGCACGCTGCACCCTCCCGCACATCTGGCCCTTGCCCGCCGGAGTTTCTCCCCTAGCTCAGGCCCCATGGGGTAGCGCGGGAGAGTCTGGGCGAAGTC GGCGGCGCCGAGACGGGCGGGCCTTGGGGCAGGAGGAAGGAATTGGAGTTTCCTCTTTTTCTGAACGAAGGCGAGGAATCTGCCTGGGATTCCGCCTACGGGGCCACAAAGGAAGCCATG(SEQ ID NO:1)
[0160] The target sequence of the TLX1 gene after bisulfite treatment (5'-3') is as follows:
[0161] GTATTTTTTGGTACGTTGTATTTTTTGGTACGTTGTATTTTTTCGTATATTTGGTTTTTGTTCGTCGGAGTTTTTTTTTAGTTTAGGTTTTATGGGGTAGCGCGGGAGAGTTTGGGCGAAGTC GGCGGCGTCGAGACGGGCGGGTTTTGGGGTAGGAGGAAGGAATTGGAGTTTTTTTTTTTTTTGAACGAAGGCGAGGAATTTGTTTGGGATTTCGTTTACGGGGTTATAAAGGAAGTTATG(SEQ ID NO:2)
[0162] The inverse complementary sequence (5'-3') of the target sequence of the TLX1 gene is as follows:
[0163] CATGGCTTCCTTTGTGGCCCCGTAGGCGGAATCCCAGGCAGATTCCTCGCCTTCGTTCAGAAAAAGAGGAAACTCCAATTCCTTCCTCCTGCCCCAAGGCCCGCCCGTCTCGGCGCCGCCGACT TCGCCCAGACTCTCCCGCGCTACCCCATGGGGCCTGAGCTAGGGGAGAAACTCCGGCGGGCAAGGGCCAGATGTGCGGGAGGGTGCAGCGTGCCAGAGGGTGCAGCGTGCCAGAGGGTGC(SEQ ID NO:3)
[0164] The reverse complementary sequence of the target sequence of the TLX1 gene after bisulfite treatment (5'-3') is as follows:
[0165] TATGGTTTTTTTTGTGGTTTCGTAGGCGGAATTTTAGGTAGATTTTTCGTTTTCGTTTAGAAAAAGAGGAAATTTTAATTTTTTTTTTTTGTTTTAAGGTTCGTTCGTTTCGGCGTCGTCGATTTCGTTTAGATTTTTTCGCGTTATTTTATGGGGTTTGAGTTAGGGGAGAAATTTCGGCGGGTAAGGGTTAGATGTGCGGGAGGGTGTAGCGTGTTAGAGGGTGTAGCGTGTTAGAGGGTGT(SEQ ID NO:4)
[0166] The target sequence (5'-3') of the NID2 gene is as follows:
[0167] CTGGCCGCCCTAGCAACGCCACCTTTTCTGCCTGGGACGCGTACGTGGCTGCGAACAATTCTTGCTCTCCCCTCCAGGTCATTCTTGCTCCCCTACAGCAGCGGGGCAGGCAGCGGCATCGCTCTCTGGCCGGGTACCACCGCAAGGGTGCTGGGGGGCTCCAGGAGTGGGGTCTGTTTCCTCCCCTCTGGAGGCAGGGTTTCCGTGAGACCGACCCCAGGGAAGAAGCTGCGGGAAAAGTGC(SEQ ID NO:5)
[0168] The sequence of the target sequence of the NID2 gene after bisulfite treatment (5'-3') is as follows:
[0169] TTGGTCGTTTTAGTAACGTTATTTTTTTTGTTTGGGACGCGTACGTGGTTGCGAATAATTTTTGTTTTTTTTTTTAGGTTATTTTTGTTTTTTTATAGTAGCGGGGTAGGTAGCGGTATCGTTTTTTGGTCGGGTATTATCGTAAGGGTGTTGGGGGGTTTTAGGAGTGGGGTTTGTTTTTTTTTTTTTGGAGGTAGGGTTTTCGTGAGATCGATTTTAGGGAAGAAGTTGCGGGAAAAGTGT(SEQ ID NO:6)
[0170] The inverse complementary sequence (5'-3') of the target sequence of the NID2 gene is as follows:
[0171] GCACTTTTCCCGCAGCTTCTTCCCTGGGGTCGGTCTCACGGAAACCCTGCCTCCAGAGGGGAGGAAACAGACCCACTCCTGGAGCCCCCCAGCACCCTTGCGGTGGTACCCGGCCAGAGAGC GATGCCGCTGCCTGCCCCGCTGCTGTAGGGGAGCAAGAATGACCTGGAGGGGAGAGCAAGAATTGTTCGCAGCCACGTACGCGTCCCAGGCAGAAAAGGTGGCGTTGCTAGGGCGGCCAG(SEQ ID NO:7)
[0172] The reverse complementary sequence of the NID2 gene target sequence after bisulfite treatment (5'-3') is as follows:
[0173] GTATTTTTTTCGTAGTTTTTTTTGGGGTCGGTTTTACGGAAATTTTGTTTTTAGAGGGGAGGAAATAGATTTTATTTTTGGAGTTTTTTAGTATTTTTGCGGTGGTATTCGGTTAGAGAGC GATGTCGTTGTTTGTTTCGTTGTTGTAGGGGAGTAAGAATGATTTGGAGGGGAGAGTAAGAATTGTTCGTAGTTACGTACGCGTTTTAGGTAGAAAAGGTGGCGTTGTTAGGGCGGTTAG(SEQ ID NO:8)
[0174] The target sequence (5'-3') of the DIDO1 gene is as follows:
[0175] CTTTCCGCTGTTATAAGCCTCCTTCCTAAGACTCAGGGTCCGCAGCAGAATACCCTGACCCAAAATAAAAATACTATGACAAAAATACTCCAGGAGGCAGCCGGCTTTACTTCGTTTAAAGCCGGATTTCGCTTAGTCCCGTGAAAGCGAAGGAGCACCAGCGCTTCCTGATTCCGCACAGTTCTCTCGGCAGAGACGGCCCGTCCTCTCCAAGAACCGGAAGCCGGACAGCGTCAGGACGTTTTATTCTTCTCACCTGGGATTCAGAGAGGCAGCGGCCAAGGACAGGGCCCCCGCCGAGGCCACCGGGCAGCGTCCAGGTCTCGGCCTTTGGGAGGGGAG(SEQ ID NO:9)
[0176] The sequence (5'-3') of the target sequence of the DIDO1 gene after bisulfite treatment is as follows:
[0177] TTTTTCGTTGTTATAAGTTTTTTTTTTAAGATTTAGGGTTCGTAGTAGAATATTTTGATTTAAAATAAAAATATTATGATAAAAATATTTTAGGAGGTAGTCGGTTTTATTTCGTTTAAAGTCGGATTTCGTTTAGTTTCGTGAAAGCGAAGGAGTATTAGCGTTTTTTGATTTCGTATAGTTTTTTCGGTAGAGACGGTTCGTTTTTTTTAAGAATCGGAAGTCGGATAGCGTTAGGACGTTTTATTTTTTTTATTTGGGATTTAGAGAGGTAGCGGTTAAGGATAGGGTTTTCGTCGAGGTTATCGGGTAGCGTTTAGGTTTCGGTTTTTGGGAGGGGAG(SEQ ID NO:10)
[0178] The reverse complementary sequence (5'-3') of the target sequence of the DIDO1 gene is as follows:
[0179] CTCCCCTCCCAAAGGCCGAGACCTGGACGCTGCCCGGTGGCCTCGGCGGGGGCCCTGTCCTTGGCCGCTGCCTCTCTGAATCCCAGGTGAGAAGAATAAAACGTCCTGACGCTGTCCGGCTTCCGGTTCTTGGAGAGGACGGGCCGTCTCTGCCGAGAGAACTGTGCGGAATCAGGAAGCGCTGGTGCTCCTTCGCTTTCACGGGACTAAGCGAAATCCGGCTTTAAACGAAGTAAAGCCGGCTGCCTCCTGGAGTATTTTTGTCATAGTATTTTTATTTTGGGTCAGGGTATTCTGCTGCGGACCCTGAGTCTTAGGAAGGAGGCTTATAACAGCGGAAAG(SEQ ID NO:11)
[0180] The reverse complementary sequence of the target sequence of the DIDO1 gene after bisulfite treatment (5'-3') is as follows:
[0181] TTTTTTTTTTAAAGGTCGAGATTTGGACGTTGTTCGGTGGTTTCGGCGGGGGTTTTGTTTTTGGTCGTTGTTTTTTTGAATTTTAGGTGAGAAGAATAAAACGTTTTGACGTTGTTCGGTTTTCGGTTTTTGGAGAGGACGGGTCGTTTTTGTCGAGAGAATTGTGCGGAATTAGGAAGCGTTGGTGTTTTTTCGTTTTTACGGGATTAAGCGAAATTCGGTTTTAAACGAAGTAAAGTCGGTTGTTTTTTGGAGTATTTTTGTTATAGTATTTTTATTTTGGGTTAGGGTATTTTGTTGCGGATTTTGAGTTTTAGGAAGGAGGTTTATAATAGCGGAAAG(SEQ ID NO:12)
[0182] The target sequence of the ECRG4 gene (5'-3') is as follows:
[0183] AACAGTGGCGCGGCTGGGGCGGGCGGAGGAAGTGGGGGAGCCAAGGAGACACCCCAGCGCTGGGATCCGGCAAGTCCTCCCTCTGAGTGGCCAGGGGGCCTCGTCCCTTCTCCCGATGCCTTCTGCCCTTCCTTGGGTCTCCGGAACCCAGCTTGTCCTAACCGCTTTCGCTGCGGGCAGCGCTGGCCACGCGGCCCCCGCCGCCGGCGGTTCTCCGTGGCCAAGCATCCTTGGCCTTGGAGCCCAGGGGCTGCGTTCCCCTTGGGGCCGGGGCGGGAGAGAGGACCTCGGTGGTACTCGCCCGTGCGCTGGGCGCAG(SEQ ID NO:13)
[0184] The sequence of the target sequence of the ECRG4 gene after bisulfite treatment (5'-3') is as follows:
[0185] AATAGTGGCGCGGTTGGGGCGGGCGGAGGAAGTGGGGGAGTTAAGGAGATATTTTAGCGTTGGGATTCGGTAAGTTTTTTTTTTGAGTGGTTAGGGGGTTTCGTTTTTTTTTTCGATGTTTTTTGTTTTTTTTTGGGTTTTCGGAATTTAGTTTGTTTTAATCGTTTTCGTTGCGGGTAGCGTTGGTTACGCGGTTTTCGTCGTCGGCGGTTTTTCGTGGTTAAGTATTTTTGGTTTTGGAGTTTAGGGGTTGCGTTTTTTTTGGGGTCGGGGCGGGAGAGAGGATTTCGGTGGTATTCGTTCGTGCGTTGGGCGTAG(SEQ ID NO:14)
[0186] The reverse complementary sequence of the target sequence of the ECRG4 gene (5'-3') is as follows:
[0187] CTGCGCCCAGCGCACGGGCGAGTACCACCGAGGTCCTCTCTCCCGCCCCGGCCCCAAGGGGAACGCAGCCCCTGGGCTCCAAGGCCAAGGATGCTTGGCCACGGAGAACCGCCGGCGGCGGGGGCCGCGTGGCCAGCGCTGCCCGCAGCGAAAGCGGTTAGGACAAGCTGGGTTCCGGAGACCCAAGGAAGGGCAGAAGGCATCGGGAGAAGGGACGAGGCCCCCTGGCCACTCAGAGGGAGGACTTGCCGGATCCCAGCGCTGGGGTGTCTCCTTGGCTCCCCCACTTCCTCCGCCCGCCCCAGCCGCGCCACTGTT(SEQ ID NO:15)
[0188] The reverse complementary sequence of the target sequence of the ECRG4 gene after bisulfite treatment (5'-3') is as follows:
[0189] TTGCGTTTAGCGTACGGGCGAGTATTATCGAGGTTTTTTTTTTCGTTTCGGTTTTAAGGGGAACGTAGTTTTTGGGTTTTAAGGTTAAGGATGTTTGGTTACGGAGAATCGTCGGCGGCGGGGGTCGCGTGGTTAGCGTTGTTCGTAGCGAAAGCGGTTAGGATAAGTTGGGTTTCGGAGATTTAAGGAAGGGTAGAAGGTATCGGGAGAAGGGACGAGGTTTTTTGGTTATTTAGAGGGAGGATTTGTCGGATTTTAGCGTTGGGGTGTTTTTTTGGTTTTTTTATTTTTTTCGTTCGTTTTAGTCGCGTTATTGTT(SEQ ID NO:16)
[0190] The target sequence of the ZNF132 gene (5'-3') is as follows:
[0191] TGCGTGTGAAGGCGCGGTGACGGTCCCTGCACCCACTCCCGTGCCCTGGTGTGGCTCCAGAGGCCTGCTGTAGCCCAACCCACCAGCAGCAAAATGAGGACCGCAATGGCGGCGCCGGAAGTCCCGCCTCTCAATGACAGCTCGGACTTGCCACTGGTCCGAGCTTTCATTGGCTCAAGGATCCCCGCCGTCTATGACGCTATTTCCCTATGCCCGTCACGCTACTGCTAGGTCGTTGCCAAGGTGATTGAGGAATGGCGTTTATTGCGTCGCTGCTCAGGCAACGCAAACTACATTATCCAGAAGGACCCTCGCGGTGCCTCAGGGCTGGCCATTGGCAGCCGAGGAGACAGGCACTTCCGGGCGGAGTGTAAGACGCTGGCCAATCACAGCCTGGCAGCGGGACTTCCGTCGTCGTCCTCGGACCATCACTTTGGCATTTCTCGATTTTGTCTGCTTCTGAAGGGACCGCGTTGTCAGGCGAGGGACGGAATCTTGGAGGCTCCCTGGGCCCATGGAAACAGGAGCGAGGAAGGCACGAGAGTCGGGGAAGTTCCGCCTTCTTGACATACAAGCGCCCCCACCGCGGCG(SEQ IDNO:17)
[0192] The sequence (5'-3') of the target sequence of the ZNF132 gene after bisulfite treatment is as follows:
[0193] TGCGTGTGAAGGCGCGGTGACGGTTTTTGTATTTATTTTCGTGTTTTGGTGTGGTTTTAGAGGTTTGTTGTAGTTTAATTTATTAGTAGTAAAATGAGGATCGTAATGGCGGCGTCGGAAGTTTCGTTTTTTAATGATAGTTCGGATTTGTTATTGGTTCGAGTTTTTATTGGTTTAAGGATTTTCGTCGTTTATGACGTTATTTTTTTATGTTCGTTACGTTATTGTTAGGTCGTTGTTAAGGTGATTGAGGAATGGCGTTTATTGCGTCGTTGTTTAGGTAACGTAAATTATATTATTTAGAAGGATTTTCGCGGTGTTTTAGGGTTGGTTATTGGTAGTCGAGGAGATAGGTATTTTCGGGCGGAGTGTAAGACGTTGGTTAATTATAGTTTGGTAGCGGGATTTTCGTCGTCGTTTTCGGATTATTATTTTGGTATTTTTCGATTTTGTTTGTTTTTGAAGGGATCGCGTTGTTAGGCGAGGGACGGAATTTTGGAGGTTTTTTGGGTTTATGGAAATAGGAGCGAGGAAGGTACGAGAGTCGGGGAAGTTTCGTTTTTTTGATATATAAGCGTTTTTATCGCGGCG(SEQ IDNO:18)
[0194] The reverse complementary sequence (5'-3') of the target sequence of the ZNF132 gene is as follows:
[0195] CGCCGCGGTGGGGGCGCTTGTATGTCAAGAAGGCGGAACTTCCCCGACTCTCGTGCCTTCCTCGCTCCTGTTTCCATGGGCCCAGGGAGCCTCCAAGATTCCGTCCCTCGCCTGACAACGCGGTCCCTTCAGAAGCAGACAAAATCGAGAAATGCCAAAGTGATGGTCCGAGGACGACGACGGAAGTCCCGCTGCCAGGCTGTGATTGGCCAGCGTCTTACACTCCGCCCGGAAGTGCCTGTCTCCTCGGCTGCCAATGGCCAGCCCTGAGGCACCGCGAGGGTCCTTCTGGATAATGTAGTTTGCGTTGCCTGAGCAGCGACGCAATAAACGCCATTCCTCAATCACCTTGGCAACGACCTAGCAGTAGCGTGACGGGCATAGGGAAATAGCGTCATAGACGGCGGGGATCCTTGAGCCAATGAAAGCTCGGACCAGTGGCAAGTCCGAGCTGTCATTGAGAGGCGGGACTTCCGGCGCCGCCATTGCGGTCCTCATTTTGCTGCTGGTGGGTTGGGCTACAGCAGGCCTCTGGAGCCACACCAGGGCACGGGAGTGGGTGCAGGGACCGTCACCGCGCCTTCACACGCA(SEQ IDNO:19)
[0196] The reverse complementary sequence of the target sequence of the ZNF132 gene after bisulfite treatment (5'-3') is as follows:
[0197] CGTCGCGGTGGGGGCGTTTGTATGTTAAGAAGGCGGAATTTTTTCGATTTTCGTGTTTTTTTCGTTTTTGTTTTTATGGGTTTAGGGAGTTTTTAAGATTTCGTTTTTCGTTTGATAACGCGGTTTTTTTAGAAGTAGATAAAATCGAGAAATGTTAAAGTGATGGTTCGAGGACGACGACGGAAGTTTCGTTGTTAGGTTGTGATTGGTTAGCGTTTTATATTTCGTTCGGAAGTGTTTGTTTTTTCGGTTGTTAATGGTTAGTTTTGAGGTATCGCGAGGGTTTTTTTGGATAATGTAGTTTGCGTTGTTTGAGTAGCGACGTAATAAACGTTATTTTTTAATTATTTTGGTAACGATTTAGTAGTAGCGTGACGGGTATAGGGAAATAGCGTTATAGACGGCGGGGATTTTTGAGTTAATGAAAGTTCGGATTAGTGGTAAGTTCGAGTTGTTATTGAGAGGCGGGATTTTCGGCGTCGTTATTGCGGTTTTTATTTTGTTGTTGGTGGGTTGGGTTATAGTAGGTTTTTGGAGTTATATTAGGGTACGGGAGTGGGTGTAGGGATCGTTATCGCGTTTTTATACGTA(SEQ IDNO:20)
[0198] The target sequence (5'-3') of the IFFO1 gene is as follows:
[0199] GGGCAAGTCTCCTCCCCCGGCGAAGTGGTCGCCTCCCAGTGAGTCCCCCAGTGGCCCGGCCAGGCCCTGCTGCTCCTGCTGCAGGAGGAAGAGGTTGGGGCCGAATAACGGATTCATGGCTGCGCCTTCTGCTGGGAGATGCAGACCGGTGCAGGAGCAGGGATGGAAGGCGAGCCAGAAGAGCCAATGCGGCGCCGGCGGGACAGAGCCGACCAATCAGGCGGCTCGGCAGCGGGGCAGAGGTCAGGGGGCGGGCCGAGGGGAAGCCAATGACAGGCTCCAATTGGAGGCCGGACCCTGGACCTTTCCGGGTCTGAGGCCGAGCCCTGTGATGAGGGGAGCCACCGCCTGGACTCCAG(SEQ ID NO:21)
[0200] The sequence of the target sequence of the IFFO1 gene after bisulfite treatment (5'-3') is as follows:
[0201] GGGTAAGTTTTTTTTTTCGGCGAAGTGGTCGTTTTTTAGTGAGTTTTTTAGTGGTTCGGTTAGGTTTTGTTGTTTTTGTTGTAGGAGGAAGAGGTTGGGGTCGAATAACGGATTTATGGTTGCGTTTTTTGTTGGGAGATGTAGATCGGTGTAGGAGTAGGGATGGAAGGCGAGTTAGAAGAGTTAATGCGGCGTCGGCGGGATAGAGTCGATTAATTAGGCGGTTCGGTAGCGGGGTAGAGGTTAGGGGGCGGGTCGAGGGGAAGTTAATGATAGGTTTTAATTGGAGGTCGGATTTTGGATTTTTTCGGGTTTGAGGTCGAGTTTTGTGATGAGGGGAGTTATCGTTTGGATTTTAG(SEQ ID NO: twenty-two)
[0202] The reverse complementary sequence of the target sequence of the IFFO gene (5'-3') is as follows:
[0203] CTGGAGTCCAGGCGGTGGCTCCCCTCATCACAGGGCTCGGCCTCAGACCCGGAAAGGTCCAGGGTCCGGCCTCCAATTGGAGCCTGTCATTGGCTTCCCCTCGGCCCGCCCCTGACCTCTGCCCCGCTGCCGAGCCGCCTGATTGGTCGGCTCTGTCCCGCCGGCGCCGCATTGGCTCTT CTGGCTCGCCTTCCATCCCTGCTCCTGCACCGGTCTGCATCTCCCAGCAGAAGGCGCAGCCATGAATCCGTTATTCGGCCCCAACCTCTTCCTCCTGCAGCAGGAGCAGCAGGGCCTGGCCGGGCCACTGGGGGACTCACTGGGAGGCGACCACTTCGCCGGGGGAGGAGACTTGCCC(SEQ ID NO:23)
[0204] The reverse complementary sequence of the target sequence of the IFFO1 gene after bisulfite treatment (5'-3') is as follows:
[0205] TTGGAGTTTAGGCGGTGGTTTTTTTTATAGGGTTCGGTTTTAGATTCGGAAAGGTTTAGGGTTCGGTTTTTAATTGGAGTTTGTTATTGGTTTTTTTCGTTCGTTTTTTGATTTTTGTTTCGTTGTCGAGTCGTTTGATTGGTCGGTTTTGTTTCGTCGGCGTCGTATTGGTTTT TTGGTTCGTTTTTTATTTTTGTTTTTGTATCGGTTTGTATTTTTTAGTAGAAGGCGTAGTTATGAATTCGTTATTCGGTTTTAATTTTTTTTTTTTGTAGTAGGAGTAGTAGGGTTTGGTCGGGTTATTGGGGGGATTTATTGGGAGGCGATTATTTCGTCGGGGGAGGAGATTTGTTT(SEQ ID NO:24)
[0206] The target sequences and related sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes are shown in Table 1.
[0207] Table 1: Target sequences and related sequences of each gene
[0208] Target sequence name Serial Number Target sequence of TLX1 gene SEQ ID NO:1 The target sequence of the TLX1 gene after bisulfite treatment SEQ ID NO:2 Complementary sequence of the target sequence of the TLX1 gene SEQ ID NO:3 The complementary sequence of the target sequence of the TLX1 gene after bisulfite treatment. SEQ ID NO:4 NID2 gene target sequence SEQ ID NO:5 The target sequence of the NID2 gene after bisulfite treatment SEQ ID NO:6 Complementary sequence of the target sequence of the NID2 gene SEQ ID NO:7 The complementary sequence of the target sequence of the NID2 gene after bisulfite treatment. SEQ ID NO:8 Target sequence of the DIDO1 gene SEQ ID NO:9 The target sequence of the DIDO1 gene after bisulfite treatment SEQ ID NO:10 complementary sequence of the target sequence of the DIDO1 gene SEQ ID NO:11 The complementary sequence of the target sequence of the DIDO1 gene after bisulfite treatment. SEQ ID NO:12 ECRG4 gene target sequence SEQ ID NO:13 The target sequence of the ECRG4 gene after bisulfite treatment SEQ ID NO:14 Complementary sequence of the target sequence of the ECRG4 gene SEQ ID NO:15 The complementary sequence of the target sequence of the ECRG4 gene after bisulfite treatment. SEQ ID NO:16 ZNF132 gene target sequence SEQ ID NO:17 The target sequence of the ZNF132 gene after bisulfite treatment SEQ ID NO:18 Complementary sequence of the target sequence of the ZNF132 gene SEQ ID NO:19 The complementary sequence of the target sequence of the ZNF132 gene after bisulfite treatment. SEQ ID NO:20 Target sequence of IFFO1 gene SEQ ID NO:21 The target sequence of the IFFO1 gene after bisulfite treatment SEQ ID NO:22 Complementary sequence of the target sequence of the IFFO1 gene SEQ ID NO:23 The complementary sequence of the target sequence of the IFFO1 gene after bisulfite treatment. SEQ ID NO:24
[0209] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the bisulfite-converted sequence of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0210] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene after bisulfite transformation under moderately or strictly controlled conditions, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0211] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil. More preferably, the reagent is a bisulfite.
[0212] Preferably, the composition includes one or more primers and probes as shown in Table 2.
[0213] Preferably, the composition includes one or more primers and probes as shown in Table 2.
[0214] Table 2 Primer and probe sequences used in this application
[0215]
[0216] In Table 2, “F” represents the forward primer; “R” represents the reverse primer; and “P” represents the probe.
[0217] Preferably, the probe sequence used in this application is labeled with fluorescence, which can use fluorescent groups conventional in the art. The 5' end can be labeled with 6-FAM, VIC, Cy5 (hydrophilic) or ROX, and the 3' end can be labeled with BHQ1, BHQ3 or BHQ2. For example, the fluorescent groups used are shown in Table 3.
[0218] Table 3
[0219]
[0220]
[0221] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at position 5 of a gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.
[0222] On the other hand, this application provides oligonucleotides for in vitro detection of minimal residual disease in esophageal cancer, comprising: a fragment of at least nine nucleotides from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence and containing at least one CpG dinucleotide sequence; or
[0223] A fragment consisting of at least nine nucleotides from SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0224] A fragment consisting of at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0225] A fragment consisting of at least 9 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0226] A fragment consisting of at least 9 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or
[0227] A fragment of at least 9 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0228] Preferably, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer comprises: a fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence; or
[0229] A fragment consisting of at least nine nucleotides and containing at least one CpG dinucleotide sequence in the bisulfite-converted sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence; or
[0230] A fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequence; or
[0231] A fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence; or
[0232] A fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence; or
[0233] A fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence.
[0234] The oligonucleotide of this application for in vitro detection of minimal residual disease in esophageal cancer further comprises: a fragment of at least 15 nucleotides hybridized to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequences under moderately or strictly controlled conditions, and containing at least one CpG dinucleotide sequence; or
[0235] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0236] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0237] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0238] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or
[0239] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0240] Preferably, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer comprises: a fragment hybridized to at least 15 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence under moderate or severe conditions, and containing at least one CpG dinucleotide sequence; or
[0241] A fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence obtained by bisulfite conversion of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions; or
[0242] A fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence resulting from the bisulfite conversion of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequence, under moderately or under severe conditions; or
[0243] A fragment containing at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence, and comprising at least one CpG dinucleotide sequence, under moderately or strictly controlled conditions; or
[0244] A fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence obtained by bisulfite conversion of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence under moderately or strictly controlled conditions; or
[0245] A fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence obtained by bisulfite conversion of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence under moderately or strictly controlled conditions.
[0246] In one specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:25 and SEQ ID NO:26. It also includes the sequence of SEQ ID NO:37.
[0247] In another specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:27 and SEQ ID NO:28, and further includes the sequence of SEQ ID NO:38.
[0248] In another specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:29 and SEQ ID NO:30, further including the sequence of SEQ ID NO:39.
[0249] In another specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:31 and SEQ ID NO:32, and further includes the sequence of SEQ ID NO:40.
[0250] In another specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:33 and SEQ ID NO:34, and further includes the sequence of SEQ ID NO:41.
[0251] In another specific embodiment, the oligonucleotide for in vitro detection of minimal residual disease in esophageal cancer includes the sequences of SEQ ID NO:35 and SEQ ID NO:36, and further includes the sequence of SEQ ID NO:42.
[0252] On the other hand, this application provides a kit comprising the aforementioned composition. The kit further comprises at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.
[0253] Typically, the kit also includes a container for holding the patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.
[0254] This application also relates to the use of the above-described composition and oligonucleotides in the preparation of a kit for in vitro detection of minimal residual disease in esophageal cancer.
[0255] This application also relates to the use of one or more genes selected from the TLX1 gene, NID2 gene, DIDO1 gene, ECRG4 gene, ZNF132 gene and IFFO1 gene in the preparation of a kit for in vitro detection of minimal residual disease in esophageal cancer.
[0256] The TLX1 gene, also known as T-cell leukemia homeobox 1, encodes a nuclear transcription factor belonging to the NK-linked or NK-like (NKL) subfamily of homeotype genes. This encoded protein is essential for the normal development of the spleen during embryonic development. It is also involved in the determination of neuronal cell fate.
[0257] The NID2 gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell adhesion protein that binds to type I and type IV collagen as well as laminin, and may be involved in the protection of the basement membrane structure, as well as in regulating cellular behavior and function.
[0258] The DIDO1 gene, short for death inducer-obliterator 1, is located on human chromosome 20q13.33. This gene encodes a protein product belonging to the PHD finger protein family. The primary function of the DIDO1 gene is involved in the regulation of apoptosis (programmed cell death). This regulation plays a crucial role in the cell cycle, differentiation, and apoptosis. Aberrant expression of DIDO1 may affect the survival and proliferation of cancer cells and is associated with certain types of cancer.
[0259] ECRG4, or esophageal cancer-related gene 4, is a potential tumor suppressor gene. It plays a role in suppressing tumors in various tumor cells, including esophageal squamous cell carcinoma, breast cancer, colon cancer, glioma, kidney cancer, and laryngeal cancer, exhibiting low or no expression in these tumor cells, but widespread expression in normal human tissues. Current research suggests that ECRG4's anti-tumor effects may include arresting the tumor cell cycle, promoting apoptosis, and inhibiting cell migration and invasion.
[0260] The protein encoded by the ZNF132 gene contains multiple C2H2-type zinc finger domains, which are typically involved in DNA binding, thereby regulating gene expression. The ZNF132 protein may play an important regulatory role in cell differentiation, development, and stress responses. Previous studies have shown that the expression level of ZNF132 is altered in certain cancer tissues, which may be related to its potential role in cell cycle regulation and tumorigenesis.
[0261] The IFFO1 gene belongs to the intermediate filament family and is a primitive component of the cytoskeleton and nuclear membrane.
[0262] Furthermore, this application provides a method for in vitro detection of minimal residual disease in esophageal cancer, the method comprising the following steps:
[0263] 1) Isolate the target sequence or fragment of the target gene from the biological sample to be tested;
[0264] 2) Determine the methylation status of the target sequence of the target gene;
[0265] 3) The status of biological samples is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of minimal residual lesions of esophageal cancer.
[0266] According to certain preferred embodiments, the method further includes the following steps:
[0267] 1) Extract genomic DNA from the biological sample to be tested;
[0268] 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable.
[0269] 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target sequence of the target gene, so that the target sequence of the treated target gene is amplified to produce an amplification product or is not amplified; if the target sequence of the treated target gene undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated target gene does not undergo DNA polymerization, it will not be amplified.
[0270] 4) Detect the amplification products using probes; and
[0271] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.
[0272] Preferably, the primers typically comprise fragments of the target sequence of the target gene, the target sequence of the target gene comprising fragments that are equivalent to, complementary to, or hybridize under moderate or severe conditions to at least 9 nucleotides selected from any one of SEQ ID NOs: 1-4, or fragments of at least 9 nucleotides selected from any one of SEQ ID NOs: 5-8, or fragments of at least 9 nucleotides selected from any one of SEQ ID NOs: 9-12, or fragments of at least 9 nucleotides selected from any one of SEQ ID NOs: 13-16, or fragments of at least 9 nucleotides selected from any one of SEQ ID NOs: 17-20, or fragments of at least 9 nucleotides selected from any one of SEQ ID NOs: 21-24.
[0273] Preferably, a typical probe comprises a fragment of the target sequence of the target gene, the fragment of the target sequence comprising a fragment that is equivalent to, complementary to, or hybridizes under moderate or severe conditions to at least 15 nucleotides selected from any one of SEQ ID NOs:1-4, or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs:5-8, or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs:9-12, or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs:13-16, or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs:17-20, or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs:21-24.
[0274] Preferably, one or more of the primers and probes are as shown in Table 2 above.
[0275] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.
[0276] Preferably, PCR is used to determine methylation status. Methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of a target gene. Among these, fluorescence-based real-time PCR is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers with overlapping known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence detection amplification level. The fluorescence-based real-time PCR assay can be used as a quantitative test for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe overlapping a specific CpG dinucleotide. A no-offset control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity then replaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that is no longer quenched. Typical reagents used for fluorescence-based real-time PCR analysis may include, but are not limited to: target sequence PCR primers for the target gene; nonspecific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.
[0277] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target sequence of the target gene can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction. Therefore, this provides a non-invasive and rapid in vitro detection method for minimal residual disease in esophageal cancer.
[0278] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.
[0279] This application provides a methylation marker for in vitro esophageal cancer minimal residual disease, wherein the methylation marker is selected from one or more of the TLX1 gene, NID2 gene, DIDO1 gene, ECRG4 gene, ZNF132 gene and IFFO1 gene.
[0280] Preferably, the target sequence of the TLX1 gene is a sequence as shown in any one of SEQ ID NOs:1-4 or contains a sequence as shown in any one of SEQ ID NOs:1-4; and / or
[0281] The target sequence of the NID2 gene is a sequence shown in any one of SEQ ID NOs:5-8 or contains any one of SEQ ID NOs:5-8; and / or
[0282] The target sequence of the DIDO1 gene is a sequence shown in any one of SEQ ID NOs:9-12 or contains a sequence shown in any one of SEQ ID NOs:9-12; and / or
[0283] The target sequence of the ECRG4 gene is a sequence shown in any one of SEQ ID NOs:13-16 or contains a sequence shown in any one of SEQ ID NOs:13-16; and / or
[0284] The target sequence of the ZNF132 gene is a sequence shown in any one of SEQ ID NOs:17-20 or contains a sequence shown in any one of SEQ ID NOs:17-20; and / or
[0285] The target sequence of the IFFO1 gene is a sequence shown in any one of SEQ ID NOs:21-24 or contains any one of SEQ ID NOs:21-24.
[0286] The inventors of this application have discovered that, in esophageal cancer minimal residual disease (MRD) tissue, if the methylation level of the target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes is lower than the cutoff value of 45 (ct), the sample is considered positive. Therefore, this application provides an in vitro method for detecting MRD by detecting the methylation status of the gene target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes in a sample. The method provided by this application can detect MRD non-invasively and rapidly.
[0287] In this application, for a given sample, if the methylation status of one of the target genes is positive, the sample is judged as positive; if the methylation status of both target genes is negative, the sample is judged as negative.
[0288] In this application, no restrictions are placed on the interpretation of whether a sample is negative or positive. The interpretation can be made according to conventional standards in the field. For example, the interpretation can be made according to the size of the ct value of a target gene. For example, in this application, the ct value of the target gene channel is used to determine whether the sample is positive or negative. If ct < 45, it is positive.
[0289] Minimal residual disease (MRD) detection uses highly sensitive technology to detect small amounts of residual tumor cells or DNA in the body after cancer treatment, and is used to assess the risk of recurrence and guide subsequent treatment.
[0290] The detection of minimal residual disease in esophageal cancer described in this application involves detecting changes in the content of ctDNA, the methylation status of a target gene, in esophageal cancer patients who have undergone treatment, to predict the time of recurrence.
[0291] Example
[0292] This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.
[0293] Example 1 Primer and probe testing.
[0294] The screening and confirmation process of markers involved in this embodiment is roughly as follows:
[0295] Bocheng collected blood samples from 21 patients with esophageal cancer before treatment and 20 patients within one month after radical esophagectomy for targeted high-throughput sequencing. The mean methylation value of each CpG site was calculated in both pre-treatment and post-radical esophagectomy patients, and adjacent CpG sites were merged according to the following criteria:
[0296] 1) The distance between adjacent CpG sites is less than or equal to 30 bp, and the mean methylation value of patients before treatment is higher than that of patients after radical surgery;
[0297] 2) The merged interval contains at least 5 CpG sites.
[0298] Calculate methylation levels in patients before and after radical surgery within the combined interval, and screen candidate biomarkers according to the following requirements:
[0299] 1) Screening for a range with a sensitivity of ≥50%, while ensuring at least 70% specificity in radical postoperative patients;
[0300] 2) The mean methylation value of patients after radical surgery was less than 0.04;
[0301] 3) The difference in mean methylation values between patients before treatment and those after radical surgery was greater than 0.01;
[0302] 4) The p-value of methylation values in patients before treatment and after radical surgery was less than 0.05, resulting in 46 differentially methylated regions. Genes with relevant patents or literature reports were selected, ultimately yielding 6 regions, which are the target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes. Primers and probes were then designed based on the target sequences of the TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes. The designed primer and probe sequences are shown in Tables 2 and 3 above.
[0303] The DNA from normal human leukocyte cell lines is usually in a low / unmethylated state and can be used as a negative control. In this example, the amount of DNA used was 15.75 ng / reaction. Fully methylated DNA is in a high / fully methylated state and can be used as a positive control. In this example, the amount of DNA used was 200 pg / reaction. The DNA samples were first transformed with bisulfite. Using the transformed BisDNA as a template, real-time PCR amplification was performed using the primers and probes in Table 2. The β-actin (ACTB) gene was used as an internal control. β-actin gene amplicon was created by using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon was detected using a specific probe. Each sample underwent at least one real-time PCR. In some specific embodiments, two or three real-time PCR detections were performed. The PCR system for primer and probe testing is shown in Table 4 below.
[0304] Table 4. PCR system for primer and probe testing.
[0305]
[0306] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0307] The PCR amplification program used was: 94℃, 20 min; (93℃, 30 s; 57℃, 35 s — read fluorescence signal) 45 cycles; 40℃, 5 s.
[0308] The results are shown in Table 5. When BisDNA of fully methylated DNA was used as a template, the TLX1, NID2, DIDO1, ECRG4, ZNF132 and IFFO1 genes were all effectively amplified. However, when BisDNA of WBC was used as a template, the target genes were not amplified except for the internal reference gene ACTB.
[0309] NoCt indicates no amplification.
[0310] Table 5
[0311]
[0312]
[0313] Example 2
[0314] Genomic DNA was extracted from 79 pre-treatment esophageal cancer plasma samples (3.5 mL) and 51 post-treatment esophageal cancer plasma samples (3.5 mL) without recurrence. After conversion to BisDNA via bisulfite treatment, the PCR reaction was performed according to the system described in Example 1. The Ct values for the target gene sequence in real-time PCR were measured in 38 pre-treatment and 17 post-treatment esophageal cancer plasma samples. The results are shown in Table 8. The sensitivities of detecting esophageal cancer ctDNA using TLX1, NID2, DIDO1, ECRG4, ZNF132, and IFFO1 genes individually were 45.6%, 50.6%, 39.2%, 34.2%, 54.4%, and 91.2%, respectively.
[0315] Table 8
[0316] markers Sensitivity Specificity TLX1 45.6% 86.3% NID2 50.6% 88.2% DIDO1 39.2% 86.3% ECRG4 34.2% 90.2% ZNF132 54.4% 86.3% IFFO1 91.2% 96.1%
[0317] The above experimental results demonstrate that methylated DNA of the target gene sequence is a biomarker for detecting minimal residual disease (microresidual lesions) in esophageal cancer. Using the target gene sequence methylated DNA detection method described in this application, non-invasive and sensitive in vitro detection of ctDNA in microresidual lesions after esophageal cancer treatment can be achieved.
[0318] In summary, this application utilizes the composition, nucleic acid sequence, kit, and their uses described above, as well as the detection method described above, to achieve in vitro detection of ctDNA in esophageal cancer microresidual lesions by detecting the methylated nucleic acid sequence of the target gene target sequence and its fragments.
[0319] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.
Claims
1. A composition for detecting esophageal cancer microresidual lesions in vitro, the composition comprising: a nucleic acid for detecting a methylation state of a target gene, wherein the methylation state of the target gene is characterized by methylation of a target sequence of the target gene, and wherein the target gene is selected from one or more of a TLX1 gene, a NID2 gene, a DIDO1 gene, an ECRG4 gene, a ZNF132 gene, and an IFFO1 gene. the target sequence of the TLX1 gene is a sequence as set forth in any one of SEQ ID NOs: 1-4 or comprises a sequence as set forth in any one of SEQ ID NOs: 1-4; and / or the target sequence of the NID2 gene is a sequence as set forth in any one of SEQ ID NOs: 5-8 or comprises a sequence as set forth in any one of SEQ ID NOs: 5-8; and / or the target sequence of the DIDO1 gene is a sequence as set forth in any one of SEQ ID NOs: 9-12 or comprises a sequence as set forth in any one of SEQ ID NOs: 9-12; and / or the target sequence of the ECRG4 gene is a sequence as set forth in any one of SEQ ID NOs: 13-16 or comprises a sequence as set forth in any one of SEQ ID NOs: 13-16; and / or the target sequence of the ZNF132 gene is a sequence as set forth in any one of SEQ ID NOs: 17-20 or comprises a sequence as set forth in any one of SEQ ID NOs: 17-20; and / or the target sequence of the IFFO1 gene is a sequence as set forth in any one of SEQ ID NOs: 21-24 or comprises a sequence as set forth in any one of SEQ ID NOs: 21-24. the nucleic acid for detecting a methylation state of a target gene comprises: a primer, the primer being a fragment of at least 9 nucleotides in the target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence; and / or a probe, the probe being a fragment of at least 15 nucleotides hybridizing to the target sequence of the target gene under medium stringency or high stringency conditions, the fragment comprising at least one CpG dinucleotide sequence. 2. The composition of claim 1, wherein, 3. The composition according to any one of claims 1-2, wherein, Preferably, the fragment of at least 15 nucleotides is a sequence as set forth in SEQ ID NO: 37, or a sequence as set forth in SEQ ID NO: 38, or a sequence as set forth in SEQ ID NO: 39, or a sequence as set forth in SEQ ID NO: 40, or a sequence as set forth in SEQ ID NO: 41, or a sequence as set forth in SEQ ID NO: 42; Preferably, it further comprises: An agent that converts a 5-position unmethylated cytosine base of a target sequence of a target gene into a uracil.
4. An oligonucleotide for detecting esophageal cancer microresidual lesions in vitro, comprising: a fragment of at least 9 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or a complement thereof and comprising at least one CpG dinucleotide sequence; or a fragment of at least 9 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or a complement thereof and comprising at least one CpG dinucleotide sequence; or a fragment of at least 9 nucleotides in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or a complement thereof and comprising at least one CpG dinucleotide sequence; or a fragment of at least 9 nucleotides in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or a complement thereof and comprising at least one CpG dinucleotide sequence; or a fragment of at least 9 nucleotides in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or a complement thereof and comprising at least one CpG dinucleotide sequence; or a fragment of at least 9 nucleotides in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or a complement thereof and comprising at least one CpG dinucleotide sequence.
5. The oligonucleotide of claim 4, further comprising: a fragment of at least 15 nucleotides in the SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency; or a fragment of at least 15 nucleotides in the SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency; or a fragment of at least 15 nucleotides in the SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency; or a fragment of at least 15 nucleotides in the SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency; or a fragment of at least 15 nucleotides in the SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency; or a fragment of at least 15 nucleotides in the SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or a complement thereof and comprising at least one CpG dinucleotide sequence hybridizes under conditions of medium stringency or high stringency. a fragment of at least 15 nucleotides in the SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof that hybridizes under conditions of medium stringency or high stringency, and comprises at least one CpG dinucleotide sequence; or a fragment of at least 15 nucleotides in the SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof that hybridizes under conditions of medium stringency or high stringency, and comprises at least one CpG dinucleotide sequence; or a fragment of at least 15 nucleotides in the SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof that hybridizes under conditions of medium stringency or high stringency, and comprises at least one CpG dinucleotide sequence; or a fragment of at least 15 nucleotides in the SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof that hybridizes under conditions of medium stringency or high stringency, and comprises at least one CpG dinucleotide sequence.
6. An oligonucleotide for use in the in vitro detection of microscopically residual lesions of esophageal cancer, comprising: the sequence of SEQ ID NO: 25 and SEQ ID NO: 26, preferably further comprising: the sequence of SEQ ID NO: 37; or the oligonucleotide comprises: the sequence of SEQ ID NO: 27 and SEQ ID NO: 28, preferably further comprising: the sequence of SEQ ID NO: 38; or the oligonucleotide comprises: the sequence of SEQ ID NO: 29 and SEQ ID NO: 30, preferably further comprising: the sequence of SEQ ID NO: 39; or the oligonucleotide comprises: the sequence of SEQ ID NO: 31 and SEQ ID NO: 32, preferably further comprising: the sequence of SEQ ID NO: 40; or the oligonucleotide comprises: the sequence of SEQ ID NO: 33 and SEQ ID NO: 34, preferably further comprising: the sequence of SEQ ID NO: 41 ; or the oligonucleotide comprises: the sequence of SEQ ID NO: 35 and SEQ ID NO: 36, preferably further comprising: the sequence of SEQ ID NO:
42.
7. A kit comprising the composition of any one of claims 1-3 or comprising the oligonucleotide of any one of claims 4-6; preferably further comprising at least one further component selected from: nucleotides triphosphates, a DNA polymerase and a buffer required for the function of said DNA polymerase; Preferably, the sample tested by the kit comprises: a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof; preferably further comprising: an instruction manual.
8. A method for the in vitro detection of microscopically residual lesions of esophageal cancer, comprising: contacting a sample with the composition of any one of claims 1-3 or with the oligonucleotide of any one of claims 4-6; and detecting the presence of the oligonucleotide in the sample.
8. Use of the composition according to any one of claims 1-3 or the oligonucleotide according to any one of claims 4-6 in the preparation of a kit for in vitro detection of esophageal cancer minimal residual lesions. Preferably, the kit for in vitro detection of esophageal cancer minimal residual lesions detects esophageal cancer minimal residual lesions by a method comprising the following steps: 1) isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof in a biological sample to be tested; 2) determining the methylation state of the target sequence of the target gene; 3) determining the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of esophageal cancer minimal residual lesions; Preferably, the method comprises the following steps: extracting genomic DNA of a biological sample to be tested; treating the extracted genomic DNA with a reagent to convert 5 unmethylated cytosine bases to uracil or other bases; contacting the reagent-treated DNA sample with a DNA polymerase and primers of a target sequence of a target gene to perform a DNA polymerization reaction; detecting the amplification product with a probe; and determining the methylation state of at least one CpG dinucleotide of the target sequence of the target gene based on whether the amplification product is present or not; Preferably, the reagent is a bisulfite reagent.
9. A methylation marker for in vitro esophageal cancer minimal residual lesions, the methylation marker being selected from one or more of a TLX1 gene, a NID2 gene, a DIDO1 gene, an ECRG4 gene, a ZNF132 gene, and an IFFO1 gene.
10. The methylation marker according to claim 9, wherein the target sequence of the TLX1 gene is a sequence as set forth in any one of SEQ ID NOs: 1-4 or comprises a sequence as set forth in any one of SEQ ID NOs: 1-4; and / or the target sequence of the NID2 gene is a sequence as set forth in any one of SEQ ID NOs: 5-8 or comprises a sequence as set forth in any one of SEQ ID NOs: 5-8; and / or the target sequence of the DIDO1 gene is a sequence as set forth in any one of SEQ ID NOs: 9-12 or comprises a sequence as set forth in any one of SEQ ID NOs: 9-12; and / or the target sequence of the ECRG4 gene is a sequence as set forth in any one of SEQ ID NOs: 13-16 or comprises a sequence as set forth in any one of SEQ ID NOs: 13-16; and / or the target sequence of the ZNF132 gene is a sequence as set forth in any one of SEQ ID NOs: 17-20 or comprises a sequence as set forth in any one of SEQ ID NOs: 17-20; and / or the target sequence of the IFFO1 gene is a sequence as set forth in any one of SEQ ID NOs: 21-24 or comprises a sequence as set forth in any one of SEQ ID NOs: 21-24.