Fluorescent quantitative RT-PCR detection primer and probe for pedigree 7 PRRSV-2, and application of fluorescent quantitative RT-PCR detection primer and probe

Abstract

The invention discloses a lineage 7PRRSV-2 (Prime Pack-like) fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection primer and a probe as well as application, and belongs to the technical field of biology. The invention discloses application of the lineage 7PRRSV-2 fluorescent quantitative RT-PCR detection primer and the probe in preparation of a reagent for detecting lineage 7PRRSV-2. The fluorescent quantitative RT-PCR detection method established by the invention is high in sensitivity, strong in specificity and good in repeatability.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, more particularly to a primer and probe for detecting PRRSV-2 (Prime Pac-like) by fluorescent quantitative RT-PCR and application thereof. BACKGROUND

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a highly fatal contagious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), which is characterized by causing reproductive disorders in sows and respiratory diseases in piglets. Since it was first reported in the United States in 1987, PRRSV has rapidly spread to countries around the world, becoming one of the important diseases that endanger pig populations. According to the classification standard of the International Committee on Taxonomy of Viruses (ICTV), PRRSV is divided into two genotypes: Betaarterivirus suid1 (PRRSV-1, European type) and Betaarterivirus suid2 (PRRSV-2, North American type). PRRSV-1 and PRRSV-2 are prevalent in China, but PRRSV-2 is the main type.

[0003] The genome size of PRRSV is about 15.4 kb, and contains at least 10 open reading frames (ORF), including ORF1a, ORF1b, ORF2a, ORF2b, ORF3, ORF4, ORF5a, ORF5, ORF6, ORF7 and Nsp2TF. The PRRSV genome is highly variable, and PRRSV-2 can be divided into 11 lineages (lineage 1-11) according to the ORF5 gene typing. In China, PRRSV-2 is mainly divided into lineage 1 (L1.8 / NADC30-like and L1.5 / NADC34-like), lineage 3 (L3 / QYYZ-like), lineage 5.1 (L5.1 / VR2332-like) and lineage 8.7 (L8.7 / JXA1-like / HP-PRRSV and CH-1a-like). The Nsp2 gene is the most variable region in the PRRSV genome, which can tolerate base insertion and deletion, and is an important region for monitoring PRRSV molecular epidemiology. In 2006, HP-PRRS (L8.7 / JXA1-like) broke out, and this strain has a 30 (1+29) amino acid (aa) discontinuous deletion in the Nsp2 gene. The NADC30-like strain, which broke out in 2013, has the characteristic of a 131 aa (111 aa+1 aa+19 aa) discontinuous deletion in the Nsp2 gene. In 2011, Lineage 3 PRRSV appeared in China, and this virus has a 36 aa continuous insertion in the Nsp2 gene. Prime Pac PRRS attenuated live vaccine (lineage 7 / L7 strain) has been used to prevent and control PRRS in North America, Thailand and Europe, but this vaccine has not been approved for marketing in China. Sequence alignment analysis shows that the Nsp2 gene of this strain (L7 / Prime Pac-like) has a continuous 36 aa (aa813-848) insertion. Epidemiological investigations show that the lineage 7 strain appeared in China in 2025. There are some reports on the RT-PCR or fluorescent quantitative RT-PCR detection methods for identifying classic PRRSV, HP-PRRSV, NADC30-like and NADC34-like, but there is no report on the fluorescent quantitative RT-PCR detection method for identifying the lineage 7 (Prime Pac-like) PRRSV.

[0004] Therefore, it is an urgent problem for those skilled in the art to provide a lineage 7 PRRSV-2 fluorescent quantitative RT-PCR detection primer and probe and application. SUMMARY

[0005] Therefore, it is an urgent problem for those skilled in the art to provide a lineage 7 PRRSV-2 fluorescent quantitative RT-PCR detection primer and probe and application.

[0006] In order to achieve the above object, the present application adopts the following technical solutions:

[0007] The primer and probe for detecting the lineage 7 PRRSV-2 by the fluorescent quantitative RT-PCR are as follows:

[0008] L7-F: 5'-GATGGCACCGGTTTGGCT-3';

[0009] L7-R: 5'-GGTAAACGTTGACGCCTGTGT-3';

[0010] L7-P: 5'-ACCGAGAAAAATGAACAGCCCTTCGT-3'; 5' end labeled with FAM; 3' end labeled with BHQ1.

[0011] Further, the fluorescent quantitative RT-PCR detection kit for detecting the lineage 7 PRRSV-2 contains the primer and probe.

[0012] Further, the primer and probe for detecting the lineage 7 PRRSV-2 by the fluorescent quantitative RT-PCR are used for preparing the reagent for detecting the lineage 7 PRRSV-2.

[0013] Further, a fluorescent quantitative RT-PCR detection method for detecting the lineage 7 PRRSV-2 is not for the purpose of diagnosis and treatment, taking the cDNA of the sample to be detected as a template, and using the primer and probe to perform the fluorescent quantitative RT-PCR amplification.

[0014] The fluorescent quantitative RT-PCR amplification reaction system is as follows: 2x One Step Q Probe Mix 10 μL, One Step Q Probe Enzyme Mix 1 μL, template 2 μL, 0.3 μmol / L of the upstream and downstream primers each 0.6 μL, 0.35 μmol / L of the probe 0.7 μL, and ddH2O is added to the system to 20 μL.

[0015] The fluorescent quantitative RT-PCR amplification condition is as follows: 50℃, 15min; 95℃, 30s; 95℃, 10s, 55℃, 30s, a total of 45 cycles, and the fluorescence signal is collected at 55℃.

[0016] Through the above technical solutions, compared with the prior art, the present application provides the primer and probe for detecting the lineage 7 PRRSV-2 by the fluorescent quantitative RT-PCR and the application, and the fluorescent quantitative RT-PCR detection method established by the present application has high sensitivity, strong specificity and good repeatability. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description only aim at the embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of the provided drawings.

[0018] Figure 1 PCR identification results of recombinant plasmid standard; wherein, M: DL2000 DNA Marker; 1: L7 NSP2 standard; 2: negative control.

[0019] Figure 2 Fluorescent RT-PCR primer concentration screening results; wherein, 1-8 are 0.8 μmol / L, 0.7 μmol / L, 0.4 μmol / L, 0.3 μmol / L, 0.2 μmol / L, 0.6 μmol / L, 0.5 μmol / L and 0.1 μmol / L, respectively.

[0020] Figure 3 Fluorescent RT-PCR probe concentration screening results; wherein, 1-8 are 0.35 μmol / L, 0.4 μmol / L, 0.3 μmol / L, 0.25 μmol / L, 0.2 μmol / L, 0.15 μmol / L, 0.1 μmol / L and 0.05 μmol / L, respectively.

[0021] Figure 4 Expansion curve of fluorescent quantitative RT-PCR of lineage 7 PRRSV-2; wherein, 1-9: 1×10 9 copies / μL-1×10 1 copies / μL; 10: 1×10 0 copies / μL; 11: negative control.

[0022] Figure 5 Standard curve of lineage 7 PRRSV-2 RT-PCR.

[0023] Figure 6 Minimum detection amount of ordinary PCR (A) and fluorescent quantitative RT-PCR (B) of lineage 7 PRRSV-2. In figure A, 1-9: 10 9 -10 1 copies; 10-12: 5 copies, 2 copies, 1 copy; 13, negative control.

[0024] Figure 7Specificity test results; wherein, 1: FJZHK-2025 strain; 2: L7-Pac-NSP2 strain; 3~8: PRRSV-2 HuN4-F112 strain, CH-1R strain, R98 strain, FJFS, FJZ03 and FJ0908; 9~14: swine fever live vaccine, HB-98 strain, attenuated Hu strain + attenuated CV777 strain + NX strain, PCV2, PCV3, PPV; 15: PRRSV-1 FJEU13; 16: negative control. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0026] (1) Samples to be tested, vaccines and strains

[0027] The blood samples and tissue samples and aborted fetuses suspected of being infected with PRRSV collected and preserved by the laboratory totaled 150.

[0028] The classical PRRSV-2 live vaccine (CH-1R strain / lineage 8.7) was purchased from Harbin Weike Biotechnology Development Co., Ltd.; the highly pathogenic PRRSV-2 live vaccine (HuN4-F112 strain / lineage 8.7) was purchased from Harbin Pharmaceutical Group Biotech Co., Ltd.; the PRRSV-2 live vaccine (R98 strain / lineage 5.1) was purchased from Jiangsu Nannong High-tech Co., Ltd.; the live vaccine for swine fever (cell source) was purchased from Harbin Pharmaceutical Group Biotech Co., Ltd.; the live vaccine for swine pseudorabies (HB-98 strain) was purchased from Wuhan Keqian Biotechnology Co., Ltd.; the triple live vaccine for transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis, porcine epidemic diarrhea, and porcine rotavirus (G5 type) (attenuated Huatuo strain + attenuated CV777 strain + NX strain) was purchased from Jilin Zhengye Bioproducts Co., Ltd.; the lineage 1.5 PRRSV-2 strain FJ0908 (GenBank accession number: MK202794), the lineage 1.8 PRRSV-2 strain FJZ03 (GenBank accession number: KP998476), the lineage 3 PRRSV-2 strain FJFS (GenBank accession number: PV693702), the lineage 7 PRRSV-2 strain FJZHK-2025 (GenBank accession number: PV693702), the PRRSV-1 strain FJEU13 (GenBank accession number: KP860912), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), and porcine parvovirus (PPV) were preserved by the laboratory.

[0029] The NSP2 gene sequence of the Prime Pac PRRS vaccine strain (lineage 7 strain, GenBank accession number: DQ779791) of porcine reproductive and respiratory syndrome virus (PRRSV) (L7-Pac-NSP2) was synthesized by Anshengda Biotechnology Co., Ltd., and the NSP2 gene sequence was linked with the pEASY-Blunt vector and transformed into T1 competent cells. After confirming by sequencing that the sequence of the PCR positive bacterial liquid was correct, the plasmid was extracted according to the instructions of the plasmid extraction kit

[0030] L7-Pac-NSP2.

[0031] gaccagagacccttggtactctttgaaaatgagctggcagatgaccaacctgccagagatcctcggacatcatcgcagaggtttgacgggagcacaccagctccgcccgcaggcacggatggcaccggtttggcttcgggccctggagtgagagaagtggattcatgtgaggcgagctcaaccgagaaaattgaacagcccttcgtgttgaacggcggcgccagcacacaggcgtcaacgtttaccaatttgccgcctccaggcggtatagatgcgggcgggagtgggccgttacaaacggtgcgaaagaaggctgaacggttctttgacctactaagccgtcaggtttttaatctcgtc; SEQ ID NO. 7.

[0032] Strains FJFS, FJ0908, FJZ03 and FJEU13 are described in the literature: Huang Wenlin; Molecular epidemiological investigation and ORF5 gene variation analysis of porcine reproductive and respiratory syndrome virus in Fujian province from 2020 to 2023; Animal Husbandry Progress, 2025, 46(5): 9-16.

[0033] (2) Main reagents and instruments

[0034] RNAsimple total RNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; dNTP Mix, Reverse Transcriptase M-MLV (RNase H - )(200 U / μL), Recombant RNase Inhibitor (40 U / μL), Oligo(dT) 18 Primer and Random Primer pd(N)6 were purchased from Baori Medical Biotechnology (Beijing) Co., Ltd.; Gel Extraction kit recovery kit, 2x Taq Plus Master Mix (Dye Plus), DL 2000 Plus DNA Marker, HiScript II One-step qRT-PCR Probe Kit were purchased from Nanjing Novogene Bioinformatics Technology Co., Ltd.; pEASY-Blunt Simple Cloning Vector, Trans1-T1 Phage Resistant competent cells were purchased from Beijing Zixingjin Biotechnology Co., Ltd.

[0035] Example 1

[0036] (1) Design and synthesis of primers and probes

[0037] The whole genome sequences of representative strains of PRRSV and strains prevalent in China were downloaded from NCBI GenBank. Sequence alignment analysis was performed using MEGA7 biological software. According to the high variability of NSP2 region of different lineage strains, specific primers and probes were designed using Oligo7 software for specific detection of Lineage 7 PRRSV-2 strains. The design position of the probe was referenced to FJZHK-2025 (GenBank accession number: PV693702), and the specific sequences are shown in Table 1. In order to prepare the standard sample L7-NSP2 for fluorescence quantitative PCR analysis, a set of PCR primers L7 NSP2 F / R (Table 2) was additionally designed. All the above primers and probes were synthesized by Shanghai Sangon Biological Engineering Technology Service Co., Ltd.

[0038] Table 1 PRRSV-2 Lineage 7 primer and probe sequences

[0039]

[0040] Probe L7-P: 5' labeled with FAM; 3' labeled with BHQ1.

[0041] Note: The design position of the primer and probe sequence is referenced to FJZHK-2025 (GenBank accession number: PV693702).

[0042] Table 2 Standard primer sequences

[0043]

[0044] Note: The design position of the primer sequence is referenced to FJZHK-2025 (GenBank accession number: PV693702).

[0045] (2) Preparation of fluorescence quantitative PCR standard

[0046] The Lineage 7 PRRSV-2 strain FJZHK-2025 strain (GenBank accession number: PV693702) preserved in the laboratory was used as a template. Total RNA in the virus liquid was extracted using a total RNA extraction kit, and reverse transcribed into cDNA. PCR amplification reaction was performed according to the primer sequence provided in Table 2, and the NSP2 gene (nt 3635-4070) of the Lineage 7 PRRSV-2 strain FJZHK-2025 was obtained. The NSP2 gene sequence is shown as SEQ ID NO. 6.

[0047] TGC AAG ATG ATC GAC CAG AGA CCT TGG TAC TCT ATG AAA ATG AGC TGG CAG ATG ACC AAC CTG CCA GAG ATC CTC GGA CAT CAT CGC AGA GGT TTG ATG GGAGCACACCAGCTCCGCCC GC AGGC AGGC ATGG CAC CGGT TTG GCT TCG GGCCCTGGAGTGAGAGAAGTGGATTCATGTGAGGCAGCTCAACC GAG AAAA ATG AAC AGC CCT TCG TGT TGA ACG GC GGC GCC AGC AC AC AGG CGT CAAC GTT TAC CAATTTGCTGCCTCCAGGC GGT ATAG ATG CGG GC GGG AGT GGG CCT TAC AAA CGG TGC GAA AGA AGGC TGAACGGTTCTTTGACCTACTAAGCCGTCAGGTTTTTAATCTCGTCTCCC ATCTCCCTGTTTTCTTCTCACGCCTTTTCAAACCTGGCGGTGACTATTC TCCGGGTGATT; SEQ ID NO. 6.

[0048] The amplified product (NSP2 gene sequence) was ligated with pEASY-Blunt vector and transformed into T1 competent cells. After confirming that the sequence of the PCR positive bacterial liquid was correct by sequencing, the plasmid L7-NSP2 thereof was extracted according to the instructions of the plasmid extraction kit, and the concentration was determined by ultraviolet absorption method, which was used for the preparation of subsequent standards. In order to convert the measured plasmid concentration into copy number concentration (copies / μL), first adjust the positive plasmid concentration to 1×10 10 copies / μL, then perform 10-fold gradient dilution, which is used as a standard template. The formula for calculating the copy number is: copy number concentration (copies / μL) = c × NA / m, where c is the plasmid concentration, unit: ng / μL; NA is Avogadro's constant (6.02×10 23 copies / mol); m is the average molecular weight of the plasmid, unit: Da (g / mol).

[0049] As shown in Figure 1 , the recombinant plasmid L7 NSP2 was amplified with the L7 NSP2 F and L7 NSP2 R primers in Table 2 to obtain a fragment of about 436 bp in size, and the sequencing result was consistent with the expectation. The L7 NSP2 plasmid concentration was 95.65 ng / μL, corresponding to a copy number of 2.045×10 10 copies / μL, which was gradient diluted with distilled water to 1×10 9copies / μL ~ 1 x 10 0 copies / μL, for subsequent experiments.

[0050] (3) Optimization of the fluorescence quantitative PCR reaction conditions

[0051] To optimize the fluorescence quantitative PCR reaction conditions, the pre-prepared standard was used as a reference, and a 20 μL reaction system was established according to the instructions of the HiScript II one-step qRT-PCR probe kit: 10 μL 2x One Step Q Probe Mix, 1 μL One Step Q Probe Enzyme Mix, 2 μL template DNA, RNase-free ddH2O to 20 μL. The amount of primers and probes in the reaction system was optimized by the control variable method. Different amounts of primers were added to the reaction system, and the final concentration was 0.1-0.8 μmol / L, with an increase of 0.1 μmol / L each time, to determine the optimal final concentration of primers. Different amounts of probes were added to the reaction system, and the final concentration was 0.05-0.4 μmol / L, with an increase of 0.05 μmol / L each time, with 3 repeated experiments for each concentration. In addition, the annealing temperature was optimized, and the annealing temperature was 52-60°C, so as to achieve the lowest cycle threshold (Ct value) and the highest amplification efficiency under the same template amount.

[0052] The optimal reaction concentration was determined by experimental screening: the primer was 0.3 μmol / L, and the probe was 0.35 μmol / L; under this condition, the same template amount could obtain the minimum Ct value and the highest amplification efficiency, and the results were shown in Figure 2 and Figure 3 .

[0053] The optimized optimal reaction system: 2x One Step Q Probe Mix 10 μL, One Step Q Probe Enzyme Mix 1 μL, template 2 μL, upstream and downstream primers (0.3 μmol / L each) 0.6 μL each, probe (0.35 μmol / L) 0.7 μL, ddH2O to fill the system to 20 μL. The optimal amplification condition: 50°C, 15 min; 95°C, 30 s; 95°C, 10 s, 55°C, 30 s, a total of 45 cycles, collect fluorescence signal at 55°C.

[0054] (4) Establishment of standard curve and sensitivity test

[0055] To evaluate the sensitivity of the detection method, 10 gradient concentrations (1 x 10 9 copies / μL ~ 1 x 10 0copies / μL) as template, amplification was carried out under optimal reaction conditions, 3 replicates were set for each concentration to determine the detection limit of the method. Then, the standard curve was constructed with the logarithm of copy number as abscissa and the corresponding Ct value as ordinate.

[0056] The plasmid standard (1 x 10 9 copies / μL) was diluted by 10 times, and the standard curve was constructed with the logarithm of copy number as abscissa and the corresponding Ct value as ordinate. 0 Figure 4 and Figure 5 The standard curve of lineage 7 PRRSV-2 was y = -3.4775x + 42.591, the correlation coefficient R 2 = 0.9996. It had good linear relationship in the concentration range of 1 x 10 9 copies / μL to 1 x 10 1 copies / μL. In addition, the standard plasmid was further diluted, and the fluorescence quantitative RT-PCR method established in the application was used for detection, and the results showed that the detection limit of the method was 5 copies / μL, while the detection limit of ordinary PCR was 100 copies / μL Figure 6 ). The ordinary PCR amplification system was 25 μL: 2 x Phantamax master mix 12.5 μL, cDNA template 2 μL, 1 μL of upstream and downstream primers (Table 2, 10 μmol / L) respectively, and sterilized deionized water was added to 25 μL. The PCR reaction program was 95°C for 3 min; 95°C for 30 s, 58.8°C for 30 s, 72°C for 1 min, for a total of 35 cycles; 72°C for 5 min, and a negative control was set at the same time.

[0057] (5) Specificity test

[0058] ​To verify the specificity of the established detection method, the nucleic acids of lineage 1.5 PRRSV-2 strain (FJ0908), lineage 1.8 PRRSV-2 strain (FJZ03), lineage 3 PRRSV-2 strain (FJFS), lineage 5 PRRSV-2 vaccine strain (R98), lineage 7 PRRSV-2 strain (FJZHK-2025), and Nsp2 plasmid of Pac Prime vaccine strain (L7-Pac-NSP2), lineage 8.7 PRRSV vaccine strain (CH-1R and HuN4-F112), PRRSV-1 strain (FJEU13), PRV live vaccine HB-98 strain, CSFV live vaccine, and porcine enterovirus triple attenuated live vaccine (TGEV of Huazhi strain, PEDV of CV777 strain, G5 type PoRV of NX strain), PCV2, PCV3, and PPV strain were extracted for testing. Through systematic detection of the above diversified samples, the specificity and reliability of the detection method were comprehensively evaluated.

[0059] Using the optimized fluorescent quantitative RT-PCR method, the nucleic acids of the samples were used as templates for amplification. The specificity results are shown in Figure 7 As shown in the FAM channel, only L7-Pac-NSP2 and FJZHK-2025 strain showed amplification curves, and other samples had no amplification curves. In summary, the primers and probes designed by the established method have specificity and accuracy.

[0060] (6) Reproducibility test

[0061] Three concentrations of 10 5 copies / μL, 10 4 copies / μL, and 10 3 copies / μL were selected, and the same batch of test reagents was used. Each concentration was detected 3 times, and the intra-group coefficient of variation was calculated. Three batches of reagents were prepared at different time points, and each batch of reagents was detected at the above concentration gradient, and the inter-group coefficient of variation was calculated.

[0062] Plasmid standards with concentrations of 1×10 5 copies / μL, 1×10 4 copies / μL, and 1×10 3 copies / μL were selected as templates for intra-group and inter-group reproducibility tests. The results are shown in Tables 3 and 4.

[0063] Table 3 Intra-batch reproducibility test results

[0064]

[0065] Table 4 Inter-batch reproducibility test results

[0066]

[0067] The results of Table 3 and Table 4 show that the coefficient of variation within and between groups are less than 1%, indicating that the established method has good repeatability and high stability.

[0068] (7) Compliance test and clinical sample detection

[0069] To verify the clinical practicability of the established fluorescent quantitative RT-PCR method, 50 clinical samples suspected to be infected with PRRSV were selected for simultaneous detection, and the detection results were verified for compliance with the results of nested PCR (first round of PCR amplification was performed with the primers in Table 2, and then the second round of PCR amplification was performed with the primers L7-F / R in Table 1 using the first round of PCR product as template) and sequencing. The results showed that the fluorescent quantitative RT-PCR detection method established in this study was consistent with the results of nested PCR and sequencing (3 / 50), indicating that the method is accurate and reliable.

[0070] The established fluorescent quantitative RT-PCR method was used to detect 150 clinical samples collected and preserved in the laboratory to analyze the infection of lineage 7 PRRSV-2. The results showed that 12 of the 150 clinical samples were lineage 7 PRRSV-2, indicating that lineage 7 PRRSV is showing a potential epidemic trend in China.

[0071] The above description of the disclosed embodiments enables one skilled in the art to make or use the application. Numerous modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Therefore, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Primers and probes for the detection of lineage 7 PRRSV-2 by real-time RT-PCR, characterized in that, The primer and probe sequences are as follows: L7-F: 5'-GATGGCACCGGTTTGGCT-3'; L7-R: 5'-GGTAAACGTTGACGCCTGTGT-3'; L7-P: 5'-ACCGAGAAAAATGAACAGCCCTTCGT-3'; 5' end labeled FAM; 3' end labeled BHQ1.

2. A fluorescent quantitative RT-PCR detection kit for lineage 7 PRRSV-2, characterized in that, containing the primer and probe of claim 1.

3. The application of the primer and probe for detecting lineage 7 PRRSV-2 fluorescence quantitative RT-PCR detection in preparing a reagent for detecting lineage 7 PRRSV-2.

4. A lineage 7 PRRSV-2 fluorescent quantitative RT-PCR detection method which is not for the purpose of diagnosis and treatment, characterized in that, The cDNA of the sample to be detected is used as a template, and the primer and probe of claim 1 are used for fluorescence quantitative RT-PCR amplification; The fluorescence quantitative RT-PCR amplification reaction system: 2x One Step Q Probe Mix 10 μL, One Step Q Probe Enzyme Mix 1 μL, template 2 μL, 0.3 μmol / L of the upstream and downstream primers each 0.6 μL, 0.35 μmol / L of the probe 0.7 μL, and ddH2O is added to the system to 20 μL; The fluorescence quantitative RT-PCR amplification condition: 50℃, 15min; 95℃, 30s; 95℃, 10s, 55℃, 30s, a total of 45 cycles, and the fluorescence signal is collected at 55℃.

Images