Method for editing RNA, composition and application thereof

Abstract

The present invention relates to a single-stranded antisense oligonucleotide (ASO) for targeted RNA editing, in which the ASO comprises a specific domain (SD) and a secondary binding domain (BHD), in which the SD is complementarily paired with a targeted RNA region, and the BHD is complementarily paired with a non-targeted RNA region, and in which the specific domain (SD) and the BHD are complementarily paired with the non-targeted RNA region, in which the specific domain (SD) and the BHD are in one-to-one correspondence with the specific domain (SD) and the BHD are in one-to-one correspondence with the specific domain (SD) and the BHD are in one-to-one correspondence with the specific domain (SD) and the BHD are in one-to-one correspondence. Methods of editing RNA, compositions, and uses thereof are also provided.

Description

Methods, compositions and uses of editing RNA Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to a single-stranded antisense oligonucleotide (ASO) for targeted RNA editing, a method for editing RNA, a composition, and applications thereof. Background Art

[0002] Targeted RNA editing manipulates genetic information in a reversible and adjustable manner without causing permanent changes to the genome. Therefore, it is safer than DNA editing and has certain advantages in therapeutic applications. RNA editing mainly involves the conversion of adenosine (A) to inosine (I) and cytidine (C) to uridine (U), which occurs through adenosine deaminases (ADARs) and cytidine deaminases, respectively. The most widely studied RNA editing system is ADAR-mediated A-to-I editing, of which ADAR members ADAR1 (isoforms p110 and p150) and ADAR2 have been designed for A-to-I RNA editing. ADAR is a multidomain protein that recognizes specific dsRNA sequences and / or conformations through a recognition domain and uses a catalytic domain to convert A to I through deamination of the nucleobase. During translation, A is read as guanosine (G) and paired with C, completing the recoding of the protein sequence.

[0003] Some RNA editing tools have been designed for targeted A-to-I conversion. Through genetic engineering methods, ADAR proteins or their catalytic domains are fused with phage λN peptides, SNAP tags, MS2 or dCas13b proteins (PMID: 34569891), and a guide RNA (gRNA) is designed to guide the ADAR fusion protein to the target site, thereby achieving directed RNA editing. Studies have also shown that overexpression of ADAR1 or ADAR2 proteins together with gRNA containing R / G motifs (ADAR recruitment regions) can achieve targeted RNA editing.

[0004] The researchers further used endogenous ADAR proteins for RNA editing. No exogenous proteins were required. Only a gRNA was needed to recruit endogenous ADAR proteins and edit the target RNA. This editing method includes two major categories.

[0005] The first type of gRNA consists of a targeting region and a recruitment region. The targeting region is complementary to the target RNA region containing the target adenosine, and the recruitment region is used to recruit naturally occurring ADAR proteins in cells and perform RNA editing on the targeted region. WO2016 / 097212 (ProQR Therapeutics) describes an oligonucleotide structure with both a targeting and recruitment region, wherein the recruitment region is a stem-loop structure within a single-stranded molecule and the targeting region contains some chemical modifications. WO2017 / 050306 describes an RNA editing tool with a similar structure to the above, and a subsequent application, CN112752844A, reports an RNA editing technology called "RESTORE" further developed based on the above tool. RESTORE optimizes the recruitment region sequence and distributes dense chemical modifications throughout the gRNA sequence. However, high editing efficiency requires the presence of IFN-γ (to induce expression of the ADAR1 p150 isoform), a key factor in the development and severity of autoimmunity, which significantly reduces its application in the medical field. WO2022078569A1 further discloses an RNA editing method called “CLUSTER”, in which the gRNA of CLUSTER adds 3-10 recruitment sequence clusters on the basis of the RESTORE recruitment region and the targeting region to improve the sequence targeting and flexibility of RNA editing. WO2022026928 (ADARx Pharmaceuticals) also describes a gRNA consisting of a targeting region and a recruitment region, wherein the recruitment region is an intermolecular structure formed by the complementarity of double-stranded RNA, and the targeting region and the recruitment region contain a large number of chemical modifications to achieve a higher editing efficiency. WO2022147573A1 (MALI Prashant et al) discloses a cyclized gRNA strategy that protects cadRNA from the influence of nucleases through a covalently closed loop structure, wherein the cadRNA recruits endogenous ADARs through the recruitment region, thereby achieving efficient and lasting RNA editing.

[0006] The second type of gRNA is a single-stranded antisense oligonucleotide that only contains the targeting region. The single-stranded antisense oligonucleotide AON disclosed in WO2017 / 220751 (ProQR Therapeutics) contains 18-50 nucleotides. The AON has one or more complex modified nucleotides, and the 5' and 3' are connected by a phosphorothioate bond, but the editing efficiency is not high. The application PCT / EP2017 / 071912 (ProQR Therapeutics) further uses special chemical modifications to improve editing. WO / 2020 / 074001 (BoYaGene) describes an RNA editing method called "LEAPER". The gRNA used by LEAPER contains 60-200 linear nucleotide dRNAs that are complementary to the target RNA. The 5' and 3' of the dRNA contain methylation and / or phosphorothioate modifications, which produce more efficient editing for the target adenosine, but it is usually too long for therapeutic applications. HK40062258A (BoYaGene) further developed LEAPER 2.0 based on LEAPER, which circularizes dRNA and protects it from nucleases to achieve persistent editing.

[0007] However, the above RNA editing systems all have certain limitations. For the first type of RNA editing system: First, the most ideal in vivo delivery method for the ectopic expression of exogenous editing proteins and gRNA is viral vectors. Adeno-associated virus AAV is a more ideal viral vector, but its load capacity is difficult to accommodate both editing proteins and gRNA; second, the ectopic expression of non-human proteins has the potential risk of causing immunogenicity, and the editing activity may be impaired by the adaptive immune system; third, the overexpression of ADAR can easily affect its own endogenous gene editing, causing homeostasis disorders and posing a pathogenic risk. Finally, the overexpression of ADAR can cause global off-target phenomena in the transcriptome, posing a risk of carcinogenesis. For the second type of RNA editing system: Although the use of gRNA containing a targeting region and a recruitment region or a single-stranded antisense oligonucleotide containing only a targeting region can recruit endogenous ADAR to avoid the above problems, there is still the problem of low editing efficiency.

[0008] Therefore, it is urgent to further improve the RNA editing system that recruits endogenous ADARs to enhance the binding stability of single-stranded antisense oligonucleotides and target RNA, thereby improving the editing efficiency of the RNA editing system.

[0009] Summary of the Invention

[0010] The present application provides a single-stranded antisense oligonucleotide (Antisense Oligonucleotide, ASO) for targeted RNA editing. The ASO provided in the present application comprises a targeting region (Specificity Domain, SD) and an auxiliary binding region (Binding Helper Domain, BHD), which can form a double-stranded complex with the target RNA. The ASO can deaminize the target adenosine present in the target RNA region by the ADAR enzyme present in the cell, and the BHD is conducive to the stable binding of the ASO to the target RNA, thereby improving the editing efficiency. The present application also provides a method for editing RNA using the ASO, a composition and its application.

[0011] On the one hand, the present application provides a single-stranded antisense oligonucleotide (Antisense Oligonucleotide, ASO) for targeted RNA editing, wherein the ASO comprises a targeting region (Specificity Domain, SD) and an auxiliary binding region (Binding Helper Domain, BHD), wherein the SD is complementary to the targeted RNA region, and the BHD is complementary to the non-targeted RNA region, and the ASO can form a double-stranded complex with the target RNA.

[0012] In certain embodiments, in the ASO, the targeting RNA region is non-contiguous with the non-targeting RNA region.

[0013] In certain embodiments, the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-1000 nt.

[0014] In certain embodiments, the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-200 nt.

[0015] In certain embodiments, the length of the interval between the targeting RNA region and the non-targeting RNA region is 200-500 nt.

[0016] In certain embodiments, the length of the interval between the targeting RNA region and the non-targeting RNA region is 500-1000 nt.

[0017] In certain embodiments, the length of the interval between the targeting RNA region and the non-targeting RNA region is 4nt, 8nt, 11nt, 12nt, 24nt, 25nt, 36nt, 237nt, 340nt, 343nt, 494nt, or 681nt.

[0018] In certain embodiments, the BHD is fully complementary to a non-target RNA region.

[0019] In certain embodiments, the BHD is complementary to a non-target RNA region and has one or more mismatches, wobbles, deletions, and / or bulges.

[0020] In certain embodiments, the BHD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, and UNA.

[0021] In certain embodiments, the BHD has phosphorothioate modifications, 2'-OMe, LNA, 2'-MOE, or inosine substitution modifications.

[0022] In certain embodiments, the BHD is 8-40 nt in length.

[0023] In certain embodiments, the length of the BHD is 15 nt, 20 nt, or 25 nt.

[0024] In certain embodiments, the ASO comprises one or more BHDs.

[0025] In certain embodiments, the one or more BHDs do not form intramolecular secondary structures.

[0026] In certain embodiments, the one or more BHDs form an intramolecular secondary structure.

[0027] In certain embodiments, the plurality of BHDs do not form intermolecular secondary structures.

[0028] In certain embodiments, the plurality of BHDs form an intermolecular secondary structure.

[0029] In certain embodiments, the BHD and SD do not form an intermolecular secondary structure.

[0030] In certain embodiments, the BHD forms an intermolecular secondary structure with SD.

[0031] In certain embodiments, the BHD is 5' to the SD.

[0032] In certain embodiments, the BHD is 3' to the SD.

[0033] In certain embodiments, the plurality of BHDs are located at the 5' end and / or the 3' end of the SD.

[0034] In certain embodiments, the BHD is directly connected to the SD.

[0035] In certain embodiments, the BHD is indirectly linked to the SD.

[0036] In certain embodiments, the BHD and SD are indirectly connected via a Linker.

[0037] In certain embodiments, the linker comprises one or more conventional (phosphodiester) or modified (such as phosphorothioate) nucleotides, oligopeptides, or any other chemical linkers.

[0038] In certain embodiments, the linker is selected from one or more of the following groups: AAA, AAAC, AACAA, AAAACAAAA, PEG2, and C6.

[0039] In certain embodiments, the linker is AAA.

[0040] In certain embodiments, the linker is AAAC.

[0041] In certain embodiments, the linker is AACAA.

[0042] In certain embodiments, the linker is AAAACAAAA.

[0043] In certain embodiments, the linker is PEG2.

[0044] In certain embodiments, the linker is C6.

[0045] In certain embodiments, the BHD increases the stability of the double-stranded complex formed between the ASO and the target RNA.

[0046] In certain embodiments, the SD is fully complementary to the target RNA region or has one or more mismatches, wobbles, deletions, and / or bulges.

[0047] In certain embodiments, the SD has one or more modifications selected from the group consisting of sugar modifications and base modifications.

[0048] In certain embodiments, the SD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, and UNA.

[0049] In certain embodiments, the SD has a phosphorothioate modification.

[0050] In certain embodiments, the SD has one or more modifications selected from the group consisting of 2'-OMe, 2'-F, LNA, UNA, 2'-FANA, DNA base substitution, and inosine substitution modifications.

[0051] In certain embodiments, the SD has a 2'-OMe modification.

[0052] In certain embodiments, the SD has a 2'-F modification.

[0053] In certain embodiments, the SD is 20-50 nt in length.

[0054] In certain embodiments, the SD is 30 nt in length.

[0055] In certain embodiments, the targeting RNA region comprises a target adenosine.

[0056] In certain embodiments, the targeting RNA region is 15-60 nt in length.

[0057] In certain embodiments, the targeting RNA region is 30 nt in length.

[0058] In certain embodiments, the non-targeting RNA region does not contain a target adenosine.

[0059] In certain embodiments, the non-targeting RNA region is 5-50 nt in length.

[0060] In certain embodiments, the length of the non-targeting RNA region is 15 nt, 20 nt, or 25 nt.

[0061] In certain embodiments, the ASO deaminates a target adenosine present in a targeted RNA region by an ADAR enzyme present in the cell.

[0062] In certain embodiments, the target RNA is selected from one or more of the following groups: pre-mRNA, mRNA, rRNA, tRNA, lnc-RNA, snRNA, and snoRNA.

[0063] In another aspect, the present application provides a method for editing RNA, comprising using the ASO.

[0064] In certain embodiments, the method comprises the following steps:

[0065] (1) providing the ASO;

[0066] (2) allowing cells to take up the ASO;

[0067] (3) allowing the ASO to bind to the target RNA;

[0068] (4) Allowing intracellular ADAR enzymes to deaminate target adenosine in the targeted RNA region to inosine;

[0069] (5) Identify the presence of inosine in the targeted RNA region.

[0070] In certain embodiments, the method can recruit endogenous deaminases to perform deamination reactions on specific nucleotide sites.

[0071] In another aspect, the present application provides one or more isolated nucleic acid molecules encoding the ASO, or the SD contained in the ASO, or the BHD contained in the ASO.

[0072] In another aspect, the present application provides an expression vector that expresses one or more isolated nucleic acid molecules.

[0073] In another aspect, the present application provides a delivery vehicle that delivers the ASO.

[0074] In another aspect, the present application provides a cell comprising the ASO, the one or more isolated nucleic acid molecules, the expression vector, and / or the delivery vector.

[0075] In certain embodiments, the cell is a eukaryotic cell.

[0076] In certain embodiments, the cell is a human cell or a mouse cell.

[0077] In certain embodiments, the cell is a hepatocyte.

[0078] In certain embodiments, the cell is a neural cell.

[0079] In another aspect, the present application provides a pharmaceutical composition comprising the ASO, the one or more isolated nucleic acid molecules, the expression vector, the delivery vector, the cell, and / or a pharmaceutically acceptable carrier.

[0080] On the other hand, the present application provides the ASO, the isolated nucleic acid molecule, the expression vector, the delivery vector, the cell, and the pharmaceutical composition for preventing and / or treating diseases and / or conditions.

[0081] On the other hand, the present application provides the use of the ASO, the one or more isolated nucleic acid molecules, the expression vector, the delivery vector, the cell, and the pharmaceutical composition in the preparation of a drug for preventing and / or treating a disease and / or condition.

[0082] On the other hand, the present application provides a method for preventing and / or treating a disease and / or condition, comprising administering an effective amount of the ASO, the one or more isolated nucleic acid molecules, the expression vector, the delivery vector, the cell, or the pharmaceutical composition to a subject in need thereof.

[0083] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0085] FIG1 shows the target CDS region of the GAPDH gene and its corresponding ASO sequence described in this application.

[0086] FIG2 shows the editing efficiency of ASOs targeting the GAPDH target CDS region as demonstrated by Sanger sequencing described in this application.

[0087] FIG3 shows the target 3'UTR region of the GAPDH gene and its corresponding ASO sequence described in the present application.

[0088] FIG4 shows the editing efficiency of ASOs targeting the 3'UTR region of GAPDH as shown by Sanger sequencing described in this application.

[0089] FIG5 shows the target 3'UTR region of the OGT gene and its corresponding ASO sequence described in the present application.

[0090] FIG6 shows the editing efficiency of the ASO targeting the 3'UTR region of the OGT gene as shown by Sanger sequencing described in this application.

[0091] FIG. 7 shows the editing efficiency of ASOs targeting the GAPDH target CDS region as demonstrated by Sanger sequencing described in this application.

[0092] FIG8 shows the editing efficiency of ASOs targeting the 3′-UTR region of GAPDH as demonstrated by Sanger sequencing described in this application.

[0093] FIG9 shows the editing efficiency of ASO targeting the 3'UTR region of the OGT gene as shown by Sanger sequencing described in this application. DETAILED DESCRIPTION

[0094] The following describes the implementation of the present invention through specific embodiments. People familiar with this technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0095] Definition of terms

[0096] In this application, the term "antisense oligonucleotide", also known as "Antisense Oligonucleotide", abbreviated as "ASO", generally refers to an artificially synthesized single-stranded or double-stranded oligonucleotide, which can be modified by modifying ASO to change its structure, binding site, etc. In this application, ASO can be in a single-stranded form, and its function can be to complement and edit the specific sequence of the target RNA. In this application, ASO can include an auxiliary binding region (Binding Helper Domain, BHD) and a targeting region (Specificity Domain, SD). For example, ASO can form a double-stranded complex with the target RNA, and then recruit endogenous deaminase to perform a deamination reaction on a specific nucleotide site.

[0097] In this application, the term "target RNA", also known as "target RNA" or "Target RNA", can be used interchangeably in this application and generally refers to RNA containing a target site. Target RNA can be a variety of types such as pre-mRNA, mRNA, rRNA, tRNA, lncRNA, sRNA, etc. Mutations at certain nucleotide sites can cause different types of functional differences in the target RNA, such as abnormal splicing and alternative splicing of RNA, truncation, extension, and misfolding of proteins. In this application, the target RNA can include a targeted RNA region and a non-targeted RNA region.

[0098] In this application, the term "target site", also known as "editing site", is used interchangeably in this application and generally refers to the ASO-directed editing site in RNA editing. In this application, the target site can be adenosine.

[0099] As used herein, the term "targeting region," also referred to as "Specificity Domain," or "SD," generally refers to a sequence within an ASO that binds to a target RNA sequence containing the target site. As used herein, the SD may be complementary to a region of the target RNA. As used herein, the SD may be modified.

[0100] In this application, the term "helper binding domain," also known as "Binding Helper Domain," abbreviated as "BHD," generally refers to a sequence within an ASO that binds to a target RNA sequence that does not contain the target site. In this application, the BHD enhances the binding stability of the ASO to the target RNA. In this application, the BHD can complementarily pair with a non-targeting RNA region. In this application, the BHD can be modified. In this application, the BHD can be directly or indirectly linked to the SD.

[0101] In this application, the term "targeting RNA region", also known as "editing RNA region", is used interchangeably in this application and generally refers to a sequence in the target RNA that contains a target site, and this sequence is a sequence that the SD can bind to. In this application, the targeting RNA region can be complementary to the targeting domain (Specificity Domain, SD). For example, the target site of the targeting RNA region can be adenosine.

[0102] In this application, the term "non-targeting RNA region", also known as "non-editing RNA region", can be used interchangeably in this application, generally referring to a section of RNA sequence in the target RNA that does not contain the target site, and the sequence is a sequence that BHD can bind to. In this application, the non-targeting RNA region can be complementary to the auxiliary binding region (Binding Helper Domain, BHD). In this application, the non-targeting RNA region can be continuous with the targeted RNA region or non-continuous with the targeted RNA region.

[0103] In this application, the term "modification" generally refers to the alteration of natural or synthetic components. Modifications can include base modifications, nucleoside modifications, sugar modifications, and internucleotide linkage modifications; they can include chemical modifications and non-chemical modifications. In this application, modifications may include LNA, UNA, 2'-MOE, 2'-OMe, 2'-F, phosphorothioate modifications, DNA base substitutions, and inosine substitutions. LNA refers to a modification in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom. UNA refers to a modification in which the ribose ring lacks a chemical bond between the C2' and C3' groups. 2'-MOE refers to the replacement of a hydrogen atom at the 2'-hydroxyl group of a ribonucleotide with a methoxyethyl group. 2'-OMe refers to the replacement of a hydrogen atom at the 2'-hydroxyl group of a ribonucleotide with a methoxy group. 2'-F refers to the replacement of a hydrogen atom at the 2'-hydroxyl group of a ribonucleotide with a fluorine group. Phosphorothioate modifications replace a non-bridging oxygen atom in a phosphate bond with a sulfur atom. DNA base substitution modifications replace RNA bases in the ASO with DNA bases. Inosine substitution modifications replace guanosine bases in the ASO with inosine bases.

[0104] In this application, the terms "complementary pairing" and "complementary" are used interchangeably and generally refer to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. In this application, base pairing can refer to AT, CG, T*A / T ​​(referring to the protonated T and the A in the AT base pair), C*G / C (referring to the protonated C and the G in the GC base pair). In this application, complementary pairing can be a complete complementary pairing, or one or more protrusions, wiggles, deletions, and / or mismatches can be present between nucleic acid molecules. In this application, ASOs can form double-stranded complexes with target RNAs through complementary pairing.

[0105] In this application, the term "protrusion" generally refers to a region where one base upstream and downstream of the protrusion is complementary to the target RNA region, and the corresponding two bases in the target RNA region are continuous. In this application, the term "wobble" generally refers to a region where the wobble base pairing on the complementary strand is GU pairing. In this application, the term "deletion" generally refers to a region where the upstream and downstream bases of the deletion are continuous, and the target RNA region of the deletion region has a corresponding number of bases.

[0106] In this application, the term "mismatch" generally refers to the situation in which the opposing nucleotides in a double-stranded RNA complex do not form a perfect base pair according to the Watson-Crick base pairing rules. The mismatched nucleotides can be AA, AG, AC, UU, UG, UC, GG, GA, GU, CA, CC, CU, etc.

[0107] In this application, the term "perfectly complementary pairing" generally refers to the presence of only strict Watson-Crick or Hoogsteen base pairing between nucleotide units of a nucleic acid molecule. A completely complementary pairing has no bulges, wobbles, deletions, and / or mismatches.

[0108] In this application, the term "secondary structure" generally refers to the structure formed by incomplete complementary pairing of nucleic acid molecules. Incomplete complementary pairing may cause protrusions, wiggles, deletions, and / or mismatches. The secondary structure of a DNA molecule may refer to the helical conformation of the DNA. The secondary structure of an RNA molecule may refer to a helical conformation, loops, stems, and / or arms. In this application, the secondary structure may refer to the secondary structure formed by the action of bases within the molecule, or it may refer to the secondary structure formed by the action of bases between molecules. The loop may refer to the secondary structure formed by the protrusion of unpaired bases, the stem may refer to the local A-type double helix secondary structure formed by pairing between complementary bases, and the arm may refer to a non-paired nucleotide secondary structure that is close to the stem and does not belong to the loop.

[0109] As used herein, the term "isolated nucleic acid molecule" generally refers to isolated forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, separated from their natural environment or artificially synthesized.

[0110] In this application, the term "expression vector" generally refers to a vector containing expression elements (such as a promoter, RBS, terminator, etc.) that enable the expression of a nucleic acid sequence in a cell, or one or more transcripts thereof having relevant expression elements. In this application, the expression vector can express all or part of the sequence of an ASO. In this application, the expression vector can express the SD in the ASO, for example, the SD sequence expressed by the expression vector has not been chemically modified. In this application, the expression vector can express the BHD in the ASO, for example, the BHD sequence expressed by the expression vector has not been chemically modified.

[0111] In this application, the term "delivery vector" generally refers to a vector that delivers one or more nucleotides to a cell. The vector may include a viral vector or a non-viral vector. Viral vectors include DNA viruses and RNA viruses, such as retrovirus (RV), lentivirus (LV) vectors, adenovirus (AdV) vectors, and adeno-associated virus (AAV) vectors. Non-viral vectors may include liposomes, molecularly coupled receptors, polymers, composite vectors, and nanoparticle vectors. In this application, the delivery vector may deliver the ASO or isolated nucleic acid molecules described herein into cells.

[0112] In the present application, methods for cellular uptake of expression vectors or delivery vectors include, but are not limited to, electroporation, lipofection, nucleofection, microinjection, viral infection, liposomes, exosomes, polymeric cations or lipids, nucleic acid conjugates, nanoparticles, microbubbles, gene guns, and naked nucleotides.

[0113] In this application, the term "cell" generally includes prokaryotic cells and eukaryotic cells. Nucleic acids can be transfected in cells, plasmids can be propagated in prokaryotic cells, and nucleic acids and encoded polypeptides can be expressed in eukaryotic cells. For example, cells can include ASOs, SDs, BHDs, isolated nucleic acid molecules, expression vectors, and delivery vectors. Cells can be cells from any of the following organs: for example, skin, lungs, heart, kidneys, liver, pancreas, intestines, muscles, glands, eyes, brain, blood, etc. For example, cells can be human cells or mouse cells. For example, cells can be immune cells. For example, immune cells can be T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes, peripheral blood mononuclear cells, embryonic stem cells, lymphoid progenitor cells, and / or pluripotent stem cells. In this application, the term "pharmaceutical composition" generally refers to a chemical or biological composition suitable for administration to an individual. For example, the individual can be a mammal. For example, the pharmaceutical composition may include the ASO, the isolated nucleic acid molecule, the vector and / or the cell, and optionally a pharmaceutically acceptable carrier.

[0114] As used herein, the term "pharmaceutically acceptable carrier" generally refers to materials and / or ingredients that can be incorporated pharmaceutically into a pharmaceutical composition to be administered to a patient without causing any adverse biological effects or interacting in a deleterious manner with any other ingredients in the pharmaceutical composition, such as liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffered solutions; polyesters, polycarbonates, and / or polyanhydrides; and other nontoxic, compatible substances employed in pharmaceutical formulations. Pharmaceutically acceptable carriers include pharmaceutically acceptable salts, where the term "pharmaceutically acceptable salts" includes salts of the active compounds which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.

[0115] As used herein, the term "treat" generally refers to: (1) preventing the development of a disease, disorder, and / or condition in a patient who may be susceptible to the disease but has not yet been diagnosed with the disease; (2) inhibiting the disease, disorder, or condition, that is, arresting its development; and (3) relieving the disease, disorder, or condition, that is, causing the disease, disorder, and / or condition and / or symptoms associated with the disease, disorder, and / or condition to subside.

[0116] In this application, the term "subject" generally refers to a human or non-human animal, including but not limited to a cat, dog, horse, pig, cow, sheep, rabbit, mouse, rat, or monkey.

[0117] In this application, the term "RNA editing" generally refers to a co-transcriptional or post-transcriptional modification process that introduces changes in the RNA sequence encoded by the genome, resulting in RNA mutations. The editing of adenosine in double-stranded RNA (dsRNA) to inosine (A- to -I), catalyzed by adenosine deaminases acting on RNA (ADAR) enzymes, is a common type of RNA editing in mammals. In vertebrates, a family of three ADAR proteins, ADAR1, ADAR2, and ADAR3, has been previously characterized. ADAR1 and ADAR2 (ADAR) catalyze all currently known A- to -I editing sites. ADAR3 has no known deaminase activity. Inosine (I) mimics guanosine (G), so ADAR proteins introduce a virtual A to G substitution in the transcript. This change can lead to specific amino acid substitutions, alternative splicing, miRNA-mediated gene silencing, changes in transcript localization or stability or expression.

[0118] In the present application, RNA editing can be used not only in animal cells, such as mammalian cells, but also in plants or fungi, for example, in plants or fungi with endogenously expressed deaminases (such as ADARs). The methods of the present application can be used to generate optimized genetically engineered plants and fungi.

[0119] In this application, the terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" refer to the nucleobases themselves. The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," and "inosine" refer to nucleobases linked to a ribose or deoxyribose sugar moiety. The term "nucleoside" refers to a nucleobase linked to a ribose or deoxyribose sugar moiety.

[0120] In this application, the term "nucleotide" refers to the respective nucleobase-ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate. In this application, the terms "adenosine" and "adenine" (abbreviated "A"), "guanosine" and "guanine" (abbreviated "G"), "cytidine" and "cytosine" (abbreviated "C"), "uridine" and "uracil" (abbreviated "U"), "thymidine" and "thymine" (abbreviated "T"), "hypoxanthine" and "inosine" (abbreviated "I"), are used interchangeably.

[0121] In this application, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (eg, an animal, plant, and / or microorganism).

[0122] In this application, the term "in vivo" refers to events that occur within an organism (eg, an animal, a plant, and / or a microorganism).

[0123] In this application, the term "and / or" should be understood to mean either one of the alternatives or both of the alternatives.

[0124] In this application, the term "comprising" generally means including the features explicitly specified, but not excluding other elements. In some cases, "comprising" also covers the case where only the specified components are included. For example, "comprising" is also intended to mean "consisting of..."

[0125] In this application, the term "about" generally refers to a variation within a range of 0.5%-10% above or below the specified value, for example, a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0126] In this application, the term "include" generally means to include, encompass, contain or encompass. In some cases, it also means "to be", "to be composed of..."

[0127] Detailed Description of the Invention

[0128] Single-stranded antisense oligonucleotides for targeted RNA editing

[0129] On the one hand, the present application provides a single-stranded antisense oligonucleotide (ASO) for targeted RNA editing, wherein the ASO comprises a targeting region (Specificity Domain, SD) and a binding helper domain (BHD), wherein the SD is complementary to the targeted RNA region, and the BHD is complementary to the non-targeted RNA region, and the ASO is capable of forming a double-stranded complex with the target RNA.

[0130] In the present application, the targeting RNA region and the non-targeting RNA region are non-contiguous.

[0131] For example, the length of the target RNA region and the non-target RNA region interval can be 4-1000nt. For example, the length of the target RNA region and the non-target RNA region interval can be 4-200nt. For example, the length of the target RNA region and the non-target RNA region interval can be 200-500nt. For example, the length of the target RNA region and the non-target RNA region interval can be 500-1000nt. For example, the length of the target RNA region and the non-target RNA region interval can be 4-200nt. For example, the length of the target RNA region and the non-target RNA region interval can be 4nt, 8nt, 11nt, 12nt, 24nt, 25nt, 36nt, 237nt, 340nt, 343nt, 494nt, 681nt nt.

[0132] In the present application, the ASO can deaminize the target adenosine in the target RNA region by the ADAR enzyme present in the cell.

[0133] In the present application, the target RNA is selected from one or more of the following groups: pre-mRNA, mRNA, rRNA, tRNA, lnc-RNA, snRNA, and snoRNA.

[0134] In the present application, the ASO may have one or more modifications.

[0135] For example, the BHD in the ASO may comprise one or more modifications. For example, the SD in the ASO may comprise one or more modifications.

[0136] For example, the modification may be a sugar modification and / or a base modification.

[0137] For example, the ASO may comprise an isotopic modification. For example, the ASO may comprise an isotopic modification of one or more elements (e.g., hydrogen, carbon, nitrogen, etc.). For example, the ASO may comprise one or more isotopic modifications.

[0138] For example, in the ASO, the modified nucleobase may be a nucleobase. The modified nucleobase may have at least one function of a nucleobase. For example, it may be capable of base complementary pairing. For example, the modified nucleobase may be A, T, C, G, or U. For example, the base may be subjected to substitution modification, and the substitution modification may be a DNA base substitution modification and / or a nucleoside analog substitution modification (such as inosine). For example, the ASO may contain one or more modified nucleobases. For example, the modified nucleobase percentage in the ASO can be about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-85%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-85%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-85%, 70%-85%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-85%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-95%, 70%-80%, 70%-85 ...0%, 70%-85%, 70%-85%, 70%-90%, 70%-95%, 70%-80%, 0%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%, etc.

[0139] For example, in the ASO, the modified sugar may be ribose. The modified sugar may have the spatial arrangement, electronic properties, or some other physicochemical properties of the unmodified ribose. For example, the modified sugar is a substituted ribose or deoxyribose. For example, the modified sugar comprises a 2'-modification, and the 2'-modification may be 2'-MOE, 2'-OR, such as 2'-OMe (wherein R represents an alkyl group), 2'-F. For example, the modified sugar may comprise an LNA modification. For example, the modified sugar may comprise a UNA modification. For example, the ASO may comprise one or more modified sugars. For example, the modified sugar content of the ASO may be about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-85%, 70%-90%, 70%-95%, 70 ... %-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%, etc.

[0140] Binding Helper Domain (BHD)

[0141] In another aspect, the ASO provided herein comprises a BHD, and the sequence in the target RNA to which the BHD binds does not comprise a target site.

[0142] In the present application, BHD can increase the stability of the double-stranded complex formed between ASO and target RNA. In the present application, BHD may not have a recruitment function.

[0143] For example, the improved stability can be reflected in an improved editing efficiency of the ASO. For example, the editing efficiency of the ASO can be increased by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an ASO without BHD.

[0144] In the present application, the BHD can be fully complementary to the non-target RNA region.

[0145] In the present application, the BHD may be complementary to a non-target RNA region and may have one or more mismatches, wobbles, deletions, and / or bulges.

[0146] For example, the complementary pairing principle is Watson-Crick or Hoogsteen base pairing. For example, the complementary pairing can refer to AT, CG, T*A / T ​​(referring to that protonated T can pair with the A in the AT base pair), C*G / C (referring to that protonated C can pair with the G in the GC base pair). For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) base mispairing. For example, there may be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) wiggles. For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) deletions. For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) protrusions.For example, the complementarity between the BHD and the non-targeting RNA region is about 50%-100% (e.g., about 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%). In some embodiments, the complementarity is at least about 60%. In some embodiments, the complementarity is at least about 65%. In some embodiments, the complementarity is at least about 70%. In some embodiments, the complementarity is at least about 75%. In some embodiments, the complementarity is at least about 80%. In some embodiments, the complementarity is at least about 85%. In some embodiments, the complementarity is at least about 90%. In some embodiments, the complementarity is at least about 90%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. For example, the complementarity is at least about 95%.

[0147] In the present application, BHD may have one or more modifications selected from the following group: sugar modification, base modification.

[0148] For example, the BHD may have one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, and inosine substitution modification.

[0149] For example, the BHD may have phosphorothioate modification, 2'-OMe, or LNA modification. For example, the BHD may have phosphorothioate modification, 2'-OMe modification.

[0150] In the present application, the length of the BHD may be 8-40 nt.

[0151] For example, the length of the BHD can be 8-15 nt, 8-25 nt, 8-35 nt, 15-25 nt, 15-35 nt, 15-40 nt, 25-35 nt, 25-40 nt, 35-40 nt. For example, the length of the BHD can be 15 nt, 20 nt, 25 nt.

[0152] In this application, the ASO may contain one or more BHDs.

[0153] For example, there may be 1-10 BHDs (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) BHDs may have different lengths, and the relative positions of the BHDs to the SD may be different.

[0154] In the present application, the one or more BHDs may not form a secondary structure within the molecule.

[0155] In the present application, the one or more BHDs may form a secondary structure within the molecule.

[0156] In the present application, the multiple BHDs may not form an intermolecular secondary structure.

[0157] In the present application, the multiple BHDs can form an intermolecular secondary structure.

[0158] In the present application, the one or more BHDs may not form an intermolecular secondary structure with the SD.

[0159] In the present application, the one or more BHDs can form an intermolecular secondary structure with SD.

[0160] For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) intramolecular secondary structures. For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) intermolecular secondary structures.

[0161] For example, secondary structure can refer to the structure formed by incomplete complementary pairing of nucleic acid molecules. Incomplete complementary pairing may cause protrusions, wiggles, deletions, and / or mismatches. For example, secondary structure can refer to the secondary structure formed by the interaction of bases within the RNA molecule, or it can refer to the secondary structure formed by the interaction of bases between molecules. Loops can refer to the secondary structure formed by the protrusion of unpaired bases, stems can refer to the local A-type double helical secondary structure formed by the pairing of complementary bases, and arms can refer to the non-paired nucleotide secondary structure that is close to the stem and does not belong to the loop.

[0162] In this application, the connection order of the BHD and SD is not limited.

[0163] For example, the BHD may be located at the 5' end of the SD. For example, the BHD may be located at the 3' end of the SD. For example, the multiple BHDs may be located at the 5' end of the SD. For example, the multiple BHDs may be located at the 3' end of the SD. For example, the multiple BHDs may be located at both the 5' end and the 3' end of the SD.

[0164] In this application, the connection method between the BHD and SD is not limited.

[0165] For example, the BHD can be directly connected to the SD. For example, the BHD can be indirectly connected to the SD. For example, the indirect connection can be connected through one or more linkers, and the multiple linkers can be of the same type or different types. For example, the linker can include one or more nucleotides, oligopeptides, or any other chemical linkers, which are conventional (phosphodiester) or modified (such as phosphorothioate). For example, the linker is selected from one or more of the following groups: AAA, AAAC, AACAA, AAAACAAAAA, PEG2, C6. For example, the linker can be AAA. For example, the linker can be AAAC. For example, the linker can be AACAA. For example, the linker can be AAAACAAAAA. For example, the linker can be PEG2. For example, the linker can be C6. For example, when multiple BHDs are connected to the SD, there can be one or more linkers, and the types of linkers can be the same or different.

[0166] Targeting region (Specificity Domain, SD)

[0167] The ASO provided herein comprises an SD, wherein the sequence in the target RNA bound by the SD comprises a target site. The ASO recognizes and binds to the target RNA via the SD.

[0168] In the present application, the SD can be fully complementary to the target RNA region.

[0169] In the present application, the SD may be complementary to the target RNA region and may have one or more mismatches, wobbles, deletions, and / or protrusions.

[0170] For example, the complementary pairing principle is Watson-Crick or Hoogsteen base pairing. For example, the complementary pairing can refer to AT, CG, T*A / T ​​(referring to that protonated T can pair with the A in the AT base pair), C*G / C (referring to that protonated C can pair with the G in the GC base pair). For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) base mispairing. For example, there may be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) wiggles. For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) deletions. For example, there can be 1-10 (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.) protrusions.For example, the complementarity between the SD and the targeting RNA region is about 50%-100% (e.g., about 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, In some embodiments, the complementarity is at least about 60%. In some embodiments, the complementarity is at least about 65%. In some embodiments, the complementarity is at least about 70%. In some embodiments, the complementarity is at least about 75%. In some embodiments, the complementarity is at least about 80%. In some embodiments, the complementarity is at least about 85%. In some embodiments, the complementarity is at least about 90%. In some embodiments, the complementarity is at least about 90%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 100%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 150%. In some embodiments, the complementarity is at least about 150%. For example, the complementarity is at least about 95%.

[0171] In the present application, the SD may have one or more modifications selected from the following group: sugar modification, base modification.

[0172] For example, the SD may have one or more modifications selected from the group consisting of phosphorothioate, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, 2'-FANA, DNA base substitution, and inosine substitution. For example, the SD may have a phosphorothioate modification. For example, the SD may have a 2'-OMe modification. For example, the SD may have a 2'-F modification. For example, the SD may have a phosphorothioate modification and a 2'-OMe modification. For example, the SD may have a phosphorothioate modification and a 2'-F modification.

[0173] In the present application, the length of the SD may be 20-50 nt.

[0174] For example, the length of the SD may be 20-25 nt, 20-30 nt, 20-40 nt, 20-45 nt, 30-35 nt, 30-40 nt, 30-45 nt, 30-50 nt, 40-45 nt, or 45-50 nt. For example, the length of the SD may be 30 nt.

[0175] Targeted RNA region and non-targeted RNA region

[0176] In the present application, the target RNA region comprises a target adenosine.

[0177] In the present application, the length of the targeting RNA region can be 15-60 nt, which includes a sequence that binds to the SD and may also include mismatches, protrusions, deletions, and / or wobble sequences.

[0178] For example, the length of the targeting RNA region can be 15-20nt, 15-30nt, 15-40nt, 15-50nt, 25-30nt, 25-40nt, 25-50nt, 25-60nt, 35-40nt, 35-50nt, 35-60nt, 45-50nt, 45-60nt. For example, the length of the targeting RNA region can be 30nt.

[0179] In the present application, the non-targeting RNA region does not contain a target adenosine, but contains a sequence that binds to BHD, and may also contain a mismatch, protrusion, deletion, and / or wobble sequence.

[0180] In the present application, the length of the non-targeting RNA region is 5-50 nt.

[0181] For example, the length of the non-targeting RNA region can be 5-10nt, 5-20nt, 5-30nt, 5-40nt, 15-20nt, 15-30nt, 15-40nt, 15-50nt, 25-30nt, 25-40nt, 25-50nt, 35-40nt, 35-50nt, 45-50nt. For example, the length of the non-targeting RNA region can be 15nt, 20nt, 25nt.

[0182] Methods for editing RNA

[0183] In another aspect, the present application provides a method for editing RNA, which may comprise using the ASO.

[0184] In this application, the method may include the following steps:

[0185] (1) providing the ASO;

[0186] (2) allowing cells to take up the ASO;

[0187] (3) allowing the ASO to bind to the target RNA;

[0188] (4) Allowing intracellular ADAR enzymes to deaminate target adenosine in the targeted RNA region to inosine;

[0189] (5) Identify the presence of inosine in the targeted RNA region.

[0190] In the present application, the method described can recruit endogenous deaminase to perform deamination reaction on specific nucleotide sites.

[0191] In the present application, the method described can improve editing efficiency. For example, the editing efficiency can be improved by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to not using the ASO.

[0192] For example, the ADAR is ADAR1 and / or ADAR2. For example, the ADAR is one or more ADARs selected from the group consisting of hADAR1, hADAR2, mouse ADAR1, mouse ADAR2.

[0193] For example, RNA editing methods can be used not only in animal cells, e.g., mammalian cells, but can also be used to edit RNA in plants or fungi. For example, in plants or fungi with endogenously expressed ADARs, the RNA editing methods provided by themselves can be used to produce genetically engineered plants and fungi with improved properties.

[0194] One or more isolated nucleic acid molecules

[0195] In another aspect, the present application provides one or more isolated nucleic acid molecules encoding the ASOs described herein, including the SD and BHD sequences within the ASOs, wherein the encoded ASOs, SDs, and BHD sequences are unmodified. The sequences encoded by the one or more isolated nucleic acid molecules can be further modified. The modified or unmodified encoded sequences can be used for RNA editing. The encoded SD can be directly or indirectly linked to one or more encoded BHD sequences to produce an ASO.

[0196] carrier

[0197] On the other hand, the present application provides an expression vector that can express the ASO, SD, and BHD described in this application. The expression vector can add expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton of the cloning vector, and then express the ASO, SD, and BHD in this application. For example, the expression vector can be a plasmid. The ASO expressed by the expression vector can be further modified; the SD expressed by the expression vector can be directly or indirectly linked to one or more BHDs to prepare the ASO, and then the synthesized ASO can be modified or not. The ASO, SD, and BHD expressed by the expression vector can be used for RNA editing.

[0198] On the other hand, the present application provides a delivery vector that can deliver the ASO in the present application to cells. For example, the vector may include a viral vector, a non-viral vector. Viral vectors may include lentivirus (LV) vectors, adenovirus (AdV) vectors, and adeno-associated virus (AAV) vectors. For example, non-viral vectors may include liposomes, molecular coupled receptors, polymers, composite vectors, and nanoparticle vectors. A delivery vector can be used to deliver ASO to cells for RNA editing.

[0199] cell

[0200] On the other hand, the present application provides a cell, which may contain the ASO described in the present application, one or more isolated nucleic acid molecules, expression vectors, and delivery vectors.

[0201] For example, cells can be used for plasmid propagation and then express ASOs, SDs, and BHDs. For example, ASOs can be transfected into cells, ASOs can be taken up by cells through endocytosis, and ASOs can be delivered to cells using delivery vectors for RNA editing.

[0202] For example, the cell is a cell that has endogenously expressed ADAR. For example, the cell manipulation can be performed in vivo. For example, the cell can be isolated from the body or cultured into a cell line and manipulated in vitro.

[0203] Pharmaceutical composition

[0204] In another aspect, the present application provides a pharmaceutical composition, which may comprise the ASO described herein, one or more isolated nucleic acid molecules, expression vectors, delivery vectors, cells, and / or pharmaceutically acceptable carriers.

[0205] For example, the pharmaceutical composition can be administered by intravenous infusion over a period of time. For example, the pharmaceutical composition can be administered by subcutaneous delivery. For example, the pharmaceutical composition can be administered regularly, such as once a week, every two weeks, every month, every two months, every three months, or every four months. For example, after weekly or biweekly administration for three months, administration can be continued monthly for six months, a year, or more.

[0206] application

[0207] On the other hand, the present application provides the ASO, the isolated nucleic acid molecule, the expression vector, the delivery vector, the cell, and the pharmaceutical composition for preventing and / or treating diseases and / or conditions.

[0208] On the other hand, the present application provides the use of the ASO, the one or more isolated nucleic acid molecules, the expression vector, the delivery vector, the cell, and the pharmaceutical composition in the preparation of a drug for preventing and / or treating a disease and / or condition.

[0209] On the other hand, the present application provides a method for preventing and / or treating a disease and / or condition, comprising administering an effective amount of the ASO, the one or more isolated nucleic acid molecules, the expression vector, the delivery vector, the cell, or the pharmaceutical composition to a subject in need thereof.

[0210] For example, the disease and / or disorder can be a single gene or multiple gene mutation-related disease.For example, the gene can be GAPDH, OGT, ATP7B, FGFR, TP53, APC, SERPINA1, MECP2, SCN1A.

[0211] This application also provides the following implementation methods:

[0212] 1. A single-stranded antisense oligonucleotide (ASO) for targeted RNA editing, wherein the ASO comprises a targeting region (Specificity Domain, SD) and a binding helper domain (BHD), wherein the SD is complementary to the targeted RNA region, the BHD is complementary to the non-targeted RNA region, and the ASO is capable of forming a double-stranded complex with the target RNA.

[0213] 2. The ASO of embodiment 1, wherein the targeting RNA region is non-contiguous with the non-targeting RNA region.

[0214] 3. The ASO of any one of embodiments 1-2, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-1000 nt.

[0215] 4. The ASO of any one of embodiments 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-200 nt.

[0216] 5. The ASO of any one of embodiments 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 200-500 nt.

[0217] 6. The ASO of any one of embodiments 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 500-1000 nt.

[0218] 7. The ASO of any one of embodiments 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4 nt, 8 nt, 11 nt, 12 nt, 24 nt, 25 nt, 36 nt, 237 nt, 340 nt, 343 nt, 494 nt, or 681 nt.

[0219] 8. The ASO of any one of embodiments 1-7, wherein the BHD is fully complementary to a non-targeting RNA region.

[0220] 9. The ASO of any one of embodiments 1-7, wherein the BHD is complementary to a non-targeting RNA region and has one or more mismatches, wobbles, deletions, and / or bulges.

[0221] 10. The ASO of any one of embodiments 1-9, wherein the BHD has one or more modifications selected from the group consisting of: sugar modification, base modification.

[0222] 11. The ASO according to any one of embodiments 1-10, wherein the BHD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, and inosine substitution modification.

[0223] 12. The ASO of any one of embodiments 1-11, wherein the BHD has phosphorothioate, 2'-OMe, or LNA modifications.

[0224] 13. The ASO of any one of embodiments 1-12, wherein the BHD is 8-40 nt in length.

[0225] 14. The ASO of any one of embodiments 1-13, wherein the BHD is 15 nt, 20 nt, or 25 nt in length.

[0226] 15. The ASO of any one of embodiments 1-14, wherein the ASO comprises one or more BHDs.

[0227] 16. The ASO of embodiment 15, wherein the one or more BHDs do not form intramolecular secondary structures.

[0228] 17. The ASO of embodiment 15, wherein the plurality of BHDs do not form intermolecular secondary structures.

[0229] 18. The ASO according to any one of embodiments 1-17, wherein the BHD and SD do not form an intermolecular secondary structure.

[0230] 19. The ASO of any one of embodiments 1-18, wherein the BHD is 5' to the SD.

[0231] 20. The ASO of any one of embodiments 1-18, wherein the BHD is 3' to the SD.

[0232] 21. The ASO of any one of embodiments 1-18, wherein the plurality of BHDs are located at the 5' end and / or the 3' end of the SD.

[0233] 22. The ASO of any one of embodiments 1-21, wherein the BHD is directly linked to the SD.

[0234] 23. The ASO of any one of embodiments 1-21, wherein the BHD is indirectly linked to the SD.

[0235] 24. The ASO according to embodiment 23, wherein the BHD and SD are indirectly connected via a linker.

[0236] 25. The ASO according to any one of embodiments 23-24, wherein the linker comprises one or more nucleotides, oligopeptides or any other chemical linkers, either conventional (phosphodiester) or modified (such as phosphorothioate).

[0237] 26. The ASO according to any one of embodiments 23-25, wherein the linker is selected from one or more of the following groups: AAA, AAAC, AACAA, AAAACAAAA, PEG2, C6.

[0238] 27. The ASO of any one of embodiments 22-26, wherein the linker is AAA.

[0239] 28. The ASO of any one of embodiments 22-26, wherein the linker is PEG2.

[0240] 29. The ASO of any one of embodiments 22-26, wherein the linker is C6.

[0241] 30. The ASO of any one of embodiments 1-29, wherein the BHD increases the stability of a double-stranded complex formed by the ASO and the target RNA.

[0242] 31. The ASO of any one of embodiments 1-30, wherein the SD is fully complementary to the target RNA region or has one or more mismatches, wobbles, deletions, and / or bulges.

[0243] 32. The ASO of any one of embodiments 1-31, wherein the SD has one or more modifications selected from the group consisting of: sugar modification, base modification.

[0244] 33. The ASO of any one of embodiments 1-32, wherein the SD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, 2'-FANA, DNA base substitution modification, and inosine substitution modification.

[0245] 34. The ASO of any one of embodiments 1-33, wherein the SD has a phosphorothioate modification.

[0246] 35. The ASO of any one of embodiments 1-34, wherein the SD has a 2'-OMe modification.

[0247] 36. The ASO of any one of embodiments 1-34, wherein the SD has a 2'-F modification.

[0248] 37. The ASO of any one of embodiments 1-36, wherein the SD is 20-50 nt in length.

[0249] 38. The ASO of any one of embodiments 1-37, wherein the SD is 30 nt in length.

[0250] 39. The ASO of any one of embodiments 1-38, wherein the targeting RNA region comprises a target adenosine.

[0251] 40. The ASO of any one of embodiments 1-39, wherein the targeting RNA region is 15-60 nt in length.

[0252] 41. The ASO of any one of embodiments 1-40, wherein the targeting RNA region is 30 nt in length.

[0253] 42. The ASO of any one of embodiments 1-41, wherein the non-targeting RNA region does not comprise a target adenosine.

[0254] 43. The ASO of any one of embodiments 1-42, wherein the non-targeting RNA region is 5-50 nt in length.

[0255] 44. The ASO of any one of embodiments 1-43, wherein the non-targeting RNA region is 15 nt, 20 nt, or 25 nt in length.

[0256] 45. The ASO of any one of embodiments 1-44, wherein the ASO deaminates a target adenosine present in the targeted RNA region by an ADAR enzyme present in the cell.

[0257] 46. ​​The ASO of any one of embodiments 1-45, wherein the target RNA is selected from one or more of the following groups: pre-mRNA, mRNA, rRNA, tRNA, lnc-RNA, snRNA, snoRNA.

[0258] 47. A method of editing RNA comprising using the ASO of any one of embodiments 1-46.

[0259] 48. The method of embodiment 47, wherein the method comprises the following steps:

[0260] (1) Providing the ASO according to any one of embodiments 1-46;

[0261] (2) allowing cells to take up the ASO;

[0262] (3) allowing the ASO to bind to the target RNA;

[0263] (4) Allowing intracellular ADAR enzymes to deaminate target adenosine in the targeted RNA region to inosine;

[0264] (5) Identify the presence of inosine in the targeted RNA region.

[0265] 49. A method according to embodiments 47-48, wherein the method is capable of recruiting endogenous deaminases to perform deamination reactions on specific nucleotide sites.

[0266] 50. One or more isolated nucleic acid molecules encoding the ASO, or the SD comprised by the ASO, or the BHD comprised by the ASO, of any one of embodiments 1-46.

[0267] 51. An expression vector that expresses one or more isolated nucleic acid molecules of embodiment 50.

[0268] 52. A delivery vehicle that delivers the ASO of any one of embodiments 1-46.

[0269] 53. A cell comprising the ASO of any one of embodiments 1-46, the one or more isolated nucleic acid molecules of embodiment 50, the expression vector of embodiment 51, and / or the delivery vector of embodiment 52.

[0270] 54. The cell of embodiment 53, wherein the cell is a eukaryotic cell.

[0271] 55. The cell of any one of embodiments 53-54, wherein the cell is a human cell or a mouse cell.

[0272] 56. The cell of any one of embodiments 53-55, wherein the cell is a liver cell.

[0273] 57. The cell of any one of embodiments 53-56, wherein the cell is a neural cell.

[0274] 58. A pharmaceutical composition comprising the ASO of any one of embodiments 1-46, one or more isolated nucleic acid molecules of embodiment 50, the expression vector of embodiment 51, the delivery vector of embodiment 52, the cell of any one of embodiments 53-57, and / or a pharmaceutically acceptable carrier.

[0275] 59. The ASO of any one of embodiments 1-46, the one or more isolated nucleic acid molecules of embodiment 50, the expression vector of embodiment 51, the delivery vector of embodiment 52, the cell of any one of embodiments 53-57, the pharmaceutical composition of embodiment 58, for use in preventing and / or treating a disease and / or condition.

[0276] 60. Use of the ASO of any one of embodiments 1-46, the one or more isolated nucleic acid molecules of embodiment 50, the expression vector of embodiment 51, the delivery vector of embodiment 52, the cell of any one of embodiments 53-57, or the pharmaceutical composition of embodiment 58 in the preparation of a medicament for preventing and / or treating a disease and / or condition.

[0277] 61. A method for preventing and / or treating a disease and / or condition, comprising administering to a subject in need thereof an effective amount of the ASO of any one of embodiments 1-46, the one or more isolated nucleic acid molecules of embodiment 50, the expression vector of embodiment 51, the delivery vector of embodiment 52, the cell of any one of embodiments 53-57, or the pharmaceutical composition of embodiment 58.

[0278] Without intending to be bound by any theory, the following examples are merely intended to illustrate the ASO of the present application, its preparation method and uses, etc., and are not intended to limit the scope of the present invention.

[0279] Example

[0280] Materials and methods

[0281] Primers

[0282] Primer sequences used in Examples 1 and 4:

[0283] GAPDH-primer-F1 (SEQ ID NO:18): TCATCATCTCTGCCCCCTCT

[0284] GAPDH-primer-R1 (SEQ ID NO:19): GGCAGGGATGATGTTCTGGA

[0285] Primer sequences used in Examples 2 and 5:

[0286] GAPDH-primer-F2 (SEQ ID NO:20): GCTGGCATTGCCCTCAACGA

[0287] GAPDH-primer-R2 (SEQ ID NO:21):ACATGACAAGGTGCGGCTCC

[0288] Primer sequences used in Examples 3 and 6:

[0289] OGT-primer-F (SEQ ID NO:22): TGGCAACAAACCTGACCACA

[0290] OGT-primer-R3 (SEQ ID NO:23):ATCTGGTCGCCGCAAAATTC

[0291] Gene NCBI number:

[0292] GAPDH mRNA: NM_002046.7

[0293] OGT mRNA: NM_181673.3

[0294] ADAR1 CDS: NM_015840.4

[0295] Construction of human ADAR1 expression plasmid

[0296] The full-length sequence of human ADAR1 was amplified by PCR, and homologous arms at both ends of the pcDNA3.1 vector NheI and EcoRI restriction sites were added to its ends. The pcDNA3.1 vector was linearized using NheI and EcoRI double enzyme digestion, and the ADAR1 fragment was connected to the vector using homologous recombination.

[0297] Cell culture

[0298] 1. Cell passaging:

[0299] (1) Disinfect the clean bench with ultraviolet irradiation for 30 minutes;

[0300] (2) Rinse the cells to be passaged with PBS, add an appropriate amount of 0.25% trypsin, and add complete medium containing serum to terminate digestion after the cells become round;

[0301] (3) Transfer the digested cell suspension to a 15 mL centrifuge tube and centrifuge at 200 g for 2 minutes at room temperature;

[0302] (4) Aspirate and discard the supernatant, and add fresh culture medium to resuspend the cells;

[0303] (5) Take 20 μl of cell suspension and 20 μl of trypan blue staining solution and mix them well. Take 20 μl and count the cells using a hemocytometer.

[0304] (6) Take an appropriate amount of cells and inoculate them into a cell culture plate and place them in a cell culture incubator for culture.

[0305] 2. Cell transfection experimental steps:

[0306] (1) Cell transfection experiments can be performed when cells reach 70% confluence after 24 hours of growth;

[0307] (2) Prepare the transfection reagent mixture according to the instructions provided by the transfection reagent lipofectamine 3000 and let it stand at room temperature for 15 minutes;

[0308] (3) Add the transfection solution to the cells, mix gently, and place in the incubator.

[0309] Construction of ADAR1 overexpressing HEK293 cell line

[0310] According to the above steps, the ADAR1 expression vector was transfected into HEK293 cells. After 48 hours, the screening drug G418 was added. The medium was changed every two days. When there were no living cells in the non-transfected group, the screening of HEK293 cell lines stably transfected with ADAR1 was completed.

[0311] ASO editorial level verification

[0312] 4.5×10 5 HER293 cells stably overexpressing ADAR1 or 3×10 5Hela cells were seeded into each well of a 12-well plate. After 24 hours, ASOs were transfected when the cells were 80%-90% full. ASOs were transfected using lipo8000 (Biyuntian) at a rate of 40 pmol per well. After 48 hours, the cells were collected and RNA was extracted using an RNA isolation kit (Norwegian), followed by DNase I (Thermo) digestion, reverse transcription (Promega), and PCR amplification of the target site using the corresponding primers and DNA Taq enzyme (GeneStar). The DNA products were analyzed using agarose gels, gel-purified according to size (ZYMO), and then sent to Jinweizhi for Sanger sequencing. The A-to-I editing yield was quantified by measuring the height of G and A at each site and dividing the G height by the sum of the G and A peak heights. If sequencing is performed using a reverse primer, the peak heights of C and T are processed accordingly.

[0313] ASO sequence

[0314] Table 1 ASO sequences used in this application

[0315] Example 1 Editing specific adenosine residues in the CDS region of the GAPDH gene using different ASOs

[0316] RNA editing was investigated in human ADAR1-overexpressing HEK293 cells to investigate whether different ASO structures, SEQ-1 to SEQ-9 (Figure 1), could deaminize the A base in the middle of a specific UAG triplet in the CDS region of endogenous GAPDH mRNA to an I (which is subsequently read as a G). As shown in Figure 1: SEQ-1 contains only the SD region; SEQ-2 to SEQ-4 contain both the SD and downstream BHD, connected by a linker with three adenosines, PEG2, and C6, respectively; SEQ-5 contains both the SD and downstream BHD, without a linker; SEQ-6 to SEQ-7 contain both the SD and upstream BHD, connected by a linker with three adenosines; SEQ-8 ​​and SEQ-9 contain both the SD, downstream BHD, and upstream BHD, with the BHD and SD in SEQ-8 ​​connected by three adenosines, and SEQ-9 does not contain a linker. The SD region sequences of SEQ-1 to SEQ-9 are the same in length (30nt); the downstream BHD region sequences of SEQ-2 to SEQ-5 are the same in length (15nt); the upstream BHD regions of SEQ-6 and SEQ-7 are 25nt and 20nt long, respectively; the upstream and downstream BHD regions of SEQ-8 ​​and SEQ-9 are 15bp long.

[0317] The experimental results are shown in the figure:

[0318] Figure 2 shows that A-to-G conversion at the target adenosine was observed in SEQ-2 to SEQ-4 transfected with both the SD and downstream BHD structures, and in SEQ-1 containing only the SD structure. However, the editing level at the specific site for SEQ-1 was only 18%, while the corresponding editing levels for SEQ-2 to SEQ-4 were 40%, 36%, and 35%, respectively, significantly improving the editing efficiency. Furthermore, the editing efficiency of SEQ-5, which lacks a specific linker but contains both the SD and downstream BHD, was 34%, also significantly improving the editing efficiency.

[0319] The above results show that:

[0320] The downstream BHD structure can effectively help SD improve editing efficiency, and the connection between SD and BHD with different forms of linkers or without linkers can help SD improve editing.

[0321] The experimental results are shown in the figure:

[0322] FIG2 shows that the editing levels of SEQ-6 (BHD is 25 nt) and SEQ-7 (BHD is 20 nt) transfected with both SD and upstream BHD were 29% and 22%, respectively, which were significantly increased compared with SEQ-1.

[0323] The above results show that:

[0324] Upstream BHD structures of different lengths can effectively help SD improve editing efficiency.

[0325] The experimental results are shown in the figure:

[0326] Figure 2 shows that the editing efficiencies of SEQ-8 ​​and SEQ-9 (without linker) transfected with SD, downstream BHD, and upstream BHD were 29% and 24%, respectively, which were significantly improved compared to SEQ-1.

[0327] The above results show that:

[0328] Having both upstream BHD and downstream BHD (with or without linker) can help SD improve editing.

[0329] Example 2 Editing specific adenosine residues in the 3'UTR region of the GAPDH gene using different ASOs

[0330] RNA editing was investigated in human ADAR1-overexpressing HEK293 cells to examine whether ASOs with different structures, SEQ10-SEQ21 ( FIG3 ), could deaminize the A base in the middle of a specific UAG triplet in the 3′UTR region of endogenous GAPDH mRNA to an I (which is subsequently read as a G).

[0331] Figure 3 shows that SEQ-10 only contains the SD region; SEQ-11 to SEQ-13 contain SD and downstream BHD at the same time, and are connected in the middle by three adenosines, PEG2, and C6, respectively; SEQ-14 contains SD and downstream BHD at the same time, with no linker in the middle; SEQ-15 to SEQ-18 contain SD and upstream BHD at the same time, and are connected in the middle by three adenosines; SEQ-19 contains SD and upstream BHD at the same time, with no linker in the middle; SEQ-20 and SEQ-21 contain SD, downstream BHD, and upstream BHD at the same time, among which the BHD and SD of SEQ-20 are connected by three adenosines, and SEQ-21 does not contain a linker. The SD region sequences of SEQ-10 to SEQ-21 are the same in length (30nt); the downstream BHD region sequences of SEQ-11 to SEQ-14 are the same in length (15nt); the upstream BHD region of SEQ-15 and SEQ-16 is 25nt long, and the upstream BHD region of SEQ-17 and SEQ-18 is 20nt long, among which the upstream BHD sequences of SEQ-16 and SEQ-19 are the same; the upstream and downstream BHD of SEQ-20 and SEQ-21 are 15bp long.

[0332] The experimental results are shown in the figure:

[0333] Figure 4 shows that transfections of SEQ-11 to SEQ-13 containing both the SD and downstream BHD constructs, and SEQ-10 containing only the SD construct, all observed A-to-G conversions at the target adenosine. However, the editing level at this specific site for SEQ-10 was only 18%, while the corresponding editing levels for SEQ-11 to SEQ-13 were 39%, 24%, and 27%, respectively, significantly improving editing efficiency. Furthermore, transfections of SEQ-14 without the specific linker but containing both the SD and BHD constructs achieved an editing efficiency of 40%, also demonstrating improved editing efficiency.

[0334] The above results show that:

[0335] The downstream BHD structure can effectively help SD improve editing efficiency, and the connection between SD and BHD with different forms of linkers or without linkers can help SD improve editing.

[0336] The experimental results are shown in the figure:

[0337] Figure 4 shows that the editing levels of SEQ-15 and SEQ-16 transfected with both SD and upstream BHD (25nt) were 20% and 30%, respectively, and the editing level of SEQ-18 transfected with both SD and upstream BHD (20nt) was 22%, which was significantly improved compared with SEQ-10; in addition, the editing efficiency of SEQ-19 transfected without a special linker but with both SD and upstream BHD was 20%, which also improved the editing efficiency.

[0338] The above results show that:

[0339] Upstream BHD structures of different lengths (with or without linker) can effectively help SD improve editing efficiency.

[0340] The experimental results are shown in the figure:

[0341] Figure 4 shows that the editing efficiencies of SEQ-20 and SEQ-21 (without linker) transfected with SD, downstream BHD, and upstream BHD were 35% and 21%, respectively, which were significantly improved compared to SEQ-10.

[0342] The above results show that:

[0343] Having both upstream BHD and downstream BHD (with or without linker) can help SD improve editing.

[0344] Example 3 Editing a specific adenosine in the 3'-UTR region of the N-acetylglucosamine transferase gene (OGT) using different ASOs

[0345] RNA editing was investigated in a human ADAR1-overexpressing HEK293 cell line to examine whether ASOs with different structures, SEQ-22 to SEQ-29 ( FIG. 5 ), could deaminize the A in the middle of the UAC triplet in the 3′-UTR region of the endogenous OGT gene to I (which is subsequently read as G).

[0346] Figure 5 shows that SEQ-22 contains only the SD region; SEQ-23 to SEQ-25 contain both the SD and downstream BHD, connected by a linker with three adenosines, PEG2, and C6, respectively; SEQ-26 contains both the SD and downstream BHD, without a linker; SEQ-27 to SEQ-28 contain both the SD and upstream BHD, connected by a linker with three adenosines; SEQ-29 contains both the SD, downstream BHD, and upstream BHD, connected by three adenosines. The SD region sequences and lengths of SEQ-22 to SEQ-29 are identical (30 nt); the downstream BHD regions of SEQ-13 to SEQ-26 are identical (15 nt); the upstream BHD region of SEQ-27 is 25 nt long, and the upstream BHD region of SEQ-28 is 20 nt long; and the upstream and downstream BHD regions of SEQ-29 are 15 bp long.

[0347] The experimental results are shown in the figure:

[0348] Figure 6 shows that transfection of SEQ-23 to SEQ-25 containing both the SD and downstream BHD constructs, and SEQ-22 containing only the SD construct, all observed A-to-G conversion at the target adenosine. However, the editing level at this specific site for SEQ-22 was only 20%, while the corresponding editing levels for SEQ-23 to SEQ-25 were 28%, 38%, and 44%, respectively, significantly improving editing efficiency. Furthermore, transfection of SEQ-26 without the specific linker but containing both the SD and BHD constructs achieved an editing efficiency of 26%, also demonstrating improved editing efficiency.

[0349] The above results show that:

[0350] The downstream BHD structure can effectively help SD improve editing efficiency, and the connection between SD and BHD with different forms of linkers or without linkers can help SD improve editing.

[0351] The experimental results are shown in the figure:

[0352] Figure 6 shows that the editing level of SEQ-27 transfected with both SD and upstream BHD (25nt) was 24%, and the editing level of SEQ-28 transfected with both SD and upstream BHD (20nt) was 21%, which were significantly improved compared with SEQ-22.

[0353] The above results show that:

[0354] Upstream BHD structures of different lengths can effectively help SD improve editing efficiency.

[0355] Example 4 Editing of specific adenosine residues in the CDS region of the GAPDH gene using different ASOs in Hela cells

[0356] RNA editing was investigated in HeLa cells using endogenously expressed ADAR deaminases. Different ASO structures, SEQ-1 to SEQ-8 ​​( FIG1 ), were used to investigate whether the A base within a specific UAG triplet in the CDS region of endogenous GAPDH mRNA could be deaminated to an I (which is subsequently read as a G). The structures of SEQ-1 to SEQ-8 ​​are described in Example 1.

[0357] The experimental results are shown in the figure:

[0358] Figure 7 shows that both SEQ-2, containing both the SD and downstream BHD constructs, and SEQ-1, containing only the SD construct, observed an A-to-G conversion at the target adenosine. However, the editing level at this specific site for SEQ-1 was only 17%, while the corresponding editing level for SEQ-2 was 35%, significantly improving editing efficiency. Furthermore, the editing efficiency of SEQ-5, which lacks a specific linker but contains both the SD and downstream BHD constructs, was 23%, also demonstrating improved editing efficiency.

[0359] The above results show that:

[0360] The downstream BHD structure can effectively help SD improve editing efficiency, and whether SD and BHD are connected with a linker or without a linker can help SD improve editing.

[0361] The experimental results are shown in the figure:

[0362] FIG7 shows that the editing level of SEQ-6 (BHD is 25 nt) transfected with both SD and upstream BHD was 27%, which was significantly increased compared with SEQ-1.

[0363] The above results show that:

[0364] The upstream BHD structure can effectively help SD improve editing efficiency.

[0365] The experimental results are shown in the figure:

[0366] FIG7 shows that the editing efficiency of SEQ-8 ​​transfected with SD, downstream BHD, and upstream BHD was 31%, which was significantly improved compared with SEQ-1.

[0367] The above results show that:

[0368] Having both upstream BHD and downstream BHD can help SD improve editing.

[0369] Example 5 Editing specific adenosine residues in the 3'UTR region of the GAPDH gene using different ASOs in Hela cells

[0370] RNA editing was investigated in HeLa cells using endogenously expressed ADAR deaminases. Different ASO structures, SEQ-10 to SEQ-21 ( FIG3 ), were used to investigate whether they could deaminize the A base within a specific UAG triplet in the 3' UTR region of endogenous GAPDH mRNA to an I (which is subsequently read as a G). The structures of SEQ-10 to SEQ-21 are described in Example 2.

[0371] The experimental results are shown in the figure:

[0372] Figure 8 shows that A-to-G conversion at the target adenosine was observed when SEQ-11 to SEQ-13, which contain both the SD and downstream BHD constructs, and SEQ-10, which contains only the SD construct, were transfected. However, the editing level at this specific site for SEQ-10 was only 10%, while the corresponding editing levels for SEQ-11 to SEQ-13 were 30%, 26%, and 20%, respectively, significantly improving the editing efficiency. Furthermore, the editing efficiency of SEQ-14, which contains both the SD and BHD constructs but lacks a specific linker, was 29%, also demonstrating improved editing efficiency.

[0373] The above results show that:

[0374] The downstream BHD structure can effectively help SD improve editing efficiency, and the connection between SD and BHD with different forms of linkers or without linkers can help SD improve editing.

[0375] The experimental results are shown in the figure:

[0376] Figure 8 shows that the editing levels of SEQ-15 and SEQ-16 transfected with both SD and upstream BHD (25nt) were 17% and 35%, respectively, and the editing levels of SEQ-17 and SEQ-18 transfected with both SD and upstream BHD (20nt) were 16% and 22%, respectively, which were significantly improved compared with SEQ-10; in addition, the editing efficiency of SEQ-19 transfected without a special linker but containing both SD and upstream BHD was 26%, which also improved the editing efficiency.

[0377] The above results show that:

[0378] Upstream BHD structures of different lengths (with or without linker) can effectively help SD improve editing efficiency.

[0379] The experimental results are shown in the figure:

[0380] Figure 8 shows that the editing efficiencies of SEQ-20 and SEQ-21 (without linker) transfected with SD, downstream BHD, and upstream BHD were 18% and 20%, respectively, which were significantly improved compared to SEQ-10.

[0381] The above results show that:

[0382] Having both upstream BHD and downstream BHD (with or without linker) can help SD improve editing.

[0383] Example 6 Editing a specific adenosine residue in the 3'-UTR region of the N-acetylglucosamine transferase gene (OGT) using different ASOs in Hela cells

[0384] RNA editing was investigated in HeLa cells using endogenously expressed ADAR deaminases. Different ASO structures, SEQ-22 to SEQ-29 ( FIG5 ), were used to investigate whether they could deaminize the A in the middle of the UAC triplet in the 3'-UTR of the endogenous OGT gene to an I (which is subsequently read as a G). The structures of SEQ-22 to SEQ-29 are described in Example 3.

[0385] The experimental results are shown in the figure:

[0386] Figure 9 shows that A to G conversion at the target adenosine was observed when SEQ-23 to SEQ-24, which contain both the SD and downstream BHD constructs, and SEQ-22, which contains only the SD construct, were transfected. However, the editing level at this specific site for SEQ-22 was only 20%, while the corresponding editing levels for SEQ-23 and SEQ-24 were 39% and 39%, respectively, significantly improving the editing efficiency. Furthermore, the editing efficiency of SEQ-26, which contains both the SD and BHD constructs but lacks a specific linker, was 34%, also significantly improving the editing efficiency.

[0387] The above results show that:

[0388] The downstream BHD structure can effectively help SD improve editing efficiency, and the connection between SD and BHD with different forms of linkers or without linkers can help SD improve editing.

[0389] The experimental results are shown in the figure:

[0390] Figure 9 shows that the editing level of SEQ-27 transfected with both SD and upstream BHD (25nt) was 43%, and the editing level of SEQ-28 transfected with both SD and upstream BHD (20nt) was 29%, which were significantly improved compared with SEQ-22.

[0391] The above results show that:

[0392] Upstream BHD structures of different lengths can effectively help SD improve editing efficiency.

[0393] The experimental results are shown in the figure:

[0394] The editing efficiency of SEQ-29 transfected with SD, downstream BHD and upstream BHD was 35%, which was significantly improved compared with SEQ-22.

[0395] The above results show that:

[0396] Having both upstream BHD and downstream BHD can help SD improve editing.

Claims

1. A single-stranded antisense oligonucleotide (ASO) for targeted RNA editing, wherein the ASO comprises a targeting region (Specificity Domain, SD) and an auxiliary binding region (Binding Helper Domain, BHD), wherein the SD is complementary to the targeting RNA region, the BHD is complementary to the non-targeting RNA region, and the ASO can form a double-stranded complex with the target RNA.

2. The ASO of claim 1, wherein the targeting RNA region is non-contiguous with the non-targeting RNA region.

3. The ASO according to any one of claims 1-2, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-1000 nt.

4. The ASO according to any one of claims 1 to 3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4-200 nt.

5. The ASO according to any one of claims 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 200-500 nt.

6. The ASO according to any one of claims 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 500-1000 nt.

7. The ASO according to any one of claims 1-3, wherein the length of the interval between the targeting RNA region and the non-targeting RNA region is 4nt, 8nt, 11nt, 12nt, 24nt, 25nt, 36nt, 237nt, 340nt, 343nt, 494nt, or 681nt.

8. The ASO according to any one of claims 1-7, wherein the BHD is fully complementary to the non-targeting RNA region.

9. The ASO according to any one of claims 1-7, wherein the BHD is complementary to a non-targeting RNA region and has one or more mismatches, wobbles, deletions, and / or bulges.

10. The ASO according to any one of claims 1-9, wherein the BHD has one or more modifications selected from the group consisting of sugar modification and base modification.

11. The ASO according to any one of claims 1-10, wherein the BHD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, and inosine substitution modification.

12. The ASO according to any one of claims 1-11, wherein the BHD has phosphorothioate modification, 2'-OMe, or LNA modification.

13. The ASO according to any one of claims 1-12, wherein the BHD is 8-40 nt in length.

14. The ASO according to any one of claims 1-13, wherein the BHD has a length of 15 nt, 20 nt, or 25 nt.

15. The ASO of any one of claims 1-14, wherein the ASO comprises one or more BHDs.

16. The ASO of claim 15, wherein the one or more BHDs do not form intramolecular secondary structures. The ASO according to claim 15 , wherein the plurality of BHDs do not form intermolecular secondary structures.

18. The ASO according to any one of claims 1 to 17, wherein the BHD and SD do not form an intermolecular secondary structure.

19. The ASO of any one of claims 1-18, wherein the BHD is at the 5' end of the SD.

20. The ASO of any one of claims 1-18, wherein the BHD is 3' to the SD.

21. The ASO according to any one of claims 1-18, wherein the plurality of BHDs are at the 5' end and / or the 3' end of the SD.

22. The ASO according to any one of claims 1-21, wherein the BHD is directly connected to the SD.

23. The ASO of any one of claims 1-21, wherein the BHD is indirectly connected to the SD.

24. The ASO according to claim 23, wherein the BHD and SD are indirectly connected via a Linker.

25. The ASO according to any one of claims 23-24, wherein the linker comprises one or more nucleotides, oligopeptides or any other chemical linkers, either conventional (phosphodiester) or modified (such as phosphorothioate).

26. The ASO according to any one of claims 23-25, wherein the linker is selected from one or more of the following groups: AAA, AAAC, AACAA, AAAACAAAA, PEG2, C6.

27. The ASO according to any one of claims 22 to 26, wherein the Linker is AAA.

28. The ASO according to any one of claims 22-26, wherein the linker is PEG2.

29. The ASO according to any one of claims 22-26, wherein the linker is C6.

30. The ASO of any one of claims 1-29, wherein the BHD increases the stability of a double-stranded complex formed by the ASO and the target RNA.

31. The ASO according to any one of claims 1-30, wherein the SD is fully complementary to the targeting RNA region or has one or more mismatches, wobbles, deletions, and / or bulges.

32. The ASO according to any one of claims 1-31, wherein the SD has one or more modifications selected from the group consisting of: sugar modification, base modification.

33. The ASO according to any one of claims 1-32, wherein the SD has one or more modifications selected from the group consisting of phosphorothioate modification, 2'-OMe, 2'-F, LNA, UNA, 2'-MOE, 2'-FANA, DNA base substitution modification, and inosine substitution modification.

34. The ASO of any one of claims 1-33, wherein the SD has a phosphorothioate modification.

35. The ASO of any one of claims 1-34, wherein the SD has a 2'-OMe modification.

36. The ASO of any one of claims 1-34, wherein the SD has a 2'-F modification.

37. The ASO according to any one of claims 1-36, wherein the SD is 20-50 nt in length.

38. The ASO according to any one of claims 1-37, wherein the SD has a length of 30 nt.

39. The ASO of any one of claims 1-38, wherein the targeting RNA region comprises a target adenosine.

40. The ASO of any one of claims 1-39, wherein the targeting RNA region is 15-60 nt in length.

41. The ASO of any one of claims 1-40, wherein the targeting RNA region is 30 nt in length.

42. The ASO of any one of claims 1-41, wherein the non-targeting RNA region does not comprise a target adenosine.

43. The ASO of any one of claims 1-42, wherein the non-targeting RNA region is 5-50 nt in length.

44. The ASO according to any one of claims 1-43, wherein the length of the non-targeting RNA region is 15nt, 20nt, or 25nt.

45. The ASO of any one of claims 1-44, wherein the ASO deaminates a target adenosine present in the targeting RNA region by an ADAR enzyme present in the cell.

46. ​​The ASO according to any one of claims 1-45, wherein the target RNA is selected from one or more of the following groups: pre-mRNA, mRNA, rRNA, tRNA, lnc-RNA, snRNA, snoRNA.

47. A method of editing RNA comprising using the ASO of any one of claims 1-46.

48. The method according to claim 47, wherein the method comprises the following steps: (1) Providing the ASO according to any one of claims 1 to 46; (2) allowing cells to take up the ASO; (3) allowing the ASO to bind to the target RNA; (4) allowing intracellular ADAR enzymes to deaminate target adenosine in the targeted RNA region to inosine; (5) Identify the presence of inosine in the targeted RNA region.

49. The method of claims 47-48, wherein the method is capable of recruiting endogenous deaminases to perform deamination reactions on specific nucleotide sites.

50. One or more isolated nucleic acid molecules encoding the ASO, or the SD comprised by the ASO, or the BHD comprised by the ASO according to any one of claims 1 to 46.

51. An expression vector that expresses one or more isolated nucleic acid molecules of claim 50.

52. A delivery vehicle that delivers the ASO of any one of claims 1-46.

53. A cell comprising the ASO of any one of claims 1-46, one or more isolated nucleic acid molecules of claim 50, the expression vector of claim 51, and / or the delivery vector of claim 52.

54. The cell of claim 53, wherein the cell is a eukaryotic cell.

55. The cell of any one of claims 53-54, wherein the cell is a human cell or a mouse cell.

56. The cell of any one of claims 53-55, wherein the cell is a liver cell.

57. The cell of any one of claims 53-56, wherein the cell is a neural cell.

58. A pharmaceutical composition comprising the ASO of any one of claims 1-46, one or more isolated nucleic acid molecules of claim 50, the expression vector of claim 51, the delivery vector of claim 52, the cell of any one of claims 53-57, and / or a pharmaceutically acceptable carrier.

59. The ASO of any one of claims 1-46, the one or more isolated nucleic acid molecules of claim 50, the expression vector of claim 51, the delivery vector of claim 52, the cell of any one of claims 53-57, the pharmaceutical composition of claim 58, for use in preventing and / or treating a disease and / or condition.

60. Use of the ASO of any one of claims 1-46, the one or more isolated nucleic acid molecules of claim 50, the expression vector of claim 51, the delivery vector of claim 52, the cell of any one of claims 53-57, and the pharmaceutical composition of claim 58 in the preparation of a medicament for preventing and / or treating a disease and / or condition.

61. A method for preventing and / or treating a disease and / or condition, comprising administering to a subject in need thereof an effective amount of the ASO of any one of claims 1-46, one or more isolated nucleic acid molecules of claim 50, the expression vector of claim 51, the delivery vector of claim 52, the cell of any one of claims 53-57, or the pharmaceutical composition of claim 58.

Images