Composition and kit for detecting cervical cancer and high-grade cervical lesions and application

Abstract

The invention relates to the field of molecular biological detection, in particular to the field of cervical cancer detection. The invention provides a composition for detecting cervical cancer and high-grade cervical lesions. The composition comprises a detection reagent for detecting the methylation level of the following regions: a region shown as SEQ ID NO: 1 in a ZNF671 gene; a region in the SORCS1 gene is as shown in SEQ ID NO: 2. Meanwhile, the invention further provides a kit comprising the composition and application of the composition, and the composition and the kit can be used for clinically detecting cervical cancer and cervical high-grade lesions with high sensitivity and high specificity.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology detection, specifically, to the field of cervical cancer detection, more specifically, to the detection of the methylation level of cervical cancer gene markers. BACKGROUND

[0002] According to the Global Cancer Statistics 2020, the global cervical cancer mortality rate in 2020 ranks ninth in total cancer mortality rate and fourth in female cancer mortality rate, and the incidence has a trend of youth in recent years. Cervical cancer has characteristics such as long tumor development cycle, clear precancerous lesion stage and heavy treatment burden, and if it is found at an early stage, it can be prevented or cured. According to Globocan data, the five-year survival rates of cervical cancer precancerous lesion stage, in situ stage, local stage and distant metastasis stage in China are 100%, 84.6%, 40.1% and 12.9% respectively. However, the coverage rate of cervical cancer screening in China is still very low (less than 30%). Therefore, finding key molecules that can be used for early screening and auxiliary diagnosis of cervical cancer is a problem that needs to be solved at present, and it is also a feasible and efficient way to change the severe situation of cervical cancer diagnosis and treatment in China.

[0003] So far, two commonly used clinical screening methods for cervical cancer are ThinPrep cytology test (TCT) and HPV virus detection. TCT detection has low cost, but it is greatly affected by subjective human factors, which can easily lead to misdiagnosis and missed diagnosis, has poor accuracy, is labor-intensive, lacks high-throughput characteristics, requires high-quality pathologists, and is not easy to promote. HPV detection has high sensitivity, but most HPV infections are transient, resulting in poor specificity of HPV detection. In recent years, based on molecular diagnostic techniques such as PCR and NGS, liquid biopsy has developed and broken through, and has become a powerful weapon for precise early screening of cancer. In terms of signal abundance and signal intensity of markers, ctDNA methylation is an ideal detection marker. Studies have shown that the phenomenon of increased methylation level of tumor suppressor genes usually occurs in the early stage of cancer and is a landmark change in the early development of tumors; among the CpG islands in the human genome, 60-80% of cytosine residues are modified by methylation, and DNA methylation has become a universal and abundant signal source in early screening of cancer; in addition, different cancer types have their unique DNA methylation patterns, with strong organ specificity, which can realize tissue tracing. Therefore, ctDNA methylation is the mainstream detection index adopted by early screening enterprises at home and abroad.

[0004] The methylation status detection of the genes can provide evidence for diagnosing cervical lesions at CIN2 level and above. Therefore, in cytological abnormalities (atypical squamous cells of undetermined significance, ASCUS) and HPV positive women, the detection of methylation of HPV genes and host genes can improve the detection rate of high-grade cervical lesions and reduce unnecessary colposcopy referral, so as to achieve the purpose of precise screening.

[0005] There is an urgent need in the art for a more effective cervical cancer diagnostic product, so that early diagnosis of cervical cancer has high sensitivity and high specificity, and is non-invasive and rapid. SUMMARY

[0006] Therefore, the present application provides a composition for detecting cervical cancer and high-grade cervical lesions, which comprises detection reagents for detecting the methylation level in the following regions:

[0007] the region as shown in SEQ ID NO: 1 in the ZNF671 gene; and

[0008] the region as shown in SEQ ID NO: 2 in the SORCS1 gene.

[0009] The present application uses methylation detection reagents for both ZNF671 and SORCS1 genes to detect cervical intraepithelial neoplasia 2 and cervical cancer (CIN2+), which has higher sensitivity and specificity than the rest of the regions (other genes or the same rest of the regions), with sensitivity and specificity reaching 73.5% and 88.6%, respectively; the sensitivity and specificity for detecting cervical intraepithelial neoplasia 3 and cervical cancer (CIN3+) are 86.3% and 91.3%, respectively.

[0010] Using the methylation detection kit of the present application as a triage scheme, the colposcopy referral rate is only 10.3%, which is significantly reduced by 71.8% compared with the cytological examination triage scheme recommended by the cervical cancer screening guidelines, and the CIN3+ misdiagnosis rate is consistent with the cytological examination triage scheme, which can replace cytological examination for high-risk HPV positive population triage.

[0011] Further, the composition further comprises at least one of the detection reagents for detecting the methylation level in the following regions:

[0012] the region as shown in SEQ ID NO: 3 in the ZNF536 gene;

[0013] the region as shown in SEQ ID NO: 4 in the OTX1 gene;

[0014] the region as shown in SEQ ID NO: 5 in the SIX6 gene;

[0015] a region in the ZNF582 gene as shown in SEQ ID NO: 6;

[0016] a region in the ASCL1 gene as shown in SEQ ID NO: 7; or

[0017] a region in the RXFP3 gene as shown in SEQ ID NO: 8.

[0018] a region in the ZNF671 gene as shown in SEQ ID NO: 1, a region in the SORCS1 gene as shown in SEQ ID NO: 2, a region in the ZNF536 gene as shown in SEQ ID NO: 3, a region in the OTX1 gene as shown in SEQ ID NO: 4, a region in the SIX6 gene as shown in SEQ ID NO: 5, a region in the ZNF582 gene as shown in SEQ ID NO: 6, a region in the ASCL1 gene as shown in SEQ ID NO: 7; or a region in the RXFP3 gene as shown in SEQ ID NO: 8 is a sequence of a CpG island of the respective gene region.

[0019] Specifically, the region of SEQ ID NO: 1 of the ZNF671 (Genbank accession number: NC_000019.10) gene is as shown below:

[0020] CCCGGAGGACGCAGCACCCACCCGCGCGGAGTCCGTTAGCTCCGCCATAGGACCGTGGGCGCGGACAGCTGCCGGGAGCGGCAGGCGTCTCGATCGGGGACGCAGGCACTTCCGTCCCTGCAGAGCATCAGACGCGTCTCGGGACACTGGGGACAACATCTCCTCCGCGCTTTCCCAACACCTCCACCTGCGGCCCACACAAGCGTTACAGAACCCCGGCCAGGGACAGCCTGACAGAAAC.

[0021] The region of SEQ ID NO: 2 of the SORCS1 (Genbank accession number: NC_000010.11) gene is as shown below:

[0022] GCGGCACGAGCTCTGCGCTGGCGGCTGTGGGGGGCCGGCGCTCAGGACCCCAACTCCATCCAAGTTGCGCCGCGGTGGGGGCGGGCGGAGGCGGCGCCGGGCAGGTGGCGGCCGCTTGCCCGGGCTGGGCTTGTGCCGAGCGCGGGTCCGGACGGAGCGAGCCGCCGCCGCGCGGGGGTGGAGCTGAGCTGAAGTCACTGGCGGAG.

[0023] The region in the ZNF536 (Genbank accession number: NC_000019.10) gene as shown in SEQ ID NO: 3 is as follows:

[0024] TTCACCTTACGGAGGGGAGATAATGAGATCAATTAGAGGCGCCGTCACCGCGCCGGAGACAGCTGCCGCCGCATAGTAATCACCCGCGGGCTGGGTGCGCGGGGGCTCCCCGCTACCTGCGCGCCTGCTGCTCCCACCACGCGGCACCGACCCGGGCGCGCCCCCGGCCCCTGTCCGCAGCCCACAGCCACACCGCGCACCC.

[0025] The region in the OTX1 (Genbank accession number: NC_000002.12) gene as shown in SEQ ID NO: 4 is as follows:

[0026] GGCGTGTTTCTGCCCATTGGAGCACCCGCACACTACTCCAAATCAAAACCACTAAGAGTTCCTCCCGCGCAGACTGCTGCCCCTTCAGCTGCCCTCGATTTTGCTCCACGCCTGCCGGCCAGAGCCTCCCGGCGTTTCTTCCGCCCCAGCGGAGTGCGCTGGGGCGCGCCAGGGCTAGGCCCGCCGGAGGAGCGCGTCCCCAGCCTTCCGCGCACAGAGCCGCATCCCGCCCCGCCCTGCGCTGGACTGGTTCAAGCTTCCGCCTCGGCGGGAACGCTGTACATAGTCAGGTCCGTTCCAGGGACCACTTAAACTTTTTAGTTGCTGTTGGTTGGTTGAACTGAAC.

[0027] The region in the SIX6 (Genbank Accession No: NC_000014.9) gene as shown in SEQ ID NO: 5 is as follows:

[0028] GGTGACTGACAGGGGGTCTCCATGGCGCCCGCGCCGCCAATCCGCCCACCCCAATAGCGGAGCCAGCTCGCCTGCCGGCGTGCCTGAGCCGAGCCGAGCCCGAACCCCAAGCCGCGGAGCCAGCACCTCCTCCAGTCGGGGTCGTCCGCTCCCGGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCC.

[0029] The region in the ZNF582 (Genbank Accession No: NC_000019.10) gene as shown in SEQ ID NO: 6 is as follows:

[0030] CAGACGCACAAAGCACACCGATGCTGCGCCATGATAGGGCCGGCGCCGCAGTGTCTTCCGGGAAACATAGTCTTTAGGCGTAAAGGCAGCAGCCCGGCCTTGAAGCCGGATCTCGCGATGTTTCAGGGTGAGCCGGACGC.

[0031] The region in the ASCL1 (Genbank Accession No: NC_000012.12) gene as shown in SEQ ID NO: 7 is as follows:

[0032] GACCCGGCGCAAGAGAGCGCAGCCTTAGTAGGAGAGGAACGCGAGACGCGGCAGAGCGCGTTCAGCACTGACTTTTGCTGCTGCTTCTGCTTTTTTTTTTCTTAGAAACAAGAAGGCGCCAGCGGCAGCCTCACACGCGAGCGCCACGCGAGGCT.

[0033] The region in the RXFP3 (Genbank Accession No: NC_000005.10) gene as shown in SEQ ID NO: 8 is as follows:

[0034] TCCTGGAGGTCAGTGGGTGTCTGCGTCTCTCCGCGGTTGTCAACTCCGGGTGGGTTGCCAGCGGCTCTCACCAGTTACGGTGGCACTTGCACGGCCAAGGCGGCGGGCCCCAAGGAGCATGCGTAATCCCGGGGCGCCGCGAGGGGCGCTTTCCGAGGTGCTGAACCCAGC.

[0035] The sensitivity of the composition of the present application for diagnosing CIN3+ (including cervical cancer and cervical intraepithelial neoplasia grade III) is up to 92.7%, and the specificity is 88.2%. The sensitivity for diagnosing CIN2+ (including cervical cancer, cervical intraepithelial neoplasia grade III and cervical intraepithelial neoplasia grade II) is 75.0%, and the specificity is 88.7%. The reagent combination of the present application can detect cervical exfoliated cells in the clinic with fewer markers, saving cost and time, and can detect with high sensitivity and specificity in the early stage of cervical cancer.

[0036] In the present application, "CpG island" is the abbreviation of cytosine (C)-phosphorus (p)-guanine (G), which refers to some regions rich in CpG dinucleotides on the genome, with a length of 300-3000 bp.

[0037] In some embodiments, the methylation level of the CpG island or a sequence on the CpG island on the corresponding gene present in the sample can be detected using the detection reagent of the present application.

[0038] In the present application, "sample" is a biological sample selected from an individual. Specifically, for example, selected from histological sections, tissue biopsy / paraffin-embedded tissues, etc., preferably cervical exfoliated cell samples.

[0039] In the present application, "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample. The methylation level is measured by amplification-sequencing, chip detection, or methylation fluorescent quantitative PCR.

[0040] In some specific embodiments, the detection reagent of the methylation level can also be a detection reagent for detecting the average methylation level of a gene fragment.

[0041] In some specific embodiments, the detection reagent of the methylation level can also be a detection reagent for detecting one or more methylation sites within a gene segment.

[0042] In some specific embodiments, the detection reagent includes but is not limited to nucleic acid primers, sequencing Tag sequences, and is used to measure the methylation level by amplification-sequencing.

[0043] In some specific embodiments, the detection reagent includes, but is not limited to, a chip, which is a methylation chip having probes specifically binding to the methylation region. The chip is used to measure the methylation level.

[0044] In some specific embodiments, the detection reagent includes, but is not limited to, nucleic acid primers and nucleic acid probes for measuring the methylation level by methylation fluorescent quantitative PCR.

[0045] Further, the detection reagent also includes internal standard primers and internal standard probes.

[0046] In one specific embodiment, the target of the internal standard primers and probes is the ACTB gene.

[0047] In one preferred embodiment, the target of the internal standard primers and probes is the region of the ACTB gene as shown in SEQ ID NO: 3.

[0048] The region of SEQ ID NO: 9 of the ACTB gene (Gene bank accession number: NC_000007.14) is as follows:

[0049] TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTG AATGATGAGCCTTCGTGCCCCCCCTTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA.

[0050] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects the methylation level of nucleic acid in the sample by methylation fluorescent quantitative PCR.

[0051] In the present application, "methylation real-time PCR" refers to the methylation level of the region to be detected by subjecting the region to be detected to bisulfite conversion or methylation-sensitive restriction enzyme digestion, and then using primers and probes designed specifically for the detection target for real-time PCR detection.

[0052] The reagent combination described above can further include other reagents, specifically, for example, various reagents required for pre-treatment or pre-processing of the sample. For example, a sample release agent for extracting nucleic acids from the sample, a purification agent for purifying the sample nucleic acids, bisulfite or bisulfite for use in conversion, and the like.

[0053] In some specific embodiments, the detection reagent is as shown in Table 1. Among the following detection reagents, the upstream primer / downstream primer / probe for detecting one target corresponds to a group, and the upstream primer / downstream primer / probe for detecting which target is used, i.e. this group. Therefore, the detection reagent of the present application can include any one or more groups of the following primers and probes.

[0054] Table 1

[0055] Primer name No. Sequence (5'-3') ME-ZNF671-F SEQ ID NO: 10 CCCGCGCGGAGTCCGTTAGC ME-ZNF671-R SEQ ID NO: 11 TGTTGGGAAAGCGCGGAGGAG ME-ZNF671-P SEQ ID NO: 12 TCCCTGCAGAGCATCAGACGCGTCT ME-SORCS1-F SEQ ID NO: 13 CTGGCGGCTGTGGGGGG ME-SORCS1-R SEQ ID NO: 14 CGGCTCGCTCCGTCCGG ME-SORCS1-P SEQ ID NO: 15 AGGACCCCAACTCCATCCAAG ME-ZNF536-F SEQ ID NO: 16 GGAGATAATGAGATCAATTAGAGGCGC ME-ZNF536-R SEQ ID NO: 17 GTGTGGCTGTGGGCTGCGG ME-ZNF536-P SEQ ID NO: 18 CCGGGTCGGTGCCGCGTGGTGGGAG ME-OTX1-F SEQ ID NO: 19 CGATTTTGCTCCACGCCTG ME-OTX1-R SEQ ID NO: 20 GCGGGATGCGGCTCTGTG ME-OTX1-P SEQ ID NO: 21 CCAGAGCCTCCCGGCGTTTCTTC ME-SIX6-F SEQ ID NO: 22 TGACAGGGGGTCTCCATGGC ME-SIX6-R SEQ ID NO: 23 GATTGGGGCAGCGGGACA ME-SIX6-P SEQ ID NO: 24 CCAATCCGCCCACCCCAATAGC ME-ASCL1-F SEQ ID NO: 25 GCAGCCTTAGTAGGAGAGGAACGC ME-ASCL1-R SEQ ID NO: 26 TCGCGTGTGAGGCTGCCGCT ME-ASCL1-P SEQ ID NO: 27 AGAGCGCGTTCAGCACTGACTTTTGCT ME-ZNF582-F SEQ ID NO: 28 CGCACAAAGCACACCGATGCT ME-ZNF582-R SEQ ID NO: 29 CGCGATGTTTCAGGGTGAGCC ME-ZNF582-P SEQ ID NO: 30 TTTAGGCGTAAAGGCAGCAGCCCG ME-RXFP3-F SEQ ID NO: 31 GGTCAGTGGGTGTCTGCGTCTCT ME-RXFP3-R SEQ ID NO: 32 GGGTTCAGCACCTCGGAAAGC ME-RXFP3-P SEQ ID NO:33 TGTCAACTCCGGGTGGGTTGCCA ME-ACTB-F SEQ ID NO:34 GTTGTTACAGGAAGTCCCTTGCC ME-ACTB-R SEQ ID NO:35 GCAATGCTATCACCTCCCCTGTG ME-ACTB-P SEQ ID NO:36 CTTGGGAGAGGACTGGGCCATTCTCC

[0056] In some specific embodiments, the four fluorescence channels adopted by the present application are FAM, ROX, HEX and CY5 channels, but in actual use, it is not limited to this, and can be any combination of other fluorescence channels; at the same time, different targets can also correspond to different fluorescence channels, such as using any one fluorescence channel as an internal standard detection channel.

[0057] Using this preferred embodiment, the sensitivity and specificity of the detection are increased by about 10% compared with the combination of primers and probes for detecting other regions of the target, so that using this preferred combination can detect cervical intraepithelial neoplasia grade III and cervical cancer with higher sensitivity and better specificity in clinical practice, so that the detection accuracy of cervical intraepithelial neoplasia grade III and early cervical cancer is further improved.

[0058] Using the kit of the present application to detect DNA-specific gene methylation sequences of cervical exfoliated cells can achieve non-invasive early screening and early diagnosis of CIN2 and CIN3 and cervical cancer.

[0059] In a second aspect, the present application provides the use of the above-mentioned reagent combination in the preparation of a kit for detecting cervical cancer and high-grade cervical lesions (CIN2 and CIN3).

[0060] In a third aspect, the present application provides a kit for detecting cervical cancer and high-grade cervical intraepithelial neoplasia (CIN2 and CIN3), the kit comprising the reagent combination as described above. Further, the kit further comprises, but is not limited to, at least one of reagents for extracting nucleic acid, reagents for purifying nucleic acid, and methylation-sensitive restriction enzyme.

[0061] Further, the kit further comprises a negative sample.

[0062] Specifically, the negative sample is human genomic DNA verified by sequencing to be free of methylation of the target gene.

[0063] Further, the kit further comprises at least one of dNTPs, Mg 2+ , methylation-sensitive restriction enzyme, PCR buffer, and hot-start enzyme.

[0064] Further, the methylation-sensitive restriction enzyme comprises at least one of HpaII, HinP1I, and HhaI.

[0065] Further, the final concentration of each component is in the range as follows: Mg 2+ 1-6 mM, dNTPs 1-80 mM, methylation-sensitive restriction enzyme 0.01-30 U, primer 0.1-40 μM, and probe 0.1-20 μM. BRIEF DESCRIPTION OF DRAWINGS

[0066] Figures 1-3 for detection of methylation of the composition of the present application at 0.05 ng / reaction;

[0067] Figure 4 for detection of non-specific amplification of the composition of the present application in non-methylated DNA at 20 ng / reaction;

[0068] Figures 5-10 for detection of cervical exfoliated cells at different stages of cervical cancer by the composition of the present application. DETAILED DESCRIPTION

[0069] The present application will be specifically described below in connection with specific embodiments and examples, and the advantages and various effects of the present application will be more clearly presented thereby. Those skilled in the art will understand that the embodiments and examples are for illustrating the present application, not limiting the present application.

[0070] Example 1, Screening of Methylation Genes

[0071] The application is based on the collection and mining of cervical cancer methylation data from public data source platforms such as TCGA, NCBI, GEO, EBI ArrayExpress, and the methylation levels of normal cervical or cervical inflammation, cervical intraepithelial neoplasia grade I (CIN1), cervical intraepithelial neoplasia grade II (CIN2), cervical intraepithelial neoplasia grade III (CIN3) and cervical cancer samples are analyzed by using various bioinformatics, and the specific methylation markers are preliminarily screened out. Further, the methylation levels of real clinical samples are detected and analyzed by using fluorescence quantitative PCR.

[0072] Finally, according to the modeling analysis of cervical exfoliated cell sample data, the CpG island region selected from the genes ZNF671, SORCS1, ZNF536, OTX1, SIX6, ASCL1, RXFP3 and ZNF582 is determined as a selectable detection target, and the model and performance of combined detection of cervical cancer and high-grade cervical lesions (CIN2 and CIN3) are further verified.

[0073] Example 2, detection of gene methylation level of standard

[0074] Positive sample: standard methylation human genomic DNA and target gene non-methylation human genomic DNA are mixed to configure, the concentration is 1 ng / μL containing 10% standard methylation human genomic DNA; the concentration is 1 ng / μL containing 1% standard methylation human genomic DNA; the concentration is 1 ng / μL containing 0.5% standard methylation human genomic DNA;

[0075] Negative sample: human genomic DNA without target gene methylation verified by sequencing, 2 ng / μL;

[0076] Methylation-sensitive restriction endonuclease: including HpaII, HinP1I and HhaI;

[0077] Detection process:

[0078] PCR system configuration: according to different detection targets, the reagent formula of table 3 is prepared to prepare PCR reaction solution

[0079] Table 3

[0080]

[0081] The sample is added to the PCR reaction tube according to 10 μL / reaction, then 40 μL of PCR reaction solution is added in turn, the PCR tube cover is covered, and the mixture is shaken and mixed, and then centrifuged for 5 s.

[0082] Fluorescence PCR reaction and result analysis

[0083] 1) Put PCR tubes into the amplification instrument sample slot, and set the sample names to be tested in the corresponding order.

[0084] 2) Fluorescence detection channel selection: select FAM channel (Reporter: FAM, Quencher: None) to detect ZNF671; select ROX channel (Reporter: ROX, Quencher: None) to detect SORCS1; select CY5 channel (Reporter: CY5, Quencher: None) as an internal standard to detect the housekeeping gene ACTB;

[0085] 3) The fluorescence quantitative PCR reaction conditions are shown in Table 4:

[0086] Table 4

[0087]

[0088] 4) Result analysis

[0089] After the reaction is completed, the instrument automatically saves the results, and the software provided by the instrument can be used for automatic analysis (manual adjustment of the start value, end value and threshold value of the baseline can also be used for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e. cycle threshold, which refers to the cycle number of the fluorescence signal in the PCR tube reaching the set threshold value). The standard amplification curve is shown in Figures 1-4 The detection reagent provided by the present application is 0.05 ng / reaction ( Figures 1-3 ), and there is no non-specific amplification in 20 ng / reaction of non-methylated DNA. Figure 4

[0090] Example 3, results of the composition (ZNF671, SORCS1) provided by the present application in detecting clinical samples

[0091] 1922 cases of cervical exfoliative cell samples of people positive for high-risk HPV were collected, including 16 cases of cervical squamous cell carcinoma (SCC) patients, 86 cases of CIN3 patients, 162 cases of CIN2 patients, 1046 cases of CIN1 patients, and 612 cases of normal cervical or cervical inflammation (Normal) patients. S10016 was used in combination with natch48 for nucleic acid extraction, and the nucleic acid sample enzyme cutting treatment and PCR amplification detection were carried out in the same reaction tube according to the process of Example 2. According to the amplification results, the ΔCt value (Ct (target gene)-Ct (internal reference gene)) was calculated, logistics regression fitting and ROC curve analysis were carried out, and a prediction model was obtained:

[0092]

[0093] ​When the P value calculated by the prediction model is greater than or equal to 0.5, it is determined to be positive; and when the P value is less than 0.5, it is determined to be negative.

[0094] Results are shown in Table 5 and Table 6. Figures 5-6 and Table 5. Among them, CIN3+ includes CIN3 and cervical cancer, and CIN2+ includes cervical cancer, CIN3 and CIN2. The results show that the sensitivity and specificity of the composition of the application for detecting high-grade cervical lesions CIN2 and CIN3 and cervical cancer (CIN2+) are 73.5% and 86.6%, respectively, and the sensitivity and specificity for detecting CIN3 and cervical cancer (CIN3+) are 86.3% and 91.3%, respectively.

[0095] Table 5

[0096]

[0097] The detection results of the composition of the application in the HPV-positive population in different stages of cervical cancer, cervical precancerous lesions and cervical inflammation or normal cervix are shown in Table 6.

[0098] Table 6

[0099]

[0100] Among them, the methylation gene detection result refers to the methylation detection result of the composition of the application, SCC refers to cervical squamous carcinoma, CIN3 refers to cervical intraepithelial neoplasia grade III, CIN2 refers to cervical intraepithelial neoplasia grade II, CIN1 refers to cervical intraepithelial neoplasia grade I, and Normal refers to normal cervix or cervical inflammation. The positive coincidence rate refers to the consistency of the methylation positive result of the composition of the application and the pathological result. The results show that in the HPV-positive population, as the severity of cervical lesions deepens, the methylation positive rate of the composition of the application in the cervical lesions gradually increases, indicating that the composition of the application may play an important role in the development process of cervical cancer, or can indicate the occurrence of cervical lesions.

[0101] Example 4, the results of the composition of the application (ZNF671, SORCS1, ZNF536) in detecting clinical samples

[0102] The cervical exfoliative cell samples of 1922 high-risk HPV positive people (provided by Hunan Saintwell) were collected, including 16 cases of cervical squamous carcinoma (SCC), 86 cases of CIN3, 162 cases of CIN2, 1046 cases of CIN1, and 612 cases of normal cervix or cervix inflammation (Normal). The nucleic acid extraction was carried out by using S10016 in combination with natch48, and the nucleic acid sample enzyme cutting treatment and PCR amplification detection were carried out in the same reaction tube according to the process of Example 2. According to the amplification results, the ΔCt value (Ct (target gene)-Ct (internal reference gene)) was calculated, the logistics regression fitting and the ROC curve analysis were carried out, and the prediction model was obtained:

[0103]

[0104] When the P value calculated by the prediction model is greater than or equal to 0.5, it is judged as positive; and less than 0.5, it is judged as negative.

[0105] The results are shown in Table 7 and Table 8. Figures 7-8 The results show that the sensitivity and specificity of the composition of the present application for detecting cervical high-grade lesions CIN2 and CIN3 and cervical cancer (CIN2+) are 73.5% and 87.3%, respectively, and the sensitivity and specificity for detecting CIN3 and cervical cancer (CIN3+) are 88.2% and 91.4%, respectively.

[0106] Table 7

[0107]

[0108]

[0109] The detection results of the composition of the present application in HPV positive people with cervical cancer, different stages of precancerous lesions of cervix and cervix inflammation or normal cervix are shown in Table 8.

[0110] Table 8

[0111]

[0112] The methylation gene detection result refers to the methylation detection result of the composition of the application, SCC refers to cervical squamous carcinoma, CIN3 refers to cervical intraepithelial neoplasia grade III, CIN2 refers to cervical intraepithelial neoplasia grade II, CIN1 refers to cervical intraepithelial neoplasia grade I, and Normal refers to normal cervix or cervix inflammation. The positive coincidence rate refers to the consistency of the methylation positive result of the composition of the application and the pathological result. The results show that in the HPV positive population, as the severity of cervical lesions increases, the methylation positive rate of the composition of the application in the cervical lesions gradually increases, indicating that the composition of the application may play an important role in the development of cervical cancer, or can indicate the occurrence of cervical lesions.

[0113] Example 5, results of the composition of the application (ZNF671, SORCS1, OTX1) in detecting clinical samples

[0114] Cervical exfoliated cell samples of 1922 high-risk HPV positive people (provided by Hunan Saint Ville) were collected, including 16 cases of cervical squamous carcinoma (SCC), 86 cases of CIN3, 162 cases of CIN2, 1046 cases of CIN1, and 612 cases of normal cervix or cervix inflammation (Normal). S10016 was used in combination with natch48 for nucleic acid extraction, and nucleic acid sample digestion treatment and PCR amplification detection were carried out in the same reaction tube according to the process of Example 2. According to the amplification results, the ΔCt value (Ct (target gene)-Ct (internal reference gene)) was calculated, logistics regression fitting and ROC curve analysis were carried out, and the prediction model was obtained:

[0115]

[0116] When the P value calculated by the prediction model is greater than or equal to 0.5, it is judged as positive; and less than 0.5, it is judged as negative.

[0117] The results are shown in Table 9. Figures 9-10 and Table 9. Among them, CIN3+ includes CIN3 and cervical cancer, and CIN2+ includes cervical cancer, CIN3 and CIN2. The results show that the sensitivity and specificity of the composition of the application for detecting cervical high-grade lesions CIN2 and CIN3 and cervical cancer (CIN2+) are 75.4% and 84.4%, respectively, and the sensitivity and specificity for detecting CIN3 and cervical cancer (CIN3+) are 85.3% and 91.4%, respectively.

[0118] Table 9

[0119]

[0120] The detection results of the composition of the present application in the cervical cancer, different stages of cervical precancerous lesions and cervical inflammation or normal cervix in the HPV positive population are shown in Table 10.

[0121] Table 10

[0122]

[0123] The methylation gene detection result refers to the methylation detection result of the composition of the present application, SCC refers to cervical squamous cell carcinoma, CIN3 refers to cervical intraepithelial neoplasia grade III, CIN2 refers to cervical intraepithelial neoplasia grade II, CIN1 refers to cervical intraepithelial neoplasia grade I, and Normal refers to normal cervix or cervical inflammation. The positive coincidence rate refers to the consistency of the methylation positive result of the composition of the present application and the pathological result. The results show that in the HPV positive population, as the severity of cervical lesions increases, the methylation positive rate of the composition of the present application in the cervical lesions gradually increases, indicating that the composition of the present application may play an important role in the development of cervical cancer, or can indicate the occurrence of cervical lesions.

[0124] Example 6, detection rate of different detection technologies in HPV positive population

[0125] In order to further prove the superiority of the composition of the present application, the detection rates of different detection technologies in the HPV positive population are compared, as shown in Table 11.

[0126] Table 11

[0127]

[0128] The HPV16 / 18 refers to the HPV16 or HPV18 detection result being positive, and the TCT-ASCUS+ refers to the liquid-based thin-layer cytology test (TCT) result being ASCUS and above, including low-grade squamous intraepithelial lesion (LSIL), high-grade squamous intraepithelial lesion (HSIL), squamous cell carcinoma (SCC) and the like. The results show that in the HPV positive population, the detection rate of the composition of the present application for Normal and CIN1 is lower than 15%, while the detection rate of HPV16 / 18 and TCT-ASCUS+ for Normal and CIN1 is 21.9% to 24.9% and 66.1% to 79.9%, respectively, which is significantly higher than that of the composition of the present application, indicating that the composition of the present application has better specificity for Normal and CIN1, and can avoid over-diagnosis of HPV positive population and ASCUS and above population in cervical cancer screening, causing unnecessary panic.

[0129] Meanwhile, the detection rates of the composition of the present application on CIN3 and SCC are 82.6% to 86.0% and 100% respectively, which are significantly higher than those of HPV16 / 18 and TCT-ASCUS+, indicating that the composition of the present application has higher sensitivity on CIN3 and SCC, and can reduce the missed detection in the HPV positive population and the population with ASCUS or above in the screening of cervical cancer. Although the detection rate of the composition of the present application on CIN2 is 60.5% to 64.2%, which is significantly higher than that of HPV16 / 18 and lower than that of TCT-ASCUS+, but part of CIN2 may regress to CIN1 or progress to CIN3, and the performance on Normal, CIN1, CIN3 and SCC is better than that of HPV16 / 18 and TCT-ASCUS+. Therefore, the clinical performance of the composition of the present application is overall better than that of HPV16 / 18 and TCT-ASCUS+, improves the detection rate of high-grade cervical lesions, and reduces unnecessary colposcopy referral, so as to achieve the purpose of precise screening.

[0130] According to the recommended screening process of cervical cancer screening guidelines, the population positive for other high-risk types or untyped detection methods or any high-risk subtype needs to undergo cervical cytology examination, and if the cytology examination result is abnormal or suspicious, i.e. the population with ASCUS or above needs to undergo colposcopy examination. As a shunt scheme, the colposcopy referral rate and CIN3+ missed diagnosis rate of the composition of the present application compared with the cytology shunt scheme are shown in Table 12. The colposcopy referral rate at the CIN3 boundary point is only 10.1% to 10.3%, which is significantly reduced by 71.8% to 72% compared with the cytology shunt scheme recommended by the cervical cancer screening guidelines, and the CIN3+ missed diagnosis rate is close to that of the cytology shunt scheme, indicating that the composition of the present application can replace cytology as the first shunt scheme, effectively reduce the colposcopy referral rate, avoid overdiagnosis, and the detection result is more objective and easy to read than the cytology examination result, which can realize high-throughput detection, the technology can be popularized in places with lack of medical resources, and effectively reduce the workload of clinicians and the psychological and economic burden of patients.

[0131] Table 12

[0132]

[0133] Example 7, results of the rest of the gene detection samples

[0134] More than 20 genes such as ZNF671, SORCS1, ZNF536, OTX1, SIX6, ZNF582, ASCL1, ITGA4, POU4F3, RXFP3 were constructed into a multi-gene combined detection system, and the combination was tested for sensitivity and specificity in clinical cervical exfoliated cell samples of cervical cancer, CIN3, CIN2, CIN1, normal cervix or cervical inflammation. According to the clinical performance requirements, the gene combination with a sensitivity of more than 70% and a specificity of more than 84% for CIN2+, and a sensitivity of more than 85% and a specificity of more than 90% for CIN3+ was screened out, wherein ZNF671+SORCS1, ZNF671+SORCS1+ZNF536 and ZNF671+SORCS1+OTX1 had the best clinical performance effect, and the results are shown in Table 13. As can be seen from the table, although many genes are related to the prediction of cervical cancer and the like, in fact, the combination that can be used for prediction and achieve the related effect is very specific, and there are a large number of combinations that cannot meet the detection requirements.

[0135] Table 13

[0136]

[0137]

Claims

1. A composition for detecting cervical cancer and high-grade cervical lesions, characterized in that, The composition includes a detection reagent for detecting methylation levels in the following regions: The region of the ZNF671 gene as shown in SEQ ID NO:1; and The region in the SORCS1 gene as shown in SEQ ID NO:

2.

2. The composition according to claim 1, characterized in that, The composition further includes at least one of the detection reagents for detecting methylation levels in the following regions: The region shown in SEQ ID NO:3 in the ZNF536 gene; The region in the OTX1 gene as shown in SEQ ID NO:4; The region in the SIX6 gene as shown in SEQ ID NO:5; The region shown in SEQ ID NO:6 in the ZNF582 gene; The region of the ASCL1 gene as shown in SEQ ID NO:7; or The region in the RXFP3 gene as shown in SEQ ID NO:

8.

3. The composition according to claim 1 or 2, characterized in that, The detection reagents are those used in amplification-sequencing, chip detection, or quantitative PCR for methylation detection of methylation levels.

4. The composition according to claim 1 or 2, characterized in that, The detection reagent is any one or more of the following: nucleic acid primers, sequencing tag sequences, methylation chips, and nucleic acid probes.

5. The composition according to claim 4, characterized in that, The nucleic acid primers and nucleic acid probes are: Nucleic acid primers and probes shown in SEQ ID NO:10~33.

6. The composition according to claim 5, characterized in that, The detection reagent also includes an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for monitoring.

7. Use of the composition according to any one of claims 1 to 6 in the preparation of a kit for detecting cervical cancer and high-grade cervical lesions.

8. A kit for detecting cervical cancer and high-grade cervical lesions, characterized in that, The kit comprises the composition according to any one of claims 1 to 6.

9. The reagent kit according to claim 8, characterized in that, The kit also includes dNTPs and Mg. 2+ At least one of the following: methylation-sensitive restriction endonuclease, PCR buffer, and hot-start enzyme.

10. The reagent kit according to claim 9, characterized in that, The methylation-sensitive restriction endonuclease includes at least one of HpaII, HinP1I, and HhaI.

Images