Application of circRNA marker in diagnosis and treatment of colorectal cancer

Abstract

The invention discloses an application of a circRNA marker in diagnosis and treatment of colorectal cancer, the expression level of a circular RNA gene hsacirc0066801 in samples of patients with colorectal cancer and tumor cells is obviously improved, and the overexpression of the circular RNA hsacirc0066801 can obviously promote the proliferation, migration and invasion of the colorectal cancer cells. Meanwhile, knock-down of the hsacirc0066801 can significantly inhibit proliferation, migration and invasion of colorectal cancer cells, in addition, nude mouse tumor formation experiments prove that the tumor volume is significantly increased after overexpression of the hsacirc0066801, and is reduced after knock-down of the hsacirc0066801. Therefore, the hsacirc0066801 can be used as a potential molecular marker and is used as a target spot for clinical diagnosis and treatment of the colorectal cancer.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of a circRNA biomarker in the diagnosis and treatment of colorectal cancer. Background Technology

[0002] Because early symptoms of colorectal cancer are often subtle, many patients are diagnosed at an advanced stage. 70% of colorectal cancer cases are diagnosed only after symptoms have already appeared, significantly increasing the difficulty of treatment and patient suffering. Therefore, actively exploring and identifying novel molecular targets is crucial for optimizing the diagnosis and treatment of colorectal cancer.

[0003] Circular RNA (circRNA) is a single-stranded, covalently closed non-coding RNA (ncRNA). Unlike traditional linear RNA, it lacks a 5' cap or a 3' poly(A) tail. Due to its stable circular structure and tissue-specific expression, circRNA has potential clinical applications. In recent years, circRNA has been widely reported to regulate cancer progression through mechanisms such as miRNA binding and competitive binding to RNA-binding proteins (RBPs), making it a highly promising therapeutic target.

[0004] Therefore, by studying the role of circRNA, it is hoped that the technical difficulties in the early diagnosis of colorectal cancer can be optimized, and new treatment directions can be provided for the diagnosis and treatment of colorectal cancer. Summary of the Invention

[0005] The purpose of this invention is to provide a circRNA for the diagnosis and treatment of colorectal cancer and its application. The inventors found that the expression level of the hsa_circ_0066801 circular RNA gene was significantly increased in samples from colorectal cancer patients, suggesting that this circular RNA gene can be used as a biomarker and can be further used in the diagnosis and treatment of colorectal cancer.

[0006] The technical solution adopted by this invention to solve its technical problem is as follows:

[0007] The first aspect of the present invention is to provide a circRNA biomarker for the diagnosis and treatment of colorectal cancer, the circRNA biomarker being hsa_circ_0066801 with the nucleotide sequence shown in SEQ ID No.1.

[0008] A search using circPrimer revealed that hsa_circ_0066801 is a circular RNA molecule formed by backsplicing exons 4 to 9 of the linear ATG3 gene. After amplification, Sanger sequencing confirmed that hsa_circ_0066801 is 502 bases long. The full-length sequence is as follows:

[0009] GGCTACAGGGGAAGAATTGAAAGTGAAGGCATACCTACCAACAGGCAAACAATTTTGGTAACCAAAAATGTGCCGTGCTATAAGCGGTGCAAACAGATGGAATATTCAGATGAATTGGAAGCTATCATTGAAGAAGATGATGGTGATGGCGGATGGGTAGATACATATCACAACACAGGTATTACAGGAATAACGGAAGCCGTTAAAGAGATCACACTGGAAAATAAGGACAATATAAGGCTTCAAGATTGC TCAGCACTATGTGAAGAGGAAGAAGATGAAGATGAAGGAGAAGCTGCAGATATGGAAGAATATGAAGAGAGTGGATTGTTGGAAACAGATGAGGCTACCCTAGATACAAGGAAAATAGTAGAAGCT TGTAAAGCCAAAACTGATGCTGGCGGTGAAGATGCTATTTTGCAAACCAGAACTTATGACCTTTACATCACTTATGATAAATATTACCAGACTCCACGATTATGGTTGTTTGGCTATGATGAG (SEQ ID No.1).

[0010] Secondly, the present invention provides a primer set for the above-mentioned circRNA marker, wherein the primer set for detecting the expression level of the circRNA gene hsa_circ_0066801 includes a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.2: GAAGATGAAGATGAAGGAGAAGCTG; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3: TTCCTCTTCACATAGTGCTGAGC.

[0011] Thirdly, the present invention provides the application of the above-mentioned circRNA marker in the preparation of products for the diagnosis or treatment of colorectal cancer.

[0012] Furthermore, in a preferred embodiment of the present invention, the reagents include, but are not limited to, probes, gene chips, or detection primer sets that have detection specificity for circRNA markers; preferably, the detection primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0013] Furthermore, in a preferred embodiment of the present invention, the above reagents further include RNA extraction reagents, reverse transcription reaction system, and real-time PCR reagents.

[0014] Furthermore, in a preferred embodiment of the present invention, the above-mentioned product includes a gene chip or a reagent kit.

[0015] Fourthly, the present invention provides a kit for the diagnosis or treatment of colorectal cancer, the kit comprising a specific primer set for the above-mentioned circRNA marker; preferably, the primer set comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer being as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO.3.

[0016] Fifthly, the present invention provides the use of an expression inhibitor of the above-mentioned circRNA marker in the preparation of a medicament for treating colorectal cancer.

[0017] In a sixth aspect, the present invention provides a medicament for treating colorectal cancer, the active ingredient of which includes an expression inhibitor of the above-mentioned circRNA marker.

[0018] Compared with the prior art, the present invention has at least the following beneficial effects:

[0019] 1. We found that hsa_circ_0066801 was significantly highly expressed in colorectal cancer cells;

[0020] 2. Overexpression of hsa_circ_0066801 can promote the proliferation, migration, and invasion of colorectal cancer cells;

[0021] 3. Knockdown of hsa_circ_0066801 can inhibit the proliferation, migration and invasion of colorectal cancer cells, suggesting that it can be used as a target for the diagnosis and treatment of colorectal cancer.

[0022] 4. In vivo experiments confirmed that overexpression of hsa_circ_0066801 significantly increased tumor size, while knockdown significantly reduced it. This suggests that the circular RNA gene hsa_circ_0066801 can serve as a potential target for the treatment of colorectal cancer. Attached Figure Description

[0023] Figure 1 This is an identification diagram of the annular hsa_circ_0066801 in Embodiment 1 of the present invention;

[0024] Figure 2 This is a graph showing the screening results of stable overexpression and knockdown of hsa_circ_0066801 colorectal cancer cells in Example 2 of the present invention;

[0025] Figure 3 In Example 3 of this invention, overexpression of hsa_circ_0066801 significantly enhanced the proliferation, migration, and invasion abilities of colorectal cancer cell lines; conversely, knockdown of hsa_circ_0066801 significantly inhibited the proliferation, migration, and invasion abilities of colorectal cancer cell lines. These results were obtained using CCK-8, scratch assay, and Transwell invasion assays.

[0026] Figure 4 This is the result of a tumor transplantation experiment in nude mice using stable hsa_circ_0066801 cells overexpressed or knocked down in Example 4 of this invention. Detailed Implementation

[0027] The technical solutions of the present invention will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. It should be understood that the specific embodiments described herein are only for illustration and explanation of the present invention, and are not intended to limit the present invention. Although representative embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents. Example 1

[0028] Identification of hsa_circ_0066801.

[0029] The inventors discovered a circRNA that is specifically highly expressed in colorectal cancer cell lines compared to normal colonic epithelial cells. A search using circPrimer revealed that hsa_circ_0066801 is a circular RNA molecule formed by backsplicing exons 4 through 9 of the linear ATG3 gene. Figure 1 As shown. Its nucleotide sequence and backsplicing junction site (BSJ) are shown below. hsa_circ_0066801 gene sequence (SEQ ID No. 1):

[0030] GGCTACAGGGGAAGAATTGAAAGTGAAGGCATACCTACCAACAGGCAAACAATTTTTGGTAACCAAAAATGTGCCGTGCTATAAGCGGTGCAAACAGATGGAATATTCAGATGAATTGGAAGCTATCATTGAAGAAGATGATGGTGATGGCGGATGGGTAGATACATATCACAACACAGGTATTACAGGAATAACGGAAGCCGTTAAAGAGATCACACTGGAAAATAAGGACAATATAAGGCTTCAAGATT GCTCAGCACTATGTGAAGAGGAAGAAGATGAAGATGAAGGAGAAGCTGCAGATATGGAAGAATATGAAGAGAGTGGATTGTTGGAAACAGATGAGGCTACCCTAGATACAAGGAAAATAGTAGAAG CTTGTAAAGCCAAAACTGATGCTGGCGGTGAAGATGCTATTTTGCAAACCAGAACTTATGACCTTTACATCACTTATGATAAATATTACCAGACTCCACGATTATGGTTGTTTGGCTATGATGAG.

[0031] Based on partial reference sequences provided in the circPrimer database, primers for identifying reverse PCR amplification were designed. The primer sequences for amplifying the interface and flanking sequences of hsa_circ_0066801 are as follows:

[0032] .

[0033] We successfully verified the existence of hsa_circ_0066801 using PCR amplification and Sanger sequencing. We extracted genomic DNA (gDNA) and cDNA from SW480 cells as templates, and the amplification results were as follows (…). Figure 1 B) indicates that no amplification products were detected by the divergent primers in the gDNA sample, suggesting that the divergent primers specifically recognize the circular structure of hsa_circ_0066801. In the cDNA sample, the divergent primers successfully amplified a specific band, further confirming the specific expression of hsa_circ_0066801 in cells.

[0034] Considering the structural characteristic of circRNAs lacking a 3' poly(A) tail, we compared the effects of different reverse transcription primers on the detection efficiency of hsa_circ_0066801. The results showed that compared to random hexamer primers, using Oligo(dT) primers significantly reduced the cDNA yield of hsa_circ_0066801 during reverse transcription, while the cDNA level of linear ATG3 remained relatively stable. Figure 1 This difference fully demonstrates the essential difference between circRNA and linear RNA in their 3' end structure, and also verifies the circular structure characteristics of hsa_circ_0066801.

[0035] To further evaluate the structural stability of hsa_circ_0066801, we conducted an RNase R tolerance experiment. The results showed that after RNase R treatment, the expression level of hsa_circ_0066801 was significantly higher than that of linear ATG3, indicating that its circular structure can effectively resist the degradation by exonucleases. Figure 1 EF). Furthermore, through the actinomycin D experiment, we found that the half-life of hsa_circ_0066801 was significantly longer than that of its linear product (EF). Figure 1 (GH), further confirming the ring-shaped characteristics of hsa_circ_0066801 and its stronger stability. Example 2

[0036] Screening of cells stably overexpressing and knocking down hsa_circ_0066801.

[0037] To systematically elucidate the biological function of hsa_circ_0066801 in the pathological progression of colorectal cancer, this study constructed a gene regulatory vector using molecular cloning technology and verified it through sequencing. In the construction of the overexpression vector, the pLC5 circular RNA expression vector was selected as the basic framework, and the full sequence of hsa_circ_0066801 was directionally inserted to construct the recombinant plasmid pLC5-hsa_circ_0066801.

[0038] The gene knockdown vector sh-hsa_circ_0066801 was constructed based on the pLKO.1 vector. By designing and synthesizing a short hairpin RNA sequence specifically targeting the junction site of the hsa_circ_0066801 sequence, this vector efficiently achieved specific knockdown of hsa_circ_0066801. Lentiviral packaging was used to infect SW480 cells, and cell lines stably overexpressing and knocking down hsa_circ_0066801 were obtained through selection using gradient concentrations of puromycin. To ensure the reliability of the experimental system, such as... Figure 2 As shown, this invention uses RT-qPCR to systematically verify the stable transformation efficiency. Example 3

[0039] Transwell invasion and scratch assays were used to examine the effects of overexpression or knockdown of hsa_circ_0066801 on the invasion and migration abilities of colorectal cancer cells.

[0040] 1) CCK-8 proliferation experiment.

[0041] Cells in the logarithmic growth phase were seeded into 96-well plates, 1000 cells per well. After cell attachment (0 h), 10 μL of CCK-8 reagent was added to each well at 0 h, 24 h, 48 h, 72 h, and 96 h, and incubated at 37 ℃ for 1 h. The absorbance of each well was measured at 450 nm using a microplate reader.

[0042] 2) Transwell invasion experiment.

[0043] Transwell chambers were placed in 24-well plates. 1×Matrix gel was added to the upper chamber, and after solidification, DMEM containing 10% serum was added to the lower chamber as a chemokine. Colorectal cancer cell lines in logarithmic growth phase (either experimental or control group) were digested and resuspended in serum-free DMEM to a final density of 2×10⁻⁶ cells / well. 5 / mL. Add 200 μL of the above cell suspension to the upper chamber of the Transwell, shake well in a cross-shaped manner to ensure even distribution of cells, and incubate at 37°C with 5% CO2 for 12–18 h. Remove the chamber, wash once with PBS, fix cells with 4% paraformaldehyde at room temperature for 15 min, and then stain in 1× modified Giemsa stain for 45 min. After staining, gently wipe the upper chamber with a cotton swab to remove cells that have not penetrated the chamber. Take images using an inverted fluorescence microscope, and analyze with ImageJ to measure the number of cells that have penetrated the chamber and calculate the cell invasion rate.

[0044] 3) Scratch test.

[0045] Three parallel horizontal lines were drawn on the bottom of a six-well plate. Cells from either the experimental group or the control group in logarithmic growth phase were seeded into the six-well plates. When the cell density reached 90%, a straight line was drawn perpendicular to the horizontal lines using a 200 μL pipette tip. After washing away floating cells with PBS, 2 mL of DMED containing 1% serum was added, and the cells were cultured in a cell culture incubator at 37°C and 5% CO2. The scratch width was measured using an inverted fluorescence microscope at 0 h, 24 h, and 48 h after scratching, and analyzed using ImageJ.

[0046] The results are as follows Figure 3 As shown, the colorectal cancer cells overexpressing hsa_circ_0066801 showed significantly increased proliferation, migration, and invasion abilities compared to the negative control group; meanwhile, knocking down hsa_circ_0066801 significantly reduced the proliferation, migration, and invasion abilities of colorectal cancer cells. Example 4

[0047] The effect of hsa_circ_0066801 on the occurrence and development of colorectal cancer in vivo.

[0048] To further investigate the effect of hsa_circ_0066801 on the development and progression of colorectal cancer in vivo, this study transplanted stable transgenic cells with both overexpression and knockdown of hsa_circ_0066801 subcutaneously into the backs of nude mice. Tumor size was measured periodically, and the tumors were weighed at the end of the experiment. Results are as follows: Figure 4 As shown, tumor tissue significantly increased in size after overexpression of hsa_circ_0066801, but decreased in size after knockdown. This suggests that specifically targeting overexpressed hsa_circ_0066801 may be a potential strategy for treating colorectal cancer.

[0049] In summary, this invention is the first to discover and confirm that hsa_circ_0066801 is highly expressed in colorectal cancer, and can be used to indicate the diagnosis and prognosis of this disease. The inventors also demonstrated that overexpression of hsa_circ_0066801 in colorectal cancer cell lines significantly enhanced the proliferation, migration, and invasion abilities of colorectal cancer cells; furthermore, knockdown of hsa_circ_0066801 in colorectal cancer cell lines significantly reduced the proliferation, migration, and invasion abilities of colorectal cancer cells. Further, in vivo experiments showed that overexpression of hsa_circ_0066801 significantly increased tumor size, while knockdown reduced it. This indicates that hsa_circ_0066801 can serve as both a biomarker for the diagnosis of colorectal cancer and a potential therapeutic target. Reagents for detecting hsa_circ_0066801 can be used in products for the diagnosis or treatment of cancer, such as gene chips or kits.

[0050] Finally, it should be clarified that the above are merely preferred embodiments of the present invention and do not constitute a limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made without departing from the principles and spirit of the present invention are still included within the scope of protection of the present invention.

Claims

1. A circRNA biomarker, characterized in that: The circRNA marker is the nucleotide sequence hsa_circ_0066801 as shown in SEQ ID No.

1.

2. A primer set for a circRNA marker as described in claim 1, characterized in that, The primer set includes forward primers and reverse primers; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. The use of the circRNA biomarker as described in claim 1 in the preparation of products for the diagnosis or treatment of colorectal cancer.

4. The use of a reagent for detecting the circRNA biomarker as described in claim 1 in the preparation of products for the diagnosis or treatment of colorectal cancer.

5. The application according to claim 4, characterized in that, The reagents are selected from: probes, gene chips, or detection primer sets that have detection specificity for the circRNA marker; the detection primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

6. The application according to claim 5, characterized in that, The reagents also include RNA extraction reagents, reverse transcription reaction systems, and quantitative real-time PCR reagents.

7. The application according to claim 4, characterized in that, The products include gene chips or reagent kits.

8. A kit for the diagnosis or treatment of colorectal cancer, characterized in that, The kit includes a specific primer set for the circRNA marker of claim 1; the primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

9. The use of an expression inhibitor of the circRNA marker as described in claim 1 in the preparation of a medicament for treating colorectal cancer.

10. A drug for treating colorectal cancer, characterized in that, Its active ingredient includes an expression inhibitor of the circRNA marker as described in claim 1.

Images