PegRNA of specific targeting EGFR gene tyrosine 1068 site, pilot editing system and application

Abstract

The invention relates to the technical field of molecular biology and the technical field of gene editing, in particular to pegRNA of a specific target EGFR gene tyrosine 1068 site, a pilot editing system and application. The pegRNA comprises sgRNA (small guide RNA), sgRNA scaffold, an RT (reverse transcription) template and PBS (phosphate buffer solution); wherein the sequence of the pegRNA is as shown in SEQ ID NO. 1; the sequence of the sgRNA is as shown in SEQ ID NO. 2; the sequence of the sgRNA scaffold is as shown in SEQ ID NO. 3; the sequence of the RT template is as shown in SEQ ID NO. 4; the sequence of the PBS is as shown in SEQ ID NO. 5. The tyrosine 1068 site of the EGFR gene is mutated into phenylalanine, so that phosphorylation of the site is blocked, and a protein structure is maintained. The tyrosine 1068 site point mutant with the EGFR gene can be applied to research on preparation of drugs for treating cancers, research on drug resistance and research on screening of compounds of targeted EGFR signal channels.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and gene editing, specifically to a pegRNA that specifically targets the 1068th tyrosine position of the EGFR gene, a lead editing system, and its application. Background Technology

[0002] Epidermal growth factor receptor (EGFR) is a transmembrane receptor tyrosine kinase that plays a crucial role in cell proliferation, survival, migration, and differentiation. Abnormal EGFR expression is closely associated with the development and progression of various cancer types, making it an important target for cancer therapy. Upon binding to EGF ligands, EGFR dimers and can activate autophosphorylation at multiple tyrosine residues in its intracellular kinase domain, including Y992, Y1045, Y1068, Y1148, and Y1173. The activated Y1068 residue can then guide downstream phosphorylation via the signal adaptor protein Grb2, including AS-RAF-MEK-ERK and PI3K-AKT.

[0003] The tyrosine 1068 (Y1068) activation site is one of the most critical phosphorylation sites in EGFR. Because Y1068 mediates the activation of oncogenic signaling pathways driving cancer progression, its phosphorylation is elevated in various cancer types and is associated with poor prognosis and drug resistance. Therefore, developing cell models with specific mutations at this phosphorylation site will provide a research foundation for understanding EGFR-mediated signal transduction mechanisms and promote the development of targeted cancer therapies.

[0004] Traditional gene mutation methods, such as the CRISPR / Cas9 editing system, typically result in insertions / deletions rather than precise nucleotide substitutions. Prime editing (PE) is a newly developed gene editing technology that allows for precise point mutations without the need for double-strand breaks or donor DNA templates. The PE editing system consists of a fusion protein composed of a Cas9 nickase and a reverse transcriptase (RT), along with a PE guide RNA (pegRNA) containing the target sequence and the desired editing template.

[0005] Currently, there are no reported methods for precisely mutating the EGFR Y1068 phosphorylation site in HeLa cells using the PE editing system. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention aims to provide a pegRNA specifically targeting the 1068th tyrosine residue of the EGFR gene, a lead editing system, and its applications. By mutating the 1068th tyrosine residue of the EGFR gene to phenylalanine, phosphorylation at this site is blocked while maintaining protein structure. This EGFR gene tyrosine 1068 point mutant can be applied to research on the preparation of therapeutic cancer drugs, drug resistance studies, and the screening of compounds targeting the EGFR signaling pathway. This EGFR gene tyrosine 1068 point mutant provides an important tool for understanding the role of EGFR gene tyrosine 1068 phosphorylation in cancer cell proliferation, migration, and drug response, and is of significant value for research on related cancer mechanisms, the development of treatment methods, and drug screening.

[0007] To achieve the above objectives, in a first aspect, the present invention provides a pegRNA that specifically targets the tyrosine 1068 site of the EGFR gene, wherein the pegRNA comprises sgRNA, sgRNA scaffold, RT template, and PBS; wherein, The sequence of the pegRNA is shown in SEQ ID NO.1; The sequence of the sgRNA is shown in SEQ ID NO.2; The sequence of the sgRNA scaffold is shown in SEQ ID NO.3; The sequence of the RT template is shown in SEQ ID NO.4; The sequence of the PBS is shown in SEQ ID NO.5.

[0008] Secondly, the present invention provides a pilot editing system, which includes the pegRNA and fusion protein described in the present invention.

[0009] Thirdly, the present invention provides a gene editing kit, the gene editing kit comprising an expression vector for expressing the pegRNA described in the present invention and an expression vector for expressing a fusion protein.

[0010] Fourthly, the application of the pegRNA, pilot editing system, and gene editing kit described in this invention in the specific recognition and / or targeting of the 1068th tyrosine residue of the EGFR gene; and / or, Application in the preparation of products that specifically recognize and / or target the genomic sequence of the EGFR gene at tyrosine 1068.

[0011] Fifthly, the present invention provides a point mutant of the EGFR gene at the tyrosine 1068 site in HeLa cells, wherein the tyrosine 1068 site of the EGFR gene in HeLa cells is mutated from tyrosine to phenylalanine.

[0012] Sixthly, the present invention provides a method for constructing a point mutant at the tyrosine 1068 site of the EGFR gene in HeLa cells, the method comprising: 1) Electrotransfect the pilot editing system described in this invention into HeLa cells; 2) Screen and validate monoclonal cell lines with a mutation at tyrosine 1068 of the EGFR gene to phenylalanine.

[0013] In the above technical solution, this invention designs and synthesizes pegRNA targeting the tyrosine 1068 (Y1068) site of the EGFR gene, mutating the EGFR gene tyrosine 1068 site to phenylalanine, thereby blocking phosphorylation at this site and maintaining protein structure. The EGFR gene tyrosine 1068 point mutant can be applied to research on the preparation of therapeutic cancer drugs, drug resistance studies, and screening of compounds targeting the EGFR signaling pathway. This EGFR gene tyrosine 1068 point mutant provides an important tool for understanding the role of EGFR gene tyrosine 1068 phosphorylation in cancer cell proliferation, migration, and drug response, and has significant value for related cancer mechanism research, treatment method development, and drug screening.

[0014] Other features and advantages of the present invention will be described in detail in the following detailed description section. Attached Figure Description

[0015] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof. In the drawings: Figure 1 These are the peak sequence results after pegRNA cleavage during the construction of the point mutant cell model; Figure 2 This is the DNA sequencing identification result of a cell model from which the EGFR gene Y1068F point mutation was successfully mutated in the HeLa cell line; Figure 3 The results of Western blot analysis are from a cell model in which the EGFR gene Y1068F point mutation was successfully mutated in the HeLa cell line. Figure 4 This is a comparison of the cell proliferation performance of HeLa cells under five different electrotransfection parameters; Figure 5These are sequencing results of HeLa cell line EGFR gene Y1068F monoclonal point mutant cells obtained using a single-base editor. Detailed Implementation

[0016] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0017] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0018] In a first aspect, the present invention provides a pegRNA that specifically targets the tyrosine 1068 site of the EGFR gene, wherein the pegRNA comprises sgRNA, sgRNA scaffold, RT template, and PBS; wherein, The sequence of the pegRNA is shown in SEQ ID NO.1; The sequence of the sgRNA is shown in SEQ ID NO.2; The sequence of the sgRNA scaffold is shown in SEQ ID NO.3; The sequence of the RT template is shown in SEQ ID NO.4; The sequence of the PBS is shown in SEQ ID NO.5.

[0019] SEQ ID NO.1: 5'-CTTCTCATGCGAAGGAATTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGCTGGTCAGGAAATCCTCGATGAAGAAGCAATTCCTTCGCA-3' SEQ ID NO.2: 5'-CCTCAGTCAAGGCGCCTGTG-3' SEQ ID NO.3: 5'-GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG-3' SEQ ID NO.4: 5'-GATTCAGCTCAGACCCCAC-3' SEQ ID NO.5: 5'-AGGCGCCTTGA-3' In the pegRNA sequence, the first 20 bases represent the sgRNA sequence of the EGFR gene, the middle part represents the scaffold sequence, and the last 30 bases represent the RT template sequence containing the Y (tyrosine) to F (phenylalanine) mutation (from TAC to TTC) and PBS.

[0020] Secondly, the present invention provides a pilot editing system, which includes the pegRNA and fusion protein described in the present invention.

[0021] In a preferred embodiment of the present invention, the fusion protein comprises a Cas9 nickase and a reverse transcriptase; wherein the Cas9 nickase has an H840A mutation for creating a single-strand nick rather than a double-strand break; and the reverse transcriptase is MMLV or a truncated version thereof with reverse transcriptase activity, used to fuse the linker sequence with the C-terminus of the Cas9 nickase.

[0022] Thirdly, the present invention provides a gene editing kit, the gene editing kit comprising an expression vector for expressing the pegRNA described in the present invention and an expression vector for expressing a fusion protein.

[0023] Fourthly, the application of the pegRNA, pilot editing system, and gene editing kit described in this invention in the specific recognition and / or targeting of the 1068th tyrosine residue of the EGFR gene; and / or, Application in the preparation of products that specifically recognize and / or target the genomic sequence of the EGFR gene at tyrosine 1068.

[0024] Fifthly, the present invention provides a point mutant of the EGFR gene at the tyrosine 1068 site in HeLa cells, wherein the tyrosine 1068 site of the EGFR gene in HeLa cells is mutated from tyrosine to phenylalanine.

[0025] Sixthly, the present invention provides a method for constructing a point mutant at the tyrosine 1068 site of the EGFR gene in HeLa cells, the method comprising: 1) Electrotransfect the pilot editing system described in this invention into HeLa cells; 2) Screen and validate monoclonal cell lines with a mutation at tyrosine 1068 of the EGFR gene to phenylalanine.

[0026] In a preferred embodiment of the present invention, in step 1), the electrotransfection is performed using the Neon transfection system under conditions optimized for HeLa cells.

[0027] In a preferred embodiment of the present invention, the parameters of the electrotransfection include a voltage of 900~1500 V, a pulse width of 10~45 ms, a pulse length of 0.5~3, and a density of 0.5~2×10⁻⁶ per electrotransfection. 6 Each cell.

[0028] In a preferred embodiment of the present invention, in step 2), the verification method is to perform Sanger sequencing on the target region of the transformed HeLa cells using primer pairs; wherein, The primers include forward primers and reverse primers; The sequence of the forward primer is shown in SEQ ID NO.6; The sequence of the reverse primer is shown in SEQ ID NO.7.

[0029] SEQ ID NO.6: 5'-CGGAGTAACCTTCCCTCATTTC-3' SEQ ID NO.7: 5'-GGCTCGGTCATGTGTTTATCT-3' The present invention will be described in detail below through examples. In the following examples, the pharmaceuticals and agents are all conventional commercially available products.

[0030] Table 1. Sequences involved in this invention:

[0031] Example 1 Primer Design (1) Identify the phosphorylation site mutation at Y1086 in the EGFR gene: The tyrosine codon TAC at position Y1068 was changed to the phenylalanine codon TTC; therefore, the second base of the tyrosine codon at position Y1068 was changed from A to T, and subsequent primer design was based on this.

[0032] (2) pegRNA design: Using an online pegRNA design tool, the sequence information of the confirmed mutation site was input, and suitable sgRNA and pegRNA sequences were selected from the results. The sgRNA selection sequence is: 5'-CCTCAGTCAAGGCGCCTGTG-3'; The sgRNA scaffold sequence for Cas9 binding is as follows: 5'-GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG-3'; The RT template sequence is: 5'-GATTCAGCTCAGACCCCAC-3'; The base sequence containing the Y1068F mutation has a tyrosine mutation that is changed to phenylalanine (TAC becomes TTC). The PBS sequence is as follows: 5'-AGGCGCCTTGA-3'; Complementary to the downstream sequence of the incision site; The complete pegRNA sequence is as follows: 5'-CCTCAGTCAAGGCGCCTGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGATTCAGCTCAGACCCCACAGGCGCCTTGA-3'; (3) Design sequencing PCR primers: Genotyping analysis was performed after the experiment, and Sanger sequencing was performed using the following primers to identify clones with the desired Y1068F mutation.

[0033] Forward primer sequence: 5'-CGGAGTAACCTTCCCTCATTTC-3'; Reverse primer sequence: 5'-GGCTCGGTCATGTGTTTATCT-3'.

[0034] Example 2 Cell transfection (1) HeLa cells were cultured in DMEM medium containing 10% FBS and 1% penicillin / streptomycin at 37°C in a 5% CO2 incubator until they reached a density of 70-80%. (2) The cultured HeLa cells were isolated by trypsin digestion and collected. They were washed 1-2 times with DPBS and then resuspended in the transfection system R buffer, with the density adjusted to 0.5-1×10⁻⁶. 6 One cell; (3) Electrotransfection of the cells from step (2) was performed using the Neon transfection system. For each electrotransfection, 5 μL of cell suspension was mixed with the pilot editing system solution and the volume was adjusted to 10 μL; wherein, The pilot editing system solution consisted of 90 pmol pegRNA and 0.8 μg of purified Cas9-RT fusion protein; The electroporation parameters were: voltage: 1200 V; pulse width: 30 ms; pulse duration: 1. (4) After electroporation, the cells were immediately transferred to a 6-well plate containing preheated serum-free DMEM containing antibiotics and cultured for 4-12 h, and then transferred to DMEM complete medium containing 10% FBS and cultured for 24-48 h.

[0035] Example 3: Monoclonal Cell Acquisition (1) The cells transfected and cultured for 24-48 h in Example 2 were treated with trypsin and the cell density was detected by trypan blue dye; (2) Dilute the cell density to 1×10 3 Cells / mL, and 100 μL of cell suspension is injected into 10 wells of a 96-well plate. The cells in these 10 wells are counted under a microscope, and the total number is n. The required cell suspension volume M in the 96 wells is calculated according to the following formula: M=n / 5. (3) Inject the required cell suspension volume M into 16.8 mL of DNME complete medium and inject it into a 96-well plate. Add 200 μL of cell suspension with DNME complete medium to each well. Incubate at 37°C and 5% CO2 for 1-2 weeks. Observe the growth of single cells under a microscope. When the single cells grow to 30-50% confluence, resuspend the cells and expand them into a 6-well plate for further culture and wait for further detection.

[0036] Example 4: Peak sequence test of pegRNA after cleavage during the construction of the HeLa cell line EGFR gene Y1068F point mutant cell model When the cell confluence in the 6-well plate reached 70-80%, a portion of the cells was harvested for genotyping analysis, and the remaining cells were expanded and cryopreserved. Genomic DNA was extracted from each clone, and Sanger sequencing was performed using the following primers to identify clones with the desired Y1068F mutation. See below for specific results. Figure 1 The primer sequences are as follows: Forward primer: 5'-CGGAGTAACCTTCCCTCATTTC-3' Reverse primer: 5'-GGCTCGGTCATGTGTTTATCT-3'.

[0037] To achieve the EGFR Y1068F mutation, the tyrosine codon TAC needs to be changed to the phenylalanine codon TTC. Figure 1The sequence peak diagram shows that the amino acid at this site was successfully mutated from TAC to TTC, and there are no overlapping peaks or extraneous peaks in the peak diagram, indicating that the clone is a single clone and is consistent with the expected point mutation site, which meets the requirements.

[0038] Example 5: Sequencing and identification of the Y1068F point mutation in the EGFR gene of HeLa cell lines. To confirm the success of the HeLa cell line EGFR gene Y1068F point mutation model, this invention extracted a portion of single-clone cells for genotyping analysis, while the remaining cells were expanded and cryopreserved. Genomic DNA was extracted from each clone, and Sanger sequencing was performed using the following primers to identify clones with the desired Y1068F mutation. Specific results were obtained by [further details needed]. Figure 2 As shown, the primer sequences are as follows: Forward primer: 5'-CGGAGTAACCTTCCCTCATTTC-3' Reverse primer: 5'-GGCTCGGTCATGTGTTTATCT-3'.

[0039] Depend on Figure 2 The content shows that the amino acid at the Y1068F point mutation site of the EGFR gene in the HeLa cell line was successfully mutated from TAC to TTC, and no frameshift mutations or base substitutions occurred before or after the mutation site. This indicates that the clone is a single clone and is consistent with the expected point mutation site, which meets the requirements.

[0040] Example 6: Western blot analysis of HeLa cells with EGFR gene Y1068F point mutation Cells cultured in Example 3 were extracted and analyzed by Western blotting to further validate positive clones. Total EGFR expression was confirmed using an anti-EGFR antibody, and the absence of phosphorylation at the mutation site was confirmed using an anti-phosphorylated EGFR-Y1068 antibody. Specific results were obtained from [the following text is missing from the original extract]. Figure 3 As shown.

[0041] Depend on Figure 3 Western blot results showed that the total EGFR protein expression level in HeLa cells with the Y1068F point mutation of the EGFR gene was consistent with the EGFR expression level in wild-type HeLa cells; however, the phosphorylation expression level of the EGFR gene at the Y1068 site in point-mutant HeLa cells was significantly downregulated compared with wild-type HeLa cells, and the band was almost completely absent.

[0042] Combination Figure 1 and Figure 2 As a result, this invention clearly demonstrates the successful construction of a mutation model of the phosphorylation site of the EGFR gene Y1068 in HeLa cells.

[0043] Example 7: Expanded culture and cryopreservation of a successfully constructed monoclonal cell line via point mutation. (1) Point mutant cells that were successfully confirmed by Sanger sequencing and Western blot analysis were labeled and cultured on a large scale; (2) After treating cells with trypsin, the density of the cell suspension was detected using trypan blue. 5×10 6 The cells / mL are frozen for storage. The specific steps for freezing are as follows: After centrifuging the cell suspension at 300 g for 5 min, the cell supernatant was discarded. The cell cryopreservation solution was prepared with 90% DMEM complete medium and 10% DMSO. The cells were resuspended in 1 mL of the cell cryopreservation solution, labeled, and placed in a -80°C freezer. The cells were then transferred to a liquid nitrogen tank.

[0044] Example 8 The electrotransfection parameters for this comparative example were set as follows: voltage: 1400V; width: 30 ms; pulse: 1.

[0045] 1×10 6 One HeLa cell suspension was mixed with 100 pmol pegRNA and 1 μg of purified Cas9-RT fusion protein, and the volume was adjusted to 10 μL using electroporation buffer R. The mixture was transferred to an electroporation cuvette and transfected using the above electroporation parameters. The transfection steps were the same except for the electroporation parameters. The post-transfection steps were the same as in Example 3. Cell proliferation and cytotoxicity were detected using a CCK8 assay kit 48 h after transfection.

[0046] Add 200 μL of a solution containing 5 × 10⁻⁶ mg / L to the 96-well plate. 3 Cells were electroporated per well, and 20 μL of CCK-8 solution was added to each well to form group 1 of the electroporation experiment; another 200 μL of solution containing 5 × 10⁶ cells was added to each well. 3 Cells that were electroporated empty (without pegRNA and Cas9-RT fusion protein, all other electroporation parameters were the same) were also added to 20 μL of CCK-8 solution as a blank control cell group. Next, all cells were incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. Cell proliferation performance was statistically analyzed. Specific results are shown in [link to results]. Figure 4 .

[0047] Example 9 The electrotransfection parameters for this comparative example were set as follows: voltage: 1200 V; width: 30 ms; pulse: 1.

[0048] 1×10 6HeLa cell suspension was mixed with 90 pmol pegRNA and 0.8 μg purified Cas9-RT fusion protein, and the volume was adjusted to 10 μL using electroporation buffer R. The mixture was transferred to an electroporation cuvette and transfected using the above electroporation parameters. The transfection steps were the same except for the electroporation parameters. The post-transfection steps were the same as in Example 3. Cell proliferation and cytotoxicity were detected using a CCK8 assay kit 48 h after transfection.

[0049] Add 200 μL of a solution containing 5 × 10⁻⁶ mg / L to the 96-well plate. 3 Cells were electroporated per well, and 20 μL of CCK-8 solution was added to each well to form group 2 of the electroporation experiment; another 200 μL of solution containing 5 × 10⁶ cells was added to each well. 3 Cells that were electroporated empty (without pegRNA and Cas9-RT fusion protein, all other electroporation parameters were the same) were also added to 20 μL of CCK-8 solution as a blank control cell group. Next, all cells were incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. Cell proliferation performance was statistically analyzed. Specific results are shown in [link to results]. Figure 4 .

[0050] Example 10 The electroporation parameters for this comparative example were set as follows: voltage: 1100 V; pulse width: 20 ms; pulse duration: 2 pulses. 1×10⁻⁶ 6 One HeLa cell suspension was mixed with 100 pmol pegRNA and 1 μg of purified Cas9-RT fusion protein, and the volume was adjusted to 10 μL using electroporation buffer R. The mixture was transferred to an electroporation cuvette and transfected using the above electroporation parameters. The transfection steps were the same except for the electroporation parameters. The post-transfection steps were the same as in Example 3. Cell proliferation and cytotoxicity were detected using a CCK8 assay kit 48 h after transfection.

[0051] Add 200 μL of a solution containing 5 × 10⁻⁶ mg / L to the 96-well plate. 3 Cells were electroporated per well, and 20 μL of CCK-8 solution was added to each well to form group 3 of the electroporation experiment; another 200 μL of solution containing 5 × 10⁶ cells was added to each well. 3 Cells that were electroporated empty (without pegRNA and Cas9-RT fusion protein, all other electroporation parameters were the same) were also added to 20 μL of CCK-8 solution as a blank control cell group. Next, all cells were incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. Cell proliferation performance was statistically analyzed. Specific results are shown in [link to results]. Figure 4 .

[0052] Example 10 The electroporation parameters for this comparative example were set as follows: voltage: 1000 V; pulse width: 20 ms; pulse duration: 2 times. 1×10⁻⁶ 6 One HeLa cell suspension was mixed with 100 pmol pegRNA and 1 μg of purified Cas9-RT fusion protein, and the volume was adjusted to 10 μL using electroporation buffer R. The mixture was transferred to an electroporation cuvette and transfected using the above electroporation parameters. The transfection steps were the same except for the electroporation parameters. The post-transfection steps were the same as in Example 3. Cell proliferation and cytotoxicity were detected using a CCK8 assay kit 48 h after transfection.

[0053] Add 200 μL of a solution containing 5 × 10⁻⁶ mg / L to the 96-well plate. 3 Cells were electroporated per well, and 20 μL of CCK-8 solution was added to each well to form group 4 of the electroporation experiment; another 200 μL of solution containing 5 × 10⁶ cells was added to each well. 3 Cells that were electroporated empty (without pegRNA and Cas9-RT fusion protein, all other electroporation parameters were the same) were also added to 20 μL of CCK-8 solution as a blank control cell group. Next, all cells were incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. Cell proliferation performance was statistically analyzed. Specific results are shown in [link to results]. Figure 4 .

[0054] Example 11 The electroporation parameters for this comparative example were set as follows: voltage: 900 V; pulse width: 10 ms; pulse duration: 3 times. 1×10⁻⁶ 6 One HeLa cell suspension was mixed with 100 pmol pegRNA and 1 μg of purified Cas9-RT fusion protein, and the volume was adjusted to 10 μL using electroporation buffer R. The mixture was transferred to an electroporation cuvette and transfected using the above electroporation parameters. The transfection steps were the same except for the electroporation parameters. The post-transfection steps were the same as in Example 3. Cell proliferation and cytotoxicity were detected using a CCK8 assay kit 48 h after transfection.

[0055] Add 200 μL of a solution containing 5 × 10⁻⁶ mg / L to the 96-well plate. 3 Cells were electroporated per well, and 20 μL of CCK-8 solution was added to each well to form group 5 of the electroporation experiment; another 200 μL of solution containing 5 × 10⁶ cells was added to each well. 3 Cells that were electroporated empty (without pegRNA and Cas9-RT fusion protein, all other electroporation parameters were the same) were also added to 20 μL of CCK-8 solution as a blank control cell group. Next, all cells were incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. Cell proliferation performance was statistically analyzed. Specific results are shown in [link to results]. Figure 4 .

[0056] Depend on Figure 4 The results showed that cell proliferation was best in group 3 of the electroporation experiment. See details below. Figure 4 .

[0057] Comparative Example 1 A single-base editor (SBE) is a precise gene-editing tool that enables site-directed mutation of a single nucleotide without causing double-strand breaks. SBEs are mainly divided into two categories: cytosine base editors (CBEs) and adenine base editors (ABEs). When the editor binds to the target DNA sequence, cytosine deaminase deaminates cytosine (C) to uracil (U). During DNA replication, U pairs with adenine (A), ultimately achieving the C→T conversion. ABEs, on the other hand, use adenine deaminase to convert adenine to hypoxanthine, achieving the A→G conversion. PE editing systems can perform precise point mutations without double-strand breaks or donor DNA templates, and their point mutation efficiency is higher than that of SBEs. Furthermore, compared to SBE, PE editing eliminates the need for synthesizing sgRNA and Oligo sequences, requiring only a single pegRNA sequence. This simplifies the process and reduces self-splitting caused by sequence similarity between sgRNA and Oligo sequences, as well as re-cutting due to sgRNA binding after homology-directed repair. Additionally, PE editing produces more precise gene editing for point mutations, while SBE's sgRNA may cause frameshift effects or multi-site mutational substitutions, resulting in lower editing precision and poorer effects. The following is an experiment using SBE to perform point mutations on EGFR Y1068F.

[0058] The single-stranded Oligo and sgRNA required for SBE design, for the EGFR Y1068F mutation, need to change the tyrosine codon TAC to the phenylalanine codon TTC, altering the bases at this site. The designed sgRNA targets the genomic region in the EGFR gene exon containing the Y1068 tyrosine codon and has the following components: a) sgRNA sequence (20 nt): 5'-CCTCAGTCAAGGCGCCTGTG-3' targets regions containing Y1068; b) scaffold sequence sgRNA for Cas9 binding (64 nt): 5'-GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG-3'; c) The single-stranded Oligo sequence is: 5'-TGTCCCATCAAGGAAGACAGCTTTCTTGCAGCGATTCAGCTCAGACCCCACAGGCGCCTTGACTGAGGACAGCATAGACGA-3'; The single-stranded Oligo sequence contains information about point mutations. The single-stranded Oligo and sgRNA sequences are commercially synthesized for expression in mammalian cells.

[0059] d) The Cas9 protein is obtained commercially.

[0060] HeLa cells were cultured in DMEM medium containing 10% FBS and 1% penicillin / streptomycin at 37°C in a 5% CO2 incubator until they reached a density of 70-80%. Cells were isolated using trypsin, washed 1-2 times with DPBS, and then resuspended in R buffer of the transfection system. The cell density was adjusted to 0.5-1 × 10⁶ cells / day. 6 cells / mL; For electrotransfection, 5 μL of cell suspension was mixed with the following solvent and brought to a final volume of 10 μL: 100 pmol sgRNA; 100 pmol Oligo; 1 μg purified Cas9 protein. Electrotransfection was performed using the Neon transfection system with the following parameters: voltage: 1100V; width: 20 ms; pulses: 2.

[0061] Following electroporation, cells were immediately transferred to preheated 6-well plates containing antibiotic-free DMEM serum-free medium and cultured for 4–12 h, then transferred to DMEM complete medium containing 10% FBS and cultured for 24–48 h. Subsequent single-clone cell acquisition and expansion culture were then performed.

[0062] A subset of monoclonal cells was extracted for genotyping analysis. Genomic DNA was extracted from each clone and Sanger sequencing was performed using the following primers to identify clones with the desired Y1068F mutation. Specific results are provided by [the relevant authority / organization]. Figure 5 As shown, the primer sequences are as follows: Forward primer: 5'-CGGAGTAACCTTCCCTCATTTC-3'; Reverse primer: 5'-GGCTCGGTCATGTGTTTATCT-3'.

[0063] Figure 5These are sequencing results of HeLa cell line EGFR gene Y1068F monoclonal point mutant cells obtained using SBE, and... Figure 2 Compared with the sequencing results of the HeLa cell line EGFR gene Y1068F monoclonal point mutant cells obtained by PE editing, it can be seen that the point mutant cells obtained by SBE did not have the mutation of changing the tyrosine codon TAC to the phenylalanine codon TTC at the Y1068 site of the EGFR gene. This indicates that under the same experimental conditions and number of experiments, the point mutation efficiency of SBE is not as high as that of PE editing, and PE editing is more suitable for point mutation experiments.

[0064] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0065] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0066] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A pegRNA that specifically targets the tyrosine 1068 site of the EGFR gene, characterized in that, The pegRNA includes sgRNA, sgRNA scaffold, RT template, and PBS; wherein, The sequence of the pegRNA is shown in SEQ ID NO.1; The sequence of the sgRNA is shown in SEQ ID NO.2; The sequence of the sgRNA scaffold is shown in SEQ ID NO.3; The sequence of the RT template is shown in SEQ ID NO.4; The sequence of the PBS is shown in SEQ ID NO.

5.

2. A pilot editing system, characterized in that, The lead editing system includes the pegRNA and fusion protein as described in claim 1.

3. The pilot editing system according to claim 2, characterized in that, The fusion protein includes Cas9 nickase and reverse transcriptase; wherein... The Cas9 nickase has an H840A mutation; The reverse transcriptase is MMLV or a truncated form thereof with reverse transcriptase activity.

4. A gene editing kit, characterized in that, The gene editing kit includes an expression vector for expressing the pegRNA of claim 1 and an expression vector for expressing the fusion protein.

5. The use of the pegRNA of claim 1, or the lead editing system of claim 2 or 3, or the gene editing kit of claim 4 in specifically recognizing and / or targeting the 1068th tyrosine residue of the EGFR gene; and / or, Application in the preparation of products that specifically recognize and / or target the genomic sequence of the EGFR gene at tyrosine 1068.

6. A point mutant at tyrosine 1068 of the EGFR gene in HeLa cells, characterized in that, The EGFR gene in HeLa cells was mutated at position 1068 from tyrosine to phenylalanine.

7. A method for constructing a point mutant at tyrosine 1068 of the EGFR gene in HeLa cells, characterized in that, The construction method includes: 1) Electrotransfect the pilot editing system described in claim 2 or 3 into HeLa cells; 2) Screen and validate monoclonal cell lines with a mutation at tyrosine 1068 of the EGFR gene to phenylalanine.

8. The construction method according to claim 7, characterized in that, In step 1), the electrotransfection is performed using the Neon transfection system under conditions optimized for HeLa cells.

9. The construction method according to claim 7 or 8, characterized in that, The parameters for electrotransfection include a voltage of 900–1500 V, a pulse width of 10–45 ms, a pulse length of 0.5–3, and a transfection density of 0.5–2 × 10⁻⁶ per electrotransfection. 6 Each cell.

10. The construction method according to any one of claims 7-9, characterized in that, In step 2), the verification method involves Sanger sequencing of the target region of the transformed HeLa cells using primer pairs; wherein, The primers include forward primers and reverse primers; The sequence of the forward primer is shown in SEQ ID NO.6; The sequence of the reverse primer is shown in SEQ ID NO.7.

Images