Use of a long non-coding RNA gene and small interfering RNA thereof in preparation of a drug for inhibiting triple-negative breast cancer

Abstract

The application provides a long-chain non-coding RNA gene and a small interfering RNA thereof in the preparation of a drug for inhibiting triple-negative breast cancer. The nucleotide sequence of the long-chain non-coding RNA gene is shown as SEQ ID NO. 1. The nucleotide sequence of the small interfering RNA is shown as SEQ ID NO. 2. The application also provides a reagent for detecting the long-chain non-coding RNA gene in the preparation of a kit for diagnosing triple-negative breast cancer. The application also provides the long-chain non-coding RNA gene as a therapeutic target in the screening of a drug for treating triple-negative breast cancer. The application proves that overexpression of the long-chain non-coding RNA gene promotes the proliferation, migration and invasion of triple-negative breast cancer cells through in-vitro and in-vivo experiments; and proves that knockdown of the long-chain non-coding RNA gene can inhibit the proliferation, migration and invasion of triple-negative breast cancer cells through in-vitro and in-vivo experiments.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to a long non-coding RNA gene, in particular, a long non-coding RNA gene and a small interfering RNA thereof for use in the preparation of a medicament for inhibiting triple-negative breast cancer. BACKGROUND

[0002] Breast cancer is the highest incidence and mortality rate of malignant tumor in the world. According to molecular typing, breast cancer is divided into luminal type, HER-2 positive type and triple-negative breast cancer (TNBC). TNBC has characteristics of high heterogeneity and high invasiveness, and is prone to distant metastasis. Once metastasis occurs, the 5-year survival rate of patients is less than 25%. TNBC lacks estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor-2 (HER-2), and there is currently no effective treatment target. Therefore, finding an effective treatment target that can inhibit the growth and metastasis of TNBC is the key to improving the prognosis of patients.

[0003] Long non-coding RNA (lncRNA) refers to an RNA molecule with a length of more than 200 nucleotides and not encoding a protein. Research in the past decade has shown that lncRNA is widely involved in various pathological and physiological processes, including cancer, neurodegenerative diseases, cardiovascular diseases, and autoimmune and inflammatory diseases. Existing studies have confirmed that lncRNA can affect multiple stages of tumor development through various mechanisms such as regulation of gene transcription, mRNA stability / translation, protein modification, and protein-protein complex formation, promoting malignant phenotypes such as proliferation, stemness maintenance, and metastasis of tumor cells. Abnormal expression of lncRNA has been observed in various cancers such as colon cancer, gastric cancer, lung cancer and breast cancer. These dysregulated lncRNAs play an important role in tumor occurrence and development.

[0004] Specifically, in breast cancer, LINC02273 increases the transcription of AGR2 through epigenetic mechanisms, driving tumor cell metastasis. In bladder cancer: lncRNA ZEB1-AS1 promotes cancer cell migration and metastasis by activating ZEB1 after transcription; lncRNA SPRY4-IT1 inhibits miR-101-3p by up-regulating EZH2, thereby promoting cancer cell proliferation and metastasis. In lung cancer: lncRNA AFAP1-AS1 up-regulates c-Myc expression by binding to SNIP1, accelerating cancer cell migration and invasion. These research results fully demonstrate that lncRNA is closely related to the occurrence and development of tumors, and has great potential as a tumor diagnostic marker, prognostic evaluation index and therapeutic target.

[0005] UCA1 (Urothelial Carcinoma Associated 1) is a long non-coding RNA located on chromosome 19 with a transcript length of 2314 bp, which was first discovered and named in bladder cancer tissue. Existing studies have reported that UCA1 is involved in the occurrence and development of various cancers such as breast cancer, gastric cancer, lung cancer and bladder cancer, and is related to tumor proliferation, metastasis, invasion and drug resistance. UCA1 mediates cetuximab resistance in colorectal cancer through MiR-495 and HGF / c-MET pathways; in pancreatic cancer, UCA1 regulates tumor growth and metastasis by adsorbing miR-135a; UCA1 promotes the migration and invasion of pancreatic cancer cells through the Hippo signaling pathway; UCA1 in circulating blood can be used as a potential diagnostic biomarker for early colorectal cancer. SUMMARY

[0006] In view of the above technical problems in the prior art, the present application provides a long non-coding RNA gene and its small interfering RNA for use in the preparation of a drug for inhibiting triple-negative breast cancer. The long non-coding RNA gene and its small interfering RNA for use in the preparation of a drug for inhibiting triple-negative breast cancer solve the technical problem of poor effect of existing drugs for treating triple-negative breast cancer.

[0007] The present application provides a long non-coding RNA gene, the nucleotide sequence of which is as follows:

[0008] CAUGCUUCCAAGCAGGCUUCAUCCGUUCCUCUGGACCCUCAUCUCUUAAGACCUGCCGCCUAUAAAAAGGAUUAUAUCUUGAGACCCUAUCCUCUAAAAUUUUUUCCACACCCAAAACAAAAAAUCUCUGGGUCAAAAGUCUAAAACGCUUAGGCUGGCAACCAUCAGAUCCUUGCCCAUGGUGUCCUCAAGCCUACUCUCAUGAAAUGGACAACAGUACACGCAUAUGGGGCCAGUUCCACAUAUUUGGCAACCAGACCAGCAUCCAGGACAACACAAAGUAUGUUGUUUGUUGUUAGAGGGCUUGGGACAUUUCACUCUUUGCCAGCCUCAGCUUAAUCCAGGAGACAAAGAUUAUUUUCCUUAUUAUCUCUUCUGCAUAGGAUCUGCAAUCAGAACUAUUGAACUUCUCCAUUCAGACCGCCACUCACACCUAUGGGAAAAGGGUGUCCACGCAGUCCCUGGUCACACUUGAAGCAGUCCGGAGAAAUAUCAGCCCUACCCCAGUAAUCCCCAGAAGGAACUUACACUUUUUUUUAAUCUUUUCCUACAACUUCAUAUUUUAUAAAUAAAAAGACAAAAAUGUCAGGCCUGUGAGCUGAAGCUUAGCCAUUGUAACCCCUGUGACCUGCACAUAUCCGUCCAGGUGGCCUGCAGGAGCCAAGAAGUCUGGAGCAGCCGAAAAACCACAAAGAAGUGAAACAGCCAGUUCCUGCCUUAACUAAUUAACCCACCUUACGACAUUCCACCAU (SEQ ID NO. 1).

[0009] The long-chain non-coding RNA gene provided by the present application is a new mRNA sequence, and the transcript is located at human chromosome 19 15834835-15835859, has a length of 752 bp, cannot encode protein, and belongs to long-chain non-coding RNA. The new gene is homologous to the UCA1 gene, belongs to different spliceosomes, and is defined as UCA1-Short isoform, abbreviated as UCA1-S.

[0010] The application further provides a small interfering RNA si-UCA1-S of the UCA1-S, and the nucleotide sequence of the small interfering RNA si-UCA1-S is as follows:

[0011] 5' GGAAAAGGGUGUCCACGCAGUC 3' (SEQ ID NO. 2).

[0012] The application further provides the use of the siRNA in the preparation of a drug for treating triple-negative breast cancer.

[0013] The application further provides an expression vector containing the small interfering RNA si-UCA1-S of the UCA1-S.

[0014] Further, the expression vector is selected from any one of a plasmid, an adeno-associated virus and a retrovirus vector.

[0015] The application further provides a pharmaceutical composition containing the small interfering RNA si-UCA1-S of the UCA1-S as an active ingredient.

[0016] The application further provides the use of the pharmaceutical composition in the preparation of a drug for treating triple-negative breast cancer.

[0017] The application further provides the use of a reagent for detecting the long non-coding RNA gene in the preparation of a kit for diagnosing triple-negative breast cancer.

[0018] The application further provides the use of the long non-coding RNA gene as a therapeutic target in the screening of a drug for treating triple-negative breast cancer.

[0019] Endogenous siRNA is usually processed from long double-stranded RNA (dsRNA) and plays an important role in resisting virus invasion and silencing transposons, and siRNA regulates the expression of genes in cells through a phenomenon known as RNA interference (RNAi).

[0020] siRNA can be produced through the following processes: double-stranded RNA intermediates are produced when RNA viruses replicate in cells, and inverted repeat sequences are transcribed from transposons (movable genetic elements) in genomes to form double-stranded hairpin structure RNA. Dicer enzyme (a ribonuclease III) cuts long dsRNA into 21-23 bp (base pairs) double-stranded small fragments in an ATP-dependent manner, and the two ends have 2 nt 3' end overhangs (usually uracil U), namely siRNA.

[0021] The siRNA duplex binds to Argonaute (Ago) protein to form a core RISC complex. Then the siRNA is separated into two single strands: the guide strand and the passenger strand; finally, the passenger strand is degraded and the guide strand binds to the target mRNA through base complementary pairing. The Ago protein has endonuclease activity and cuts the target mRNA at the position corresponding to the 10th-11th base pair of the siRNA. The cut mRNA is quickly removed by the cell degradation mechanism (such as exonuclease). By causing RNAi in cells through siRNA, the abnormally high expression of genes in cells can be regulated to return to normal levels, and the abilities of tumor cells such as proliferation, apoptosis, metastasis, and drug resistance can be affected.

[0022] The present application provides a long non-coding RNA gene UCA1-S that can be used as a breast cancer prediction target and a small interfering RNA si-UCA1-S with anti-tumor function. The "siRNA" described herein refers to a class of RNA molecules, mainly derived from RNA viruses and inverted repeat sequences transcribed from transposons in the genome, or chemically synthesized in vitro.

[0023] The siRNA described in the present application refers to: si-UCA1-S cluster small interfering RNA, wherein the si-UCA1-S cluster small interfering RNA is selected from the group consisting of: (1) si-UCA1-S class small interfering RNA (2) modified si-UCA1-S derivatives; or small interfering RNAs or modified siRNA derivatives with the same or substantially the same function as si-UCA1-S;

[0024] The present application also includes siRNA variants and derivatives. In addition, siRNA derivatives in a broad sense can also include siRNA variants. Those skilled in the art can use common methods to modify the si-UCA1-S cluster, and the modification methods include (but are not limited to): phosphate backbone modification, ribose modification, base modification, end modification, backbone substitution modification, etc.

[0025] Polynucleotide construct:

[0026] According to the siRNA sequence provided by the present application, a polynucleotide construct that can be processed to affect UCA1-S after being introduced can be designed, that is, the polynucleotide construct can down-regulate the amount of corresponding UCA1-S in vivo. Therefore, the present application provides an isolated polynucleotide (construct) which can be transcribed into a single-stranded RNA by human cells, and the single-stranded RNA can express the siRNA described in the present application in human cells.

[0027] The polynucleotide construct contains the following hairpin structure:

[0028] 5'-phosphate group 3'-hydroxyl (with 2 nt overhang)

[0029]

[0030] 5'-[antisense strand] 3'

[0031] 3'-[sense strand] 5' (overhang is usually UU or UU)

[0032]

[0033] 3'-hydroxyl 5'-phosphate group

[0034] Typically, the polynucleotide construct is located on an expression vector. Accordingly, the present application also includes a vector comprising the siRNA, or the polynucleotide construct. The expression vector typically further comprises a promoter, an origin of replication, and / or a marker gene, etc. Methods well known to those skilled in the art can be used to construct the expression vector required by the present application. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. The expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as kanamycin, gentamycin, hygromycin, ampicillin resistance.

[0035] As used herein, the term "active ingredient" refers to an si-UCA1-S cluster, an si-UCA1-S cluster derivative, or a precursor sequence thereof, or an expression vector containing the same, which can be used in the present application. Preferably, the active ingredient is selected from the group consisting of:

[0036] (a) an si-UCA1-S class small interfering RNA,

[0037] wherein the si-UCA1-S class small interfering RNA is selected from the group consisting of:

[0038] (a1) an si-UCA1-S class small interfering RNA;

[0039] (a2) a modified si-UCA1-S class non-coding small RNA derivative; or a small interfering RNA or a modified RNAi derivative having the same or substantially the same function as the si-UCA1-S class small interfering RNA;

[0040] (b) a small interfering RNA precursor which can be processed into the si-UCA1-S cluster small interfering RNA described in (a) in a host;

[0041] ​​(c) an expression vector containing the si-UCA1-S small interfering RNA of (a); or the small interfering RNA precursor of (b); or the polynucleotide of (c);

[0042] The present application finds that UCA1-S is significantly highly expressed in triple negative breast cancer cells through experiments; cell in vitro experiments confirm that overexpression of UCA1-S promotes the proliferation, migration and invasion of triple negative breast cancer cells; animal in vivo experiments confirm that overexpression of UCA1-S promotes the growth of breast tumors in triple negative breast cancer tumor-bearing mouse models. Cell in vitro experiments confirm that knockdown of UCA1-S can inhibit the proliferation, migration and invasion of triple negative breast cancer cells; animal in vivo experiments confirm that knockdown of UCA1-S can inhibit the growth and lung metastasis of breast tumors in triple negative breast cancer tumor-bearing mouse models. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 An electrophoretogram showing the RNA fragments of 5' and 3' ends of UCA1-S and full-length identification.

[0044] Figure 2 It is shown that UCA1-S is significantly highly expressed in triple negative breast cancer cells with high malignancy.

[0045] Figure 3 It is shown that overexpression of UCA1-S can significantly promote the proliferation ability of triple negative breast cancer cells.

[0046] Figure 4 It is shown that overexpression of UCA1-S can significantly promote the migration ability of triple negative breast cancer cells.

[0047] Figure 5 It is shown that overexpression of UCA1-S can significantly promote the invasion ability of triple negative breast cancer cells.

[0048] Figure 6 It is shown that overexpression of UCA1-S significantly promotes the breast tumor growth ability of triple negative breast cancer tumor-bearing mice.

[0049] Figure 7 It is shown that targeted inhibition of UCA1-S can significantly reduce the proliferation ability of triple negative breast cancer cells.

[0050] Figure 8 It is shown that targeted inhibition of UCA1-S can significantly reduce the migration ability of triple negative breast cancer cells.

[0051] Figure 9 It is shown that targeted inhibition of UCA1-S can significantly reduce the invasion ability of triple negative breast cancer cells.

[0052] Figure 10It is shown that targeted inhibition of UCA1-S can significantly reduce the growth of breast tumors in triple-negative breast cancer tumor-bearing mice.

[0053] Figure 11 It is shown that targeted inhibition of UCA1-S can significantly reduce the lung metastasis of breast tumors in triple-negative breast cancer tumor-bearing mice. DETAILED DESCRIPTION

[0054] The present application is further described in conjunction with the following specific examples. It should be understood that these examples are intended to illustrate the present application and are not intended to limit the scope of the present application. The experimental procedures in the following examples, unless otherwise specified, are generally performed according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are percentages by weight and parts by weight.

[0055] In the present application, the materials used in the examples are commercially available unless otherwise specified. Example 1

[0056] Through extensive and in-depth research, the present application has for the first time discovered a new transcript UCA1-S of UCA1 that has never been reported before, and identified the full-length sequence thereof, the nucleotide sequence of which is shown as SEQ ID NO. 1, with a length of 752 bp, located at 15834835 to 15835859 of chromosome 19.

[0057] In the amplification experiment for the UCA1 gene, the present inventors unexpectedly obtained a sequence fragment with high homology to UCA1. After sequencing analysis of the short fragment, it was found that, compared with the standard UCA1 sequence, there was a partial sequence deletion in the middle region of the fragment. Further search and comparison in the NCBI database failed to find a known sequence record matching it. Based on the above experimental results and database search, the present inventors reasonably speculated that the fragment was most likely a new type of long non-coding RNA (LncRNA) variant produced by selective splicing mechanism of UCA1.

[0058] In order to further explore the biological characteristics and functional mechanism of the splice variant, the complete full-length sequence information of the splice variant needs to be determined first. In view of this, the inventors of the present application design and implement a rapid amplification of cDNA ends (RACE) experiment based on the partial sequence of the variant obtained, and successfully obtain the sequence information of the 5' end and 3' end of the variant. Subsequently, the obtained sequence is accurately spliced by using bioinformatics means, and finally the full-length sequence of the UCA1 alternative splicing variant is determined completely. The new gene is homologous to the UCA1 gene and belongs to different splicing bodies, and it is defined as UCA1-Short isoform, which is abbreviated as UCA1-S.

[0059] Experimental methods

[0060] 1. UCA1-S full-length identification

[0061] 1) The TRIzol method was used to extract high-quality total RNA of breast cancer cells (MDA-MB-231, purchased from ATCC) in a good growth state, and DNase I was used to remove residual genomic DNA.

[0062] 2) Reverse transcription to synthesize first-strand cDNA

[0063] 5'-RACE: 5'-CDS primer, SMARTer II A Oligo, reverse transcriptase, RNase inhibitor, and buffer were added for reverse transcription reaction, and the product was diluted with buffer for standby.

[0064] 3'-RACE: 3'-CDS primer Oligo(dT), reverse transcriptase, RNase inhibitor, and buffer were added for reverse transcription reaction, and the product was diluted with buffer for standby.

[0065] 3) PCR amplification

[0066] 5'-RACE:

[0067] First round of PCR:

[0068] 5' end primer: adapter universal primer; 3' end primer: gene-specific outer primer (GSP1); template: diluted product in step two.

[0069] Second round of PCR:

[0070] 5' end primer: adapter universal primer; 3' end primer: gene-specific inner primer (GSP2, located inside GSP1); template: diluted product of the first round of PCR.

[0071] 3'-RACE:

[0072] First round of PCR:

[0073] 5' end primer: gene-specific outer primer (GSP1); 3' end primer: adaptor universal primer; template: diluted product in step two.

[0074] Second round of PCR:

[0075] 5' end primer: gene-specific inner primer (GSP2); 3' end primer: adaptor universal primer; template: diluted product of the first round of PCR.

[0076] 5' GSP1: ACTGCGTGGACACCCTTTTCC (SEQ ID NO. 3);

[0077] 5' GSP2: CCCATAGGTGTGAGTGGCG (SEQ ID NO. 4);

[0078] 3' GSP1: CTCCATTCAGACCGCCACTC (SEQ ID NO. 5);

[0079] 3' GSP2: GAAAAGGGTGTCCACGCAGTC (SEQ ID NO. 6).

[0080] 4) Product analysis and sequencing

[0081] The second PCR product was detected by agarose gel electrophoresis, and the gel of the expected size band was cut and purified using a commercial DNA gel recovery kit (Tiangen, DP204-03). The purified product was cloned into a T vector and sequenced using the universal primer T7.

[0082] 5) Design primers and clone full-length sequence

[0083] Based on the cloned product, specific forward and reverse primers were designed, and the PCR product was detected by gel electrophoresis. After purification and recovery of the full-length product, it was cloned into a T vector for sequencing verification. After combining with the previous 5'-RACE and 3'-RACE products, the sequence was aligned to determine whether it matched.

[0084] 2. UCA1-S quantitative detection

[0085] 1) Total RNA was extracted from well-grown breast cancer cells (MDA-MB-231, purchased from ATCC) using the TRIzol method.

[0086] 2) Using a commercially available reverse transcription kit (Novozyme, R333-01), 1 μg of total RNA was used as a template to synthesize the first strand of cDNA.

[0087] 3) Using the cDNA synthesized in step 2 as a template, the UCA1-S expression was detected by using a commercially available fluorescent quantitative kit (ABI, A25742) and a real-time fluorescent quantitative PCR instrument (ABI QuantStudio 7 Flex). The UCA1-S detection primer sequence is:

[0088] 5' tttgccagcctcagcttaat 3' (SEQ ID NO. 7);

[0089] 5' ttgtccccattttccatcat 3' (SEQ ID NO. 8).

[0090] Conclusion: UCA1-S is significantly highly expressed in triple-negative breast cancer cells Figure 2 .

[0091] 3. Construction of UCA1-S overexpression MDA-MB-231 stable strain

[0092] 1) The total RNA of breast cancer cells (MDA-MB-231, purchased from ATCC) in good growth state was extracted by using TRIzol method.

[0093] 2) Using a commercially available full-length reverse transcription kit (Novozyme, R312-01), 1 μg of total RNA was used as a template to synthesize the first strand cDNA.

[0094] 3) Using the cDNA synthesized in step 2 as a template, PCR amplification was performed by using a commercially available high-fidelity DNA polymerase (Novozyme, p510). The amplified primers are:

[0095] F: 5' CATGCTTCCAAGCAGGCTTC 3' (SEQ ID NO. 9);

[0096] R: 5' ATGGTGGAATGTCGTAAGGTGG 3' (SEQ ID NO. 10).

[0097] 4) The PCR product was subjected to agarose gel electrophoresis, and the correct size (752 bp) bright band was cut under the ultraviolet lamp, and the DNA was purified by using a commercially available gel recovery kit (Tiangen, DP214-03). The purified product was sent to a sequencing company to detect whether the amplified product was UCA1-S.

[0098] 5) The UCA1-S fragment was cloned into a lentiviral plasmid vector by using molecular cloning technology (linearized vector and target product ligation method).

[0099] 6) Using HEK-293T cells (purchased from ATCC) as packaging system, co-transfect helper plasmid pSPAX2 and pMD2.G respectively and vector plasmid PLVX-UCA1-S-puro containing target gene to produce lentivirus particles. After virus collection, titer detection and concentration treatment, the obtained lentivirus was used to infect MDA-MB-231 cells.

[0100] 7) After 48 hours of infection, positive cells were screened by puromycin.

[0101] 8) According to the method 2, the overexpression of UCA1-S was detected.

[0102] 4. Construction of MDA-MB-231 cell line stably knocking down UCA1-S

[0103] 1) Lentivirus vector PLKO.1-RNAi-UCA1-S-puro stably expressing knockdown of UCA1-S and control (constructed by GenePharma Company) were used.

[0104] 2) Using HEK-293T cells (purchased from ATCC) as packaging system, co-transfect helper plasmid pSPAX2 and pMD2.G respectively and vector plasmid PLKO.1-RNAi-UCA1-S-puro containing target gene to produce lentivirus particles. After virus collection, titer detection and concentration treatment, the obtained lentivirus was used to infect MDA-MB-231 cells. After 48 hours of infection, positive cells were screened by puromycin.

[0105] 3) According to the method 2, the knockdown efficiency of UCA1-S was detected.

[0106] 5. Breast cancer cell si-UCA1-S and control transfection

[0107] 1) According to the siRNA design principle, siRNA sequence specifically targeting UCA1-S was designed:

[0108] 5' GGAAAAGGGUGUCCACGCAGUC 3' (SEQ ID NO. 2).

[0109] 2) Logarithmic phase growth of MDA-MB-231 cells (purchased from ATCC) was plated in 6-well plates at a density of 1 x 10 5 cells per well, and when the cell confluence was 50-60%, transfection was performed.

[0110] 3) Taking a single culture well as an example, 100 μL Opti-MEM was used to dilute 10 μL 20 μmol si-UCA1-S or control, and gently inverted several times to mix, and then incubated at room temperature for 5 min.

[0111] 4)Add 12 μL HiPerFect transfection reagent to the mixture, mix gently and invert, and stand at room temperature for 15 min.

[0112] 5)Add the transfection complex to the 6-well culture plate, 100 μL / well, and mix gently.

[0113] 6)Place the cell plate in a 37℃, 5% CO2 incubator, and replace the fresh medium after 6-8 hours of transfection.

[0114] 7)After 24-48 hours of transfection, detect the knockdown efficiency by qPCR. Cells knocked down by UCA1-S are used for subsequent experiments.

[0115] 6. Cell proliferation detection (CCK8)

[0116] 1)After 24 hours of transfection of si-UCA1-S / NC in well-grown breast cancer cells (MDA-MB-231, purchased from ATCC), digest the cells and count them.

[0117] 2)Adjust the cell suspension concentration, add 100 μL per well, and plate to make the cell density 3000 cells / well, a total of 4 96-well plates (0 h, 24 h, 48 h, 72 h).

[0118] 3)Incubate in a 5% CO2, 37℃ cell incubator, and measure the cell activity at 0 hours after the cells are cultured and adhered. Add 10 μL CCK8 reagent (Saint, SB-CCK8) to each well, mix gently, and continue to culture for 1-4 hours.

[0119] 4)Measure the absorbance of each well at OD 450 nm wavelength on an enzyme-linked immunodetection instrument.

[0120] 7. Cell invasion detection

[0121] 1)After 24 hours of transfection of well-grown breast cancer cells (MDA-MB-231, purchased from ATCC), starve the cells with FBS-free DMEM medium for 8 hours.

[0122] 2)Place the Matrigel on ice and thaw overnight at 4℃. Place the pipette or gun head in the 4℃ overnight.

[0123] 3)Mix the Matrigel and serum-free medium at a ratio of 1:8 using the pre-cooled pipette or gun head until they are evenly mixed. Take 60 μL of the mixed solution and add it vertically to the Transwell chamber, making sure it is evenly spread on the bottom. Be careful not to create bubbles. Then incubate in a 37℃, 5% CO2 incubator for 1-3 hours.

[0124] 4) Digest the cells, centrifuge to discard the culture medium after digestion, wash 1-2 times with PBS, resuspend the cells with serum-free medium, and count.

[0125] 5) Take 6x10 4 cells and dilute them into 200 μL of serum-free medium, slowly add them to the upper chamber of the Transwell.

[0126] 6) Add 500 μL of medium containing 10% FBS to the lower chamber of the 24-well plate, and culture normally for 12-24 h.

[0127] 7) After aspirating the upper medium, fix the chamber with 4% paraformaldehyde, incubate at room temperature for 20 min, wash 3 times with PBS, stain with 0.5% crystal violet, and wipe off the excess crystal violet with a cotton swab.

[0128] 8) Collect images using an inverted microscope and count.

[0129] 8. Wound healing method for detecting cell migration ability

[0130] 1) After 24 h of transfection of well-grown breast cancer cells (MDA-MB-231, purchased from ATCC), starve the cells with FBS-free DMEM medium for 8 h.

[0131] 2) After starvation, remove the cells from the incubator, operate on the clean bench, position the scratch, remove the medium, and gently wash twice with PBS, and remove all floating cells.

[0132] 3) Take 0 h as the time when the scratch is made, and collect images at 0, 24, and 48 h using an inverted microscope.

[0133] Conclusion: Overexpression of UCA1-S can significantly promote the proliferation, migration, and invasion of triple-negative breast cancer cells in vitro ( Figure 3 , Figure 4 , Figure 5 ); knockdown of UCA1-S can effectively inhibit the proliferation, migration, and invasion of triple-negative breast cancer cells in vitro ( Figure 7 , Figure 8 , Figure 9 ).

[0134] 9. Animal experiments

[0135] 1) Preparation of breast cancer tumor-bearing animal model: 4-6-week-old immunodeficient female nude mice were purchased from Shanghai Slake Experimental Animal Company. Inject 5x10 5 or more breast cancer cells subcutaneously into the fourth pair of mammary fat pads of the immunodeficient mice to prepare a breast cancer model.

[0136] 2) Tumor growth record and subsequent analysis: After one week of cell injection (MDA-MB-231 cell line with UCA1-S knockdown or MDA-MB-231 stable strain with UCA1-S overexpression), the mice were observed daily, and the health, diet, and tumor initiation date of the mice were recorded. The tumor size was measured every other day with a vernier caliper, and the mice were continuously observed and recorded for 5 weeks. The tumor growth curve was plotted. Finally, the mice were sacrificed, and the tumor tissue was collected by dissection, along with the lung, brain, and other tissues. The tumor volume and weight were measured, and the protein, RNA, and formaldehyde fixation were extracted.

[0137] Conclusion: Overexpression of UCA1-S can significantly promote the growth of triple-negative breast cancer in vivo ( Figure 6 ); knockdown of UCA1-S can effectively inhibit the growth of triple-negative breast cancer and lung metastasis in vivo ( Figure 10 , Figure 11 ).

Claims

1. A long non-coding RNA gene, characterized in that, The nucleotide sequence is shown as SEQ ID NO.

1.

2. A small interfering RNA, characterized in that The nucleotide sequence is shown as SEQ ID NO.

2.

3. Use of the small interfering RNA of claim 2 in the preparation of a medicament for treating triple negative breast cancer.

4. An expression vector, characterized by, The small interfering RNA of claim 2.

5. The expression vector of claim 4, wherein, The expression vector is selected from any one of plasmid, adeno-associated virus or retrovirus vector.

6. A pharmaceutical composition, characterized by, The small interfering RNA of claim 2 is used as an active ingredient.

7. Use of the pharmaceutical composition of claim 6 in the preparation of a medicament for treating triple negative breast cancer.

8. Use of the reagent for detecting the long non-coding RNA gene of claim 1 in the preparation of a kit for diagnosing triple negative breast cancer.

9. Use of the long non-coding RNA gene of claim 1 as a therapeutic target in the screening of a medicament for treating triple negative breast cancer.

10. An isolated polynucleotide, comprising: The polynucleotide can be transcribed into single-stranded RNA by human cells, and the single-stranded RNA can be expressed into the small interfering RNA of claim 2 in human cells.

Images