Method for constructing lonicera maackii evm0006705 gene vigs silencing vector and application thereof

By constructing a VIGS silencing vector for the phytoene dehydrogenase EVM0006705 gene of Lonicera japonica, effective silencing of Lonicera japonica gene function research was achieved, solving the genetic transformation problem and providing technical support for gene function verification.

CN121109435BActive Publication Date: 2026-02-06BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511667922.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-02-06
Estimated Expiration
2045-11-14

AI Technical Summary

Technical Problem

The genetic transformation system of honeysuckle is not yet mature, which limits gene function research. In particular, the PDS gene and its coding sequence are unclear, which hinders the application of VIGS technology in this species.

Method used

A VIGS silencing vector for the phytoene dehydrogenase EVM0006705 gene of Lonicera japonica was constructed. Specific primers were designed to amplify the gene and perform homologous recombination with the vector. Lonicera japonica leaves were then infected with RNA virus vectors such as tobacco brittle virus (TRV). Phenotypic changes and gene expression levels were observed to achieve gene silencing.

Benefits of technology

Successfully silencing the EVM0006705 gene in Lonicera japonica resulted in leaf bleaching and a significant reduction in chlorophyll content, providing technical support for gene function verification and overcoming the difficulties of genetic transformation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109435B_ABST
    Figure CN121109435B_ABST
Patent Text Reader

Abstract

The application provides a method for constructing a Lonicera maackii EVM0006705 gene VIGS silencing vector and application. The gene has a nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence complementary to SEQ ID NO:1. The gene provided by the application can be used for constructing a virus silencing system, so that the Lonicera maackii EVM0006705 gene is silenced in a Lonicera maackii plant.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, in particular to a method for constructing a VIGS silencing vector of Lonicera maackii EVM0006705 gene and application. BACKGROUND

[0002] Lonicera maackii is a deciduous shrub of Caprifoliaceae Lonicera genus, which has unique flower color dynamic changes. The flowers are white at the beginning, and then gradually turn into golden yellow. After the flowers wither, the branches bear dense red berries, which greatly enhances the ornamental value. In addition, Lonicera maackii is rich in various natural active ingredients, such as chlorogenic acid, flavonoids, anthocyanins, etc. These ingredients endow the plant with significant antioxidant, anti-inflammatory and antibacterial potential, and have broad prospects for medicinal development. However, a mature genetic transformation system of Lonicera maackii has not been established yet, making it difficult to carry out in-depth research on the function of related genes. Therefore, developing an efficient and fast gene function verification method is of great significance for promoting the molecular breeding of Lonicera maackii and the biosynthesis of its medicinal ingredients.

[0003] Virus-induced gene silencing (VIGS) is a technology based on post-transcriptional gene silencing mechanism, which has the advantages of simple operation, short cycle and no need for stable genetic transformation. It has been widely used in tobacco, Arabidopsis, pepper, oil tea and other plants, and has become one of the important tools in gene reverse genetics research. Phytoene desaturase (PDS) is a key enzyme in the carotenoid biosynthesis pathway, and its silencing will lead to blocked carotenoid synthesis and degraded chlorophyll, thus causing albino phenotype, which is easy to observe, so it is often used as a reporter gene to establish VIGS system. At present, the research on gene function of Lonicera maackii is relatively lagging behind, and its PDS gene and coding sequence are not clear, which limits the application and development of VIGS technology in this species. SUMMARY

[0004] The present application aims to provide a method for constructing a VIGS silencing vector of Lonicera maackii EVM0006705 gene and application. The gene provided by the present application can be used to construct a viral silencing system, so that the Lonicera maackii phytoene desaturase EVM0006705 gene is silenced in Lonicera maackii plants. The LmPDS gene silencing plant constructed by the present application has a significantly reduced expression level of LmPDS gene in the leaves, and the contents of chlorophyll a, chlorophyll b and total chlorophyll all decrease obviously, accompanied by leaf whitening. It can be used for subsequent verification of the function of target genes of Lonicera maackii, effectively overcoming the problem of difficult genetic transformation of Lonicera maackii, and providing important technical support for the functional analysis of key genes.

[0005] Specifically, the present application provides the following technical solutions.

[0006] The first aspect of the present application provides a Lonicera maackii phytoene dehydrogenase EVM0006705 gene, which has a nucleotide sequence as shown in SEQ ID NO:1 or a nucleotide sequence complementary to SEQ ID NO:1.

[0007] The second aspect of the present application provides a Lonicera maackii phytoene dehydrogenase EVM0006705 protein, which has an amino acid sequence as shown in SEQ ID NO:2.

[0008] The third aspect of the present application provides a target sequence of the Lonicera maackii phytoene dehydrogenase EVM0006705 gene, which has a nucleotide sequence as shown in SEQ ID NO:3.

[0009] The fourth aspect of the present application provides a recombinant vector, which comprises the Lonicera maackii phytoene dehydrogenase EVM0006705 gene according to the first aspect or the target sequence according to the third aspect.

[0010] The fifth aspect of the present application provides a recombinant cell comprising the recombinant vector according to the fourth aspect.

[0011] The sixth aspect of the present application provides a recombinant engineering bacterium comprising the recombinant vector according to the fourth aspect. The recombinant engineering bacterium can be Agrobacterium.

[0012] The seventh aspect of the present application provides an infection solution for silencing the Lonicera maackii phytoene dehydrogenase EVM0006705 gene according to the first aspect, which comprises the recombinant engineering bacterium according to the sixth aspect.

[0013] The eighth aspect of the present application provides a method for constructing a VIGS silencing vector of the Lonicera maackii phytoene dehydrogenase EVM0006705 gene, comprising the following steps.

[0014] (1) designing specific homologous amplification primers with restriction enzyme cutting sites according to the target sequence of the third aspect, and amplifying PCR products by using the primers;

[0015] (2) performing homologous recombination on the PCR products and the vectors subjected to the restriction enzyme cutting, so as to obtain the VIGS silencing vector of the Lonicera maackii EVM0006705 gene.

[0016] According to an embodiment of the present application, the vector is selected from at least one of RNA viral vectors, DNA viral vectors. The available RNA viral vectors include but are not limited to tobacco rattle virus (TRV) vector, barley stripe mosaic virus (BSMV, for monocotyledonous plants), apple latent spherical virus (ALSV, for Rosaceae fruit trees), etc. The available DNA viral vectors include but are not limited to geminivirus vectors (such as tomato leaf curl virus ToLCV, yellow leaf curl virus TYLCV): suitable for solanaceous and cruciferous crops (such as Chinese cabbage). Among them, the tobacco rattle virus (TRV) vector is the most commonly used VIGS vector, which includes a binary system (pTRV1 and pTRV2). pTRV1 encodes a viral replicase, and pTRV2 carries a target gene fragment, which are used together.

[0017] The first aspect of the present application provides a method for silencing the Lycopene dehydrogenase EVM0006705 gene of Lonicera maackii described in the first aspect, comprising

[0018] The infection solution described in the seventh aspect is injected into the leaves of Lonicera maackii with a needleless syringe, and after dark culture, it is converted to culture under light / dark cycle;

[0019] Observe the phenotypic changes of the plants and / or detect the expression amount of the EVM0006705 gene in the plants by PCR; if the leaves of the plants are significantly yellow or the expression amount of the EVM0006705 gene in the plants is significantly reduced, it indicates that the Lonicera maackii plant with EVM0006705 gene silencing is obtained. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 It is a cloning gel electrophoresis map of the Lonicera maackii lycopene dehydrogenase EVM0006705 gene specific fragment provided according to an embodiment of the present application.

[0021] Figure 2 It is a Lonicera maackii leaf phenotype map of the VIGS silenced strain provided according to an embodiment of the present application.

[0022] Figure 3 It is a result map of PCR detection of successful introduction of pTRV vector and pTRV-EVM0006705 into Lonicera maackii leaves according to an embodiment of the present application.

[0023] Figure 4 It is a relative expression amount verification result map of the EVM0006705 gene of the Lonicera maackii leaf of the VIGS silenced strain according to an embodiment of the present application.

[0024] Figure 5 It is a Lonicera maackii leaf chlorophyll a, chlorophyll b and total chlorophyll content result map of the VIGS silenced strain according to an embodiment of the present application. DETAILED DESCRIPTION

[0025] Embodiments of the present application are described in detail below with reference to examples illustrated in the accompanying drawings, the embodiments described below are exemplary, and are intended to explain the present application, and cannot be understood as a limitation of the present application.

[0026] The present application provides a nucleotide sequence encoding Lonicera maackii phytoene dehydrogenase EVM0006705 protein, which has the nucleotide sequence shown in SEQ ID NO: 1.

[0027] The nucleotide sequence of the Lonicera maackii phytoene dehydrogenase EVM0006705 gene is shown as SEQ ID NO: 1:

[0028]

[0029] The application further provides a Lonicera maackii phytoene dehydrogenase EVM0006705 protein, which has the amino acid sequence shown in SEQ ID NO: 2.

[0030] The amino acid sequence of the Lonicera maackii phytoene dehydrogenase EVM0006705 protein is shown in SEQ ID NO. 2.

[0031] MSQFGHVSVVNLTGQSNIINLWNPQSTWRRGSGQTHVLSFRDGDYMGPRLEFRTTQATNTRSRKGVSPLKVVCIDYPRPELDNTVNYLEAAYFSSSFQTAPRPNKPLEIVIAGAGLAGLSTAKYLADAGHKPILLEARDVLGGKVAAWKDDDGDWYETGLHIFFGAYPNIQNLFGELGINDRLQWKEHSMIFAMPNKPGQFSRFDFPEVLPAPINGIWAILKNNEMLTWPEKIKFAIGLLPAILGGQAYVEAQDGLSVKEWMKSRYFGIPERVTTEVFIAMSKALNFINPDELSMQCILIALNRFLQEKHGSKMAFLDGSPPERLCKPIVDHIQSLGGQVRLNSRIQKIDLNQDGTVKRFILSNGDVIKGDAYVIAAPVDILKLLLPEDWKEIPYFRKLDKLVGVPVINVHIWFDRKLKNTYDHLLFSRSSLLSVYADMSVTCKEYYDPNKSMLELVFAPAEEWITRSDSDIIDATMNELARLFPDEISADQSKAKILKYHVVKTPRSVYKTVPNCEPCRPLQRSPIEGFYLSGDYTKQKYLASMEGAVLSGKLCAQAIIQDYEKLVAREQKMLAEASLV (SEQ ID NO: 2).

[0032] The application further provides a target sequence of the lonicera maackii phytoene dehydrogenase EVM0006705 gene, which has the nucleotide sequence shown in SEQ ID NO: 3. The target sequence is a specific sequence selected from the complete sequence of the lonicera maackii EVM0006705 gene and used for constructing a silencing vector. For the VIGS technology, the full length of the whole gene does not need to be inserted into the viral vector. A specific fragment (usually 200-500 base pairs long) of the gene is sufficient to enable the plant RNAi mechanism to recognize and silence the whole complete gene. The sequence is a unique sequence selected and only exists in the EVM0006705 gene, and is not similar to any other gene in the lonicera maackii genome, so as to avoid “off-target”. In this way, it is ensured that the viral vector only guides the cell to silence the “target” gene EVM0006705, and does not mistakenly silence other unrelated genes (this phenomenon is called “off-target effect”). Moreover, the sequence should be a part of the gene that is stably expressed in the cell, so as to be effectively recognized and utilized by the cell's gene silencing mechanism, and ensure the silencing efficiency.

[0033] ATGTCTCAATTTGGACATGTCTCAGTAGTTAACCTGACCGGCCAAAGTAATATAATAAACCTTTGGAACCCACAATCTACTTGGAGACGTGGTTCAGGACAAACACATGTGCTATCATTTAGAGATGGTGATTATATGGGTCCTAGATTGGAATTTCGAACCACACAAGCTACTAATACAAGATCCAGGAAGGGTGTCTCCCCTTTGAAGGTGGTTTGCATTGATTATCCAAGACCAGAACTGGACAACACTGTCAATTATTTAGAAGCTGCTTACTTCTCGTCGTCCTTCCAAACTGCT (SEQ ID NO: 3).

[0034] The application further provides a method for constructing a lonicera maackii phytoene dehydrogenase EVM0006705 gene VIGS silencing vector, comprising the following steps:

[0035] (1) designing specific homologous amplification primers with Xba I and Kpn I restriction enzyme cutting sites according to the target sequence; then amplifying the PCR product by using the primers; according to the specific embodiments, the restriction enzyme cutting sites can be Xba I and Kpn I restriction enzyme cutting sites;

[0036] (2) homologous recombination of the PCR product with a vector with the same restriction enzyme site to obtain a VIGS silencing vector of the Lonicera maackii phytoene dehydrogenase EVM0006705 gene.

[0037] The present application also provides a VIGS vector and / or an engineering bacterium containing the EVM0006705 gene fragment described above.

[0038] The present application also provides an infection liquid for silencing the EVM0006705 gene described above, wherein the infection liquid comprises the engineering bacterium described above.

[0039] The present application also provides a method for silencing the Lonicera maackii phytoene dehydrogenase EVM0006705 gene, comprising the following steps:

[0040] The infection liquid is injected into the Lonicera maackii leaf through a needleless syringe on the back of the Lonicera maackii leaf, and after incubation in the dark for a predetermined time, the incubation is switched to a 16h light / 8h dark cycle; according to the specific embodiment, the light / dark cycle mentioned can be 16h light / 8h dark.

[0041] The phenotype change of the plant is observed and / or the expression amount of the EVM0006705 gene in the plant is detected through PCR. If the leaves of the plant are significantly yellow or the expression amount of the EVM0006705 gene in the plant is significantly reduced, it is indicated that the Lonicera maackii plant with the EVM0006705 gene silenced is obtained.

[0042] The technical solutions of the present application are described below through specific embodiments, and it should be noted that these embodiments are only used to facilitate the understanding of those skilled in the art and should not be regarded as a limitation on the protection scope of the present application. Unless otherwise specified, the reagents or materials used in the embodiments can be obtained by commercial purchase.

[0043] Example 1

[0044] Example 1 constructs a Lonicera maackii VIGS silencing expression vector pTRV2-EVM0006705. First, the nucleotide sequence SEQ ID NO. 1 encoding the Lonicera maackii phytoene dehydrogenase EVM0006705 gene is obtained by analysis. And according to the website https: / / vigs.solgenomics.net / , the database of Arabidopsis thaliana is used as a reference to design a target sequence, and the nucleotide sequence of the target sequence is shown as SEQ ID NO: 3, and the specific steps are as follows:

[0045] (1) Extraction of Lonicera maackii RNA

[0046] The roots, stems, leaves, flowers and fruits of Lonicera maackii were collected and ground in liquid nitrogen environment. Then the RNA was extracted according to the instructions of the plant total RNA extraction kit (RNeasy Plant mini Kit) of Tian Gen Biochemical Technology Co., Ltd.

[0047] (2) cDNA synthesis

[0048] First, the reverse transcription mixture was prepared according to the following system and placed in a 200 µL RNase free PCR tube; the system is shown in Table 1 as follows:

[0049] Table 1: Reverse transcription system

[0050]

[0051] The above reverse transcription system was mixed thoroughly, then incubated at 42℃ for 30 min; and heated at 85℃ for 5 s to inactivate TransScript RT / RI and gDNA Remover, thereby obtaining cDNA. The obtained cDNA was stored at -20℃. The reagents used in the reaction were all purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.

[0052] (3) Construction of vector pTRV2-EVM0006705

[0053] 1) According to SEQ ID NO: 3, the specific primer of EVM0006705 gene with Xba I and Kpn I restriction enzyme cutting site was designed, wherein the specific primer is as follows:

[0054] The upstream primer EVM0006705-F is 5'-GGTTACCGAATTCTCTAGAATGTCTCAATTTGGACATGT-3' (SEQ ID NO: 4);

[0055] The downstream primer EVM0006705-R is 5'-AGACGCGTGAGCTCGGTACCAGCAGTTTGGAAGGACGACG-3' (SEQ ID NO: 5).

[0056] Then, taking the Lonicera maackii cDNA sequence as a template, the PCR reaction system was used to amplify the Lonicera maackii phytoene dehydrogenase EVM0006705 sequence with enzyme cutting site, and the results are shown in Table 2 as follows: Figure 1

[0057] Table 2: PCR amplification system

[0058]

[0059] PCR reaction program is as follows:

[0060] Pre-denaturation: 98℃ 2 min; (denaturation: 98℃ 30 s, annealing: 58℃ 30 s, extension: 72℃ 1.5 min) x 35 cycles; extension: 72℃ 5 min; 4℃ preservation.

[0061] 2) The pTRV2 vector was digested with Xba I and Kpn I at 37℃ for 4h, and the amplified product and the digested product were purified by a recovery kit (Takara, China).

[0062] 3) The two fragments of step 1) and step 2) were mixed, and under the action of homologous recombination enzyme, the mixture was reacted at 50℃ for 15 min to obtain a ligation product. Then the ligation product was transformed into trans1-T1 yeast competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd., and the specific operation method and amount were referred to the instruction manual), and the transformed bacterial liquid was spread on LB solid medium containing 50ul / mL kanamycin. After the colonies grew, single colonies were picked and cultured in 700uL LB liquid medium containing 50ug / mL Kan at 37℃ for 6h. Positive clones were screened and sequenced to obtain the recombinant expression vector pTRV2-EVM0006705.

[0063] The preparation method of the LB liquid medium is as follows: 5 g of tryptone, 5 g of NaCl, and 2.5 g of yeast extract were weighed, and ddH2O was added to make the total volume 500 mL. Then it was sterilized by high-pressure steam at 121℃ for 20 min, and cooled to room temperature.

[0064] The preparation method of the LB solid medium is referred to the preparation method of the LB liquid medium, and 5g of agar powder was added before constant volume, and sterilized by high-pressure steam at 121℃ for 20 min, and cooled to room temperature.

[0065] Example 2

[0066] Example 2 prepared the agrobacterium infection solution according to the following method, including:

[0067] 1) The recombinant expression vectors pTRV2-EVM0006705, pTRV2 (empty control), and pTRV1 (auxiliary vector) were respectively transformed into agrobacterium GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd., and the specific operation steps were referred to the instruction manual).

[0068] 2) The three agrobacterium containing plant expression vectors pTRV2-EVM0006705, pTRV2, pTRV1 obtained in step 1) were inoculated into LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and incubated at 28°C, 200 rpm overnight until the OD600 value of the three agrobacterium was 0.8.

[0069] 3) The three agrobacterium in step 2) were collected into 50 mL centrifuge tubes, centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the bacterial cells were resuspended with the infection solution to obtain pTRV1 infection solution (OD600 0.8), pTRV2 infection solution (OD600 0.8), and pTRV2-EVM0006705 (OD600 0.8) infection solution, respectively.

[0070] The infection solution was LB liquid medium (5 g tryptone, 5 g NaCl, 2.5 g yeast extract, ddH2O was added to make the total volume 500 mL, 121°C high pressure steam sterilization for 20 min), and only contained 10 mM magnesium chloride, 10 mM 2-morpholinoethanesulfonic acid and 200 µM acetyl-syringone.

[0071] 4) The pTRV1 infection solution (OD600 0.8) in step 3) was mixed with the pTRV2 infection solution (OD600 0.8) and the pTRV2-EVM0006705 (OD600 0.8) infection solution at a volume ratio of 1:1, respectively, and stood in the dark for 3-4 h to obtain pTRV infection solution and pTRV-EVM0006705 infection solution, respectively, which were ready for use.

[0072] Example 3

[0073] Example 3 used agrobacterium injection to infect the leaves of Lonicera maackii, and then performed phenotype identification and detection of silencing efficiency. Specifically, it included:

[0074] 1) The harvested Lonicera maackii seeds were soaked in water and placed in a 4°C refrigerator for one week, and then transferred to a mixed substrate with a volume ratio of 3:1 of nutrient soil and vermiculite for cultivation. When the seedlings grew to have 8-10 leaves, the agrobacterium injection mediated leaf infection experiment was performed.

[0075] 2) Seedlings were randomly selected from plants that were growing well, developing uniformly, and free from obvious pests and diseases. They were divided into a control group (pTRV), an experimental group (pTRV-EMV0006705), and an untreated group (no treatment). Using a sterile, needle-free syringe, the infection solution prepared in step 4) of Example 2 was drawn and injected onto the underside of the leaves of both groups (control and experimental groups). Each group had 20 biological replicates (i.e., 20 plants). After injection, the plants were first cultured in darkness for 12 hours, and then transferred to a 25°C environment with a photoperiod of 16 hours light / 8 hours dark for further culture.

[0076] 3) After 15 days of cultivation, the phenotypic characteristics of the honeysuckle leaves in the experimental and control groups were identified, and the results were as follows: Figure 2 As shown (the experimental group shows three lines, designated as pTRV-EVM0006705-41, pTRV-EVM0006705-42, and pTRV-EVM0006705-31), compared with the control group and the untreated group, the leaves of the honeysuckle in the experimental group showed yellowing, indicating that the EVM0006705 gene was successfully silenced.

[0077] 4) Selected yellowed leaves from the control group, untreated group, and experimental group, and extracted genomic DNA using the CTAB method. PCR detection of TRV1 and TRV2 in the leaves of *Lonicera japonica* from the control group, untreated group, and experimental group was performed using the following primers:

[0078] pTRV1-F: 5'-CGTGTTGCATTTCGATGAAGCT-3' (SEQ ID NO: 6);

[0079] pTRV1-R: 5'-GCGACAACGCCACGATTAAGT-3' (SEQ ID NO:7);

[0080] pTRV2-F: 5'- TGTCAACAAAGATGGACATTGTTAC-3' (SEQ ID NO: 8);

[0081] pTRV2-R: 5'-AACCTAAAACAACAGACACGG-3' (SEQ ID NO: 9).

[0082] The results are as follows Figure 3 As shown. Among them. Figure 3 The left image in the figure shows the amplified TRV1 vector fragment. Compared with the untreated group, both the positive control group and the experimental group were able to amplify the TRV1 fragment, which was 527bp in size. Figure 3The middle-right graph is the fragment amplified on the TRV2 vector. Since the silencing fragment is inserted into the pTRV2 vector, the PCR products of the control and test group treated leaves are 213 bp and 513 bp, respectively, indicating that the pTRV1 vector and the pTRV2-EVM0006705 have been successfully introduced into the leaves of Lonicera maackii.

[0083] 5) Total RNA was extracted from the untreated group, control group and test group leaves, respectively, and reverse transcribed into cDNA. The relative expression amount of EVM0006705 gene was detected by qRT-PCR technology, with 18S as the internal reference gene. The primers used are as follows:

[0084] 18S-F: 5'-CAACCATAAACGATGCCGA-3' (SEQ ID NO: 10);

[0085] 18S-R: 5'-AGCCTTGCGACCATACTCC-3' (SEQ ID NO: 11);

[0086] qPCR-EVM0006705-F: 5'-GGAACCCACAATCTACTTGGAG-3' (SEQ ID NO: 12);

[0087] qPCR-EVM0006705-R: 5'-TGTTGTCCAGTTCTGGTCTTGG-3' (SEQ ID NO: 13).

[0088] The results are shown in Figure 4 Compared with the untreated group, the relative expression amount of EVM0006705 in the leaves of the test group of 3 strains of Lonicera maackii was significantly reduced by 57%, 85% and 59%, respectively. This indicates that the pTRV2 plant expression vector has played a role in the leaves of Lonicera maackii, achieving the silencing effect of EVM0006705 gene.

[0089] 6) About 0.15 g of Lonicera maackii leaves from the untreated group, test group and control group were weighed, respectively, and quickly and thoroughly ground using a high-throughput grinder. Acetone-anhydrous ethanol mixed extraction solution (volume ratio of acetone to anhydrous ethanol is 1:2) was added, and the leaves were extracted for 3 h in the dark. When the tissue residue was nearly white, it indicated that the extraction was complete. The spectrophotometer was preheated for more than 30 min, and the wavelength was adjusted to 645 nm and 663 nm. The extraction solution was zeroed. 700 µL of the upper extraction solution was taken into a 1 mL glass cuvette, and the absorbance values at 645 nm and 663 nm were measured, respectively, and recorded as A663 and A645, respectively. The contents of chlorophyll a, chlorophyll b and total chlorophyll were calculated using the following formula.

[0090] Chlorophyll a content (mg / g) = 0.01 × (12.7 × A) 663 -2.69×A 645 ) × dilution factor ÷ sample mass (g);

[0091] Chlorophyll b content (mg / g) = 0.01 × (22.9 × A) 645 -4.68×A 663 ) × dilution factor ÷ sample mass (g);

[0092] Total chlorophyll content (mg / g) = 0.01 × (20.21 × A) 645 +8.02×A 663 ) × dilution factor ÷ sample mass (g).

[0093] The results are as follows Figure 5 As shown (**** and *** indicate P < 0.0001), compared with the untreated group, the chlorophyll a, chlorophyll b, and total chlorophyll contents of the three experimental groups (pTRV-EVM0006705-41, pTRV-EVM0006705-42, and pTRV-EVM0006705-31) were significantly reduced. Specifically, chlorophyll a decreased by 47%, 42%, and 49%, respectively; chlorophyll b decreased by 40.6%, 40%, and 45.6%, respectively; and total chlorophyll content decreased by 45%, 41.8%, and 48.6%, respectively.

[0094] In summary, this invention successfully constructed a silencing system for the phytoene dehydrogenase EVM0006705 gene in Lonicera japonica, with a short experimental cycle, no need for genetic transformation, and overcoming the difficulties of genetic transformation of Lonicera japonica.

[0095] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A Lonicera maackii phytoene dehydrogenase gene, characterized by, EVM0006705 The nucleotide sequence of the gene is shown as SEQ ID NO:

1. ​ 2. A Lonicera maackii phytoene dehydrogenase EVM0006705 protein, characterized by, The amino acid sequence of the protein is shown as SEQ ID NO:

2.

3. A target nucleic acid molecule of Lonicera maackii phytoene dehydrogenase EVM0006705 gene, characterized in that, The nucleotide sequence of the target nucleic acid molecule is shown as SEQ ID NO:

3.

4. A recombinant vector, characterized in that, The recombinant vector comprises the Lonicera maackii phytoene dehydrogenase of claim 1 EVM0006705 gene, or the target nucleic acid molecule of claim 3.

5. A recombinant cell, characterized in that, The recombinant vector of claim 4.

6. A recombinant engineered bacterium, characterized in that, The recombinant vector of claim 4.

7. A method for silencing the phytoene dehydrogenase of honeysuckle as described in claim 1. EVM0006705 The gene-infecting solution is characterized by, The engineered bacteria of claim 6.

8. A method of constructing a Lonicera japonica phytoene dehydrogenase EVM0006705 gene VIGS silencing vector, characterized by, The method comprises the following steps: (1) designing homologous amplification primers with restriction enzyme cutting sites for specificity according to the target nucleic acid molecule of claim 3, SEQ ID NO: 4 and SEQ ID NO: 5, and using the primers to amplify a PCR product; (2) homologous recombination of the PCR product with a vector having the same restriction enzyme site to obtain Parthenocissus henryi phytoene dehydrogenase EVM0006705 VIGS silencing vector of the gene.

9. The method of claim 8, wherein, The vector is selected from at least one of an RNA virus vector and a DNA virus vector.

10. A method of silencing the Lonicera maackii phytoene dehydrogenase gene of claim 1, characterized by, EVM0006705 The method comprises the following steps: ​ injecting the inoculation liquid of claim 7 to the back of the leaves of Lonicera maackii, and culturing in the dark, then culturing under light / dark cycle; observing the phenotype change of the plant and / or detecting the expression amount of the EVM0006705 gene in the plant by PCR; if the leaves of the plant are significantly yellow or the expression amount of the EVM0006705 gene in the plant is significantly reduced, it indicates that the Lonicera maackii plant with EVM0006705 gene silencing is obtained.

Citation Information

Patent Citations

  • Rubber tree phytoene dehydrogenase gene VIGS silencing system, and construction method and application thereof

    CN111593065A

  • Honeysuckle VIGS silencing system

    CN117051037A