Compositions comprising polyribonucleotides and uses thereof

Abstract

The disclosure features compositions comprising a polyribonucleotide having one or more expression enhancing elements or spacer elements. The polyribonucleotides described herein can increase the stability of the polyribonucleotides and / or can increase the expression of a polynucleotide cargo encoded by the polyribonucleotides.

Description

Background Technology

[0001] Polynucleotides are readily degraded in cells, preventing their persistence and the potential expression of the therapeutic peptides they encode. This represents a major obstacle to the use of polynucleotides as potential therapeutic agents. Therefore, methods to increase the stability of polynucleotides and enhance the translation of their peptide cargoes remain needed. Summary of the Invention

[0002] In one aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) one or more expression-enhancing elements; (c) a polynucleotide cargo; and (d) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0003] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a polynucleotide cargo; (c) one or more expression-enhancing elements; and (d) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0004] In some embodiments, the one or more expression enhancing elements comprise a fusion of a translational enhancer and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the one or more expression enhancing elements comprise a translational enhancer. In some embodiments, the translational enhancer is derived from a plant virus. In some embodiments, the translational enhancer is derived from a mammalian virus. In some embodiments, the translational enhancer is a human translational enhancer. In some embodiments, the translation enhancer is selected from the group consisting of: BYDV-like elements (BTE), translation enhancer elements (TED), PMV / PEMV-like translation enhancers (PTE), I-shaped structures (ISS), Y-shaped structures (YSS), t-shaped structures (TSS), dumbbell-shaped structures, viral RNA UTRs (including dengue virus, West Nile virus, Zika virus, and rotavirus), EMCV, CVB3, hepatitis B virus post-transcriptional regulatory elements, human genome fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g aptamer sequences. In some embodiments, the translation enhancer binds to eIF4g.

[0005] In some embodiments, the translation enhancer comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the translation enhancer comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500).

[0006] In some embodiments, the cyclic polynucleotide exhibits at least twice the stability compared to polynucleotides without translation enhancers. In some embodiments, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as the polynucleotide without translation enhancers. In some embodiments, the cyclic polynucleotide comprises a polynucleotide cargo encoding a polypeptide, wherein the polypeptide is expressed at least four times more strongly than the polynucleotide without translation enhancers.

[0007] In some embodiments, the one or more expression-enhancing elements comprise a fusion of a stabilizing element and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the expression-enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is an untranslated region (UTR). In some embodiments, the stabilizing element is a 3' UTR. In some embodiments, the stabilizing element is a 5' UTR. In some embodiments, the UTR is derived from genes encoding: translocation-associated membrane protein 1 (TRAM1), transmembrane p24 transporter 2 (TMED2), vesicle-associated membrane protein 3 (VAMP3), PDZ3 domain-interacting protein containing CXXC repeat sequences (CRIP), adaptor-associated protein complex 2 subunit α2 (AP2A2), proteasome 26S subunit, non-ATPase 5 (PSMD5), glutathione peroxidase 4 (GPX4), or AMP-activated protein kinase noncatalytic subunit β1 (PRKAB1). In some embodiments, the UTR is derived from: human β-actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or mitochondrial-encoded 12S rRNA. In some embodiments, the stabilizing element comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the stabilizing element comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500). In some embodiments, the cyclic polynucleotide exhibits at least twice the stability compared to polynucleotides without a stabilizing element. In some embodiments, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as a polynucleotide without a stabilizing element.In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has at least 2-fold greater expression compared to polynucleotides without stability elements.

[0008] In some embodiments, the cyclic polynucleotide further comprises one or more spacer elements containing a polyA region. In some embodiments, the length of the spacer sub-element is between 50 and 500 ribonucleotides (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200). In some embodiments, the length of the spacer sub-element is between 100 and 500 ribonucleotides (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 100 to 300, 100 to 200, 110 to 300, and 110 to 200). In some embodiments, the length of the spacer sub-element is between 110 and 500 ribonucleotides (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500).In some embodiments, the length of the spacer sub-element is between 100 and 300 ribonucleotides (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 110 to 300, 115 to 300, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, 110 to 200, and 280 to 300). In some embodiments, the spacer element is between 10 and 200 ribonucleotides in length (e.g., between 10 and 175, 10 and 150, 10 and 125, 10 and 100, 10 and 75, 10 and 50, 10 and 25, 25 and 200, 50 and 200, 75 and 200, 100 and 200, 150 and 200, 175 and 200, and 25 and 100). In some embodiments, the spacer element is about 120 ribonucleotides in length. In some embodiments, the spacer element is about 50 ribonucleotides in length.

[0009] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first expression-enhancing element; (c) a polynucleotide cargo; (d) a second expression-enhancing element; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction. In some embodiments, the first expression-enhancing element comprises a fusion of a translational enhancer and a spacer element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression-enhancing element comprises a fusion of a translational enhancer and a spacer element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression enhancing element comprises a translation enhancer. In some embodiments, the second expression enhancing element comprises a translation enhancer. In some embodiments, the translation enhancer is derived from a plant virus. In some embodiments, the translation enhancer is derived from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group consisting of: BTE, TED, PTE, ISS, YSS, TSS, dumbbell-shaped structures, viral RNA UTRs (including dengue virus, West Nile virus, Zika virus, rotavirus), EMCV, CVB3, hepatitis B virus post-transcriptional regulatory elements, human genome fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g aptamer sequences. In some embodiments, the translation enhancer binds to eIF4g. In some embodiments, the translation enhancer comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500).In some embodiments, the translation enhancer comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500). In some embodiments, the cyclic polynucleotide exhibits at least twice the stability compared to polynucleotides without a translation enhancer. In some embodiments, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as polynucleotides without a translation enhancer. In some embodiments, the cyclic polynucleotide comprises a polynucleotide cargo encoding a polypeptide, wherein the polypeptide has at least a 4-fold greater expression compared to a polynucleotide without a translation enhancer.

[0010] In some embodiments, the first expression-enhancing element comprises a fusion of a stabilizing element and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression-enhancing element comprises a stabilizing element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression-enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is a UTR. In some embodiments, the UTR is derived from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, the proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR derived from human β-actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or a mitochondrial-encoded 12S rRNA. In some embodiments, the stabilizing element is a 3' UTR. In some embodiments, the stabilizing element is a 5' UTR. In some embodiments, the stabilizing element comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the stabilizing element comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500). In some embodiments, the cyclic polynucleotide exhibits at least twice the stability compared to polynucleotides without a stabilizing element. In some embodiments, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as a polynucleotide without a stabilizing element.In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has at least 2-fold greater expression compared to polynucleotides without stability elements.

[0011] In some embodiments, the cyclic polynucleotide further comprises one or more spacer elements containing a polyA region. In some embodiments, the spacer element is between 100 and 500 ribonucleotides in length (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 100 and 300 ribonucleotides (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300).

[0012] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a spacer element; (c) a polynucleotide cargo; (d) an expression-enhancing element; and (e) a second cyclized element, wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0013] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) an expression-enhancing element; (c) a polynucleotide cargo; (d) a spacer element; and (e) a second cyclized element, wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0014] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first expression-enhancing element; (c) a polynucleotide cargo; (d) a second expression-enhancing element; and (e) a second cyclized element, wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0015] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polynucleotide cargo; (d) a second spacer element; and

[0016] (e) a second circumferential element; wherein the first circumferential element and the second circumferential element together form a circumferential connection point.

[0017] In another aspect, this disclosure provides a cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first spacer element; (c) a polynucleotide cargo; (d) a second spacer element having a length of at least 100 ribonucleotides; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0018] In some embodiments, the length of the first spacer element is between 50 and 500 ribonucleotides (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200). In some embodiments, the length of the first spacer element is between 100 and 500 ribonucleotides (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the second spacer element is between 50 and 500 ribonucleotides (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200). In some embodiments, the length of the second spacer element is between 100 and 500 ribonucleotides (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500).In some embodiments, the first spacer element and the second spacer element each comprise between 110 and 500 ribonucleotides (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the first spacer element and the second spacer element each comprise between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of each of the first and second spacer elements is 150 to 500 (e.g., 150 to 450, 150 to 400, 150 to 350, 150 to 300, 150 to 250, 150 to 200, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, or 450 to 500) ribonucleotides. In some embodiments, the length of each of the first and second spacer elements is 200 to 500 (e.g., 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 500, 300 to 500, 350 to 500, 400 to 500, or 450 to 500) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 100 to 200 (e.g., 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 100 to 110, 110 to 200, 120 to 200, 130 to 200, 140 to 200, 150 to 200, 160 to 200, 170 to 200, 180 to 200, and 90 to 200) ribonucleotides.In some embodiments, the length of each of the first spacer element and the second spacer element is 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the lengths of the first spacer sub-element and the second spacer sub-element are each 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 1...). 80, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300 and 290 to 300 ribonucleotides.

[0019] In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 (e.g., 0 to 10, 0 to 20, 0 to 30, 0 to 40, 0 to 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30, or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the length of the first spacer element and the length of the second spacer element are the same number of ribonucleotides.

[0020] In some embodiments, the first spacer or the second spacer element comprises: (i) a polyA region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; and (ii) a region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or... (iii) a poly-AC region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iii) a poly-AG region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.

[0021] In some embodiments, the cyclic polynucleotide exhibits at least twice the stability compared to polynucleotides lacking the first or second spacer element. In some embodiments, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as polynucleotides lacking the first or second spacer element. In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has at least four times the expression compared to polynucleotides lacking the first or second spacer element.

[0022] In some embodiments, the polynucleotide cargo comprises an expression sequence. In some embodiments, the polynucleotide cargo comprises an IRES operatively linked to the expression sequence. In some embodiments, the expression sequence further comprises a 3' untranslated region or a 5' untranslated region. In some embodiments, the expression sequence encodes a polypeptide.

[0023] In some embodiments, the polynucleotide comprises between 500 and 20,000 ribonucleotides (e.g., between 500 and 15,000, 500 and 10,000, 500 and 5,000, 500 and 1,000, 1,000 and 20,000, 5,000 and 20,000, 10,000 and 20,000, and 15,000 and 20,000). In some embodiments, the polynucleotide comprises between 2,000 and 20,000 (e.g., 2,000 to 5,000, 2,000 to 7,500, 2,000 to 10,000, 2,000 to 12,500, 2,000 to 15,000, 2,000 to 17,500, 5,000 to 20,000, 7,500 to 20,000, 10,000 to 20,000, 12,500 to 20,000, 15,000 to 20,000, and 17,500 to 20,000) ribonucleotides.

[0024] In some embodiments, the circularization junction includes a splice junction. In some embodiments, the first circularized element includes a first exon fragment and the second circularized element includes a second exon fragment, wherein the first exon fragment and the second exon fragment are connected via the splice junction. In some embodiments, the circularization junction includes an oligonucleotide clamp that hybridizes with both the first and second circularized elements. In some embodiments, the oligonucleotide clamp is a DNA clamp or an RNA clamp. In some embodiments, the first circularized element includes a region capable of hybridizing with a first region of the oligonucleotide clamp, and the second circularized element includes a region capable of hybridizing with a second region of the oligonucleotide clamp.

[0025] In one aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) one or more expression-enhancing elements; (c) a polynucleotide cargo; and (d) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0026] In one aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a polynucleotide cargo; (c) one or more expression-enhancing elements; and (d) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0027] In some embodiments, the one or more expression enhancing elements comprise a fusion of a translational enhancer and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the one or more expression enhancing elements comprise a translational enhancer. In some embodiments, the translational enhancer is derived from a plant virus. In some embodiments, the translational enhancer is derived from a mammalian virus. In some embodiments, the translational enhancer is a human translational enhancer. In some embodiments, the translation enhancer is selected from the group consisting of: BTE, TED, PTE, ISS, YSS, TSS, dumbbell-shaped structures, viral RNA UTRs (including dengue virus, West Nile virus, Zika virus, and rotavirus), EMCV, CVB3, hepatitis B virus post-transcriptional regulatory elements, human genome fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g aptamer sequences. In some embodiments, the translation enhancer binds to eIF4g. In some embodiments, the translation enhancer comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the translation enhancer comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500).

[0028] In some embodiments, the linear polynucleotide exhibits at least twice the stability compared to polynucleotides without translation enhancers. In some embodiments, after administration of the linear polynucleotide to a subject, the linear polynucleotide is detectable for at least twice as long as polynucleotides without translation enhancers. In some embodiments, the linear polynucleotide is a polynucleotide cargo encoding a polypeptide, wherein the polypeptide has at least four times the expression compared to polynucleotides without translation enhancers.

[0029] In some embodiments, the one or more expression-enhancing elements comprise a fusion of a stabilizing element and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the expression-enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is a UTR. In some embodiments, the UTR is derived from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, the proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR derived from human β-actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or mitochondrial-encoded 12S rRNA. In some embodiments, the stabilizing element is a 3' UTR. In some embodiments, the stabilizing element is a 5'UTR.

[0030] In some embodiments, the stabilizing element comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the stabilizing element comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500).

[0031] In some embodiments, the linear polynucleotide exhibits at least twice the stability compared to polynucleotides without stability elements. In some embodiments, after administration of the linear polynucleotide to a subject, the linear polynucleotide is detectable for at least twice as long as polynucleotides without stability elements. In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide is expressed at least twice as much as polynucleotides without stability elements.

[0032] In some embodiments, the linear polynucleotide further comprises one or more spacer elements containing a polyA region. In some embodiments, the spacer element is between 100 and 500 ribonucleotides in length (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 110 and 500 ribonucleotides (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 100 and 300 ribonucleotides (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 110 to 300, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300).

[0033] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first expression-enhancing element; (c) a polynucleotide cargo; (d) a second expression-enhancing element; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction. In some embodiments, the first expression-enhancing element comprises a fusion of a translational enhancer and a spacer element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression-enhancing element comprises a fusion of a translational enhancer and a spacer element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression enhancing element comprises a translation enhancer. In some embodiments, the second expression enhancing element comprises a translation enhancer. In some embodiments, the translation enhancer is derived from a plant virus. In some embodiments, the translation enhancer is derived from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group consisting of: BTE, TED, PTE, ISS, YSS, TSS, dumbbell-shaped structures, viral RNA UTRs (including dengue virus, West Nile virus, Zika virus, rotavirus), EMCV, CVB3, hepatitis B virus post-transcriptional regulatory elements, human genome fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g aptamer sequences. In some embodiments, the translation enhancer is combined with eIF4g.

[0034] In some embodiments, the translation enhancer comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the translation enhancer comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500).

[0035] In some embodiments, the linear polynucleotide exhibits at least twice the stability compared to polynucleotides without translation enhancers. In some embodiments, after administration of the linear polynucleotide to a subject, the linear polynucleotide is detectable for at least twice as long as polynucleotides without translation enhancers. In some embodiments, the linear polynucleotide is a polynucleotide cargo encoding a polypeptide, wherein the polypeptide has at least four times the expression compared to polynucleotides without translation enhancers.

[0036] In some embodiments, the first expression-enhancing element comprises a fusion of a stabilizing element and a spacer element containing a poly-A region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression-enhancing element comprises a stabilizing element. In some embodiments, the second expression-enhancing element comprises a fusion of a stabilizing element and a spacer element. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression-enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is a UTR. In some embodiments, the UTR is derived from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, the proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR derived from human β-actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or a mitochondrial-encoded 12S rRNA. In some embodiments, the stabilizing element is a 3' UTR. In some embodiments, the stabilizing element is a 5' UTR.

[0037] In some embodiments, the stabilizing element comprises between 50 and 2000 ribonucleotides (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500). In some embodiments, the stabilizing element comprises between 60 and 800 ribonucleotides (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500).

[0038] In some embodiments, the linear polynucleotide exhibits at least twice the stability compared to polynucleotides without stability elements. In some embodiments, after administration of the linear polynucleotide to a subject, the linear polynucleotide is detectable for at least twice as long as polynucleotides without stability elements. In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide is expressed at least twice as much as polynucleotides without stability elements.

[0039] In some embodiments, the linear polynucleotide further comprises one or more spacer elements containing a polyA region. In some embodiments, the spacer element is between 100 and 500 ribonucleotides in length (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the spacer sub-element is between 100 and 300 ribonucleotides (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300).

[0040] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a spacer element; (c) a polynucleotide cargo; (d) an expression-enhancing element; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0041] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) an expression-enhancing element; (c) a polynucleotide cargo; (d) a spacer element; and (e) a second cyclized element, wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0042] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first expression-enhancing element; (c) a polynucleotide cargo; (d) a second expression-enhancing element; and (e) a second cyclized element, wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0043] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polynucleotide cargo; (d) a second spacer element; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0044] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polynucleotide cargo; (d) a second spacer element; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0045] In another aspect, this disclosure provides a linear polynucleotide comprising, from 5' to 3', in the following order: (a) a first cyclized element; (b) a first spacer element; (c) a polynucleotide cargo; (d) a second spacer element having a length of at least 100 ribonucleotides; and (e) a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0046] In some embodiments, the length of the first spacer element is between 100 and 500 ribonucleotides (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of the first spacer element is between 100 and 300 (e.g., 100 to 250, 100 to 200, 100 to 150, 110 to 300, 120 to 300, 150 to 300, 200 to 300, and 250 to 300). In some embodiments, the length of the second spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise between 110 and 500 ribonucleotides (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the first spacer element and the second spacer element each comprise between 120 and 500 ribonucleotides (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500). In some embodiments, the length of each of the first spacer element and the second spacer element is 150 to 500 (e.g., 150 to 450, 150 to 400, 150 to 350, 150 to 300, 150 to 250, 150 to 200, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500 or 450 to 500) ribonucleotides.In some embodiments, the length of each of the first spacer element and the second spacer element is 200 to 500 (e.g., 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 500, 300 to 500, 350 to 500, 400 to 500 or 450 to 500) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 100 to 200 (e.g., 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 100 to 110, 110 to 200, 120 to 200, 130 to 200, 140 to 200, 150 to 200, 160 to 200, 170 to 200, 180 to 200, and 90 to 200) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the length of each of the first spacer element and the second spacer element is 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides.In some embodiments, the lengths of the first spacer sub-element and the second spacer sub-element are each 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 1...). 80, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300 and 290 to 300 ribonucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 (e.g., 0 to 10, 0 to 20, 0 to 30, 0 to 40, 0 to 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30, or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the length of the first spacer element and the length of the second spacer element are the same number of ribonucleotides.

[0047] In some embodiments, the first spacer or the second spacer element comprises: (i) a polyA region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; and (ii) a region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or... (iii) a poly-AC region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iv) a poly-AG region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.

[0048] In some embodiments, the polynucleotide exhibits at least twice the stability compared to polynucleotides lacking the first or second spacer element. In some embodiments, after administration of the polynucleotide to a subject, the polynucleotide remains detectable for at least twice as long as polynucleotides lacking the first or second spacer element. In some embodiments, the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has at least four times the expression compared to polynucleotides lacking the first or second spacer element.

[0049] In some embodiments, the polynucleotide cargo comprises an expression sequence. In some embodiments, the polynucleotide cargo comprises an IRES operatively linked to the expression sequence. In some embodiments, the expression sequence further comprises a 3' untranslated region or a 5' untranslated region. In some embodiments, the expression sequence encodes a polypeptide.

[0050] In some embodiments, the polynucleotide comprises between 500 and 20,000 ribonucleotides (e.g., between 500 and 15,000, 500 and 10,000, 500 and 5,000, 500 and 1,000, 1,000 and 20,000, 5,000 and 20,000, 10,000 and 20,000, and 15,000 and 20,000). In some embodiments, the polynucleotide comprises between 2,000 and 20,000 (e.g., 2,000 to 5,000, 2,000 to 7,500, 2,000 to 10,000, 2,000 to 12,500, 2,000 to 15,000, 2,000 to 17,500, 5,000 to 20,000, 7,500 to 20,000, 10,000 to 20,000, 12,500 to 20,000, 15,000 to 20,000, and 17,500 to 20,000) ribonucleotides.

[0051] In some embodiments, the cyclization junction includes a splice junction. In some embodiments, the first cyclized element includes a first exon fragment and the second cyclized element includes a second exon fragment, wherein the first exon fragment and the second exon fragment are connected via the splice junction. In some embodiments, the cyclization junction includes an oligonucleotide clamp that hybridizes with both the first and second cyclized elements. In some embodiments, the oligonucleotide clamp is a DNA clamp or an RNA clamp. In some embodiments, the first cyclized element includes a region capable of hybridizing with a first region of the oligonucleotide clamp, and the second cyclized element includes a region capable of hybridizing with a second region of the oligonucleotide clamp. In some embodiments, the first cyclized element includes a first catalytic intron fragment, a first splice site dinucleotide, and a first exon fragment; and the second cyclized element includes a second catalytic intron fragment, a second splice site dinucleotide, and a second exon fragment. In some embodiments, the first catalytic intron fragment and the second catalytic intron fragment together are capable of self-splicing to covalently link the first exon region and the second exon region to produce a cyclic polynucleotide. In some embodiments, the first catalytic intron fragment and the second catalytic intron fragment are derived from the pre-tRNA-Leu gene of *Anabaena cyanobacterium* or pre-rRNA of *Tetrahymena*. In some embodiments, the first cyclization element includes a region capable of hybridizing with a first region of an oligonucleotide clamp, and the second cyclization element includes a region capable of hybridizing with a second region of the oligonucleotide clamp. In another aspect, this disclosure provides a DNA vector comprising an RNA polymerase promoter operatively linked to a sequence encoding any of the linear polynucleotides described herein.

[0052] In another aspect, this disclosure provides a cyclic polynucleotide derived from the linear polynucleotides or DNA carriers described herein. In yet another aspect, this disclosure provides a pharmaceutical composition comprising any one of the linear polynucleotides, cyclic polynucleotides, or DNA carriers described herein, and a pharmaceutically acceptable excipient.

[0053] In another aspect, this disclosure provides a method for expressing a polypeptide in cells or a subject, the method comprising providing the cells or the subject with any one of the linear polynucleotides, cyclic polynucleotides, DNA carriers, or pharmaceutical compositions described herein.

[0054] In another aspect, this disclosure provides a method for generating a cyclic polynucleotide from any of the linear polynucleotides described herein, the method comprising providing the linear polynucleotide under conditions suitable for self-splicing of the linear polynucleotide to generate a cyclic polynucleotide.

[0055] definition

[0056] To facilitate understanding of this disclosure, several terms are defined below. The terms defined herein have meanings as commonly understood by one of ordinary skill in the art relating to this disclosure. Terms such as “a / an” and “described” are not intended to refer to a single entity only, but rather to encompass general categories that may be illustrated by specific examples. The term “or” is used to mean “and / or” unless explicitly stated to refer only to alternatives or that alternatives are mutually exclusive, although this disclosure supports the definitions of “and / or” and “alone”. The terms herein are used to describe specific embodiments, but their use should not be considered limiting unless set forth in the claims.

[0057] As used herein, any value provided within the range of values ​​includes the upper and lower limits, as well as any values ​​contained within the upper and lower limits.

[0058] As used in this article, the term “about” refers to a value within ±10% of the enumerated value.

[0059] As used herein, the term "between" refers to all values ​​greater than or equal to an initial value and less than or equal to an endpoint, such that the range of values ​​between the two values ​​includes the endpoints of the range. For example, "between 1 and 5" refers to all values ​​≥ 1 and ≤ 5, such that the endpoints of 1 and 5 are included in the expected range.

[0060] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., a cyclic polynucleotide) into cells via covalent modification of a cyclic polynucleotide, through partial or complete encapsulation agents, or combinations thereof. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified plant glycogen or glycoprototype materials), nanoparticles (e.g., nanoparticles encapsulated or covalently linked / bound to cyclic polynucleotides), liposomes, fusion bodies, in vitro differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently linked to cyclic polynucleotides), or cationic carriers (e.g., cationic lipid polymers or transfection reagents).

[0061] As used herein, the terms “circRNA,” “cyclic polynucleotide,” “circular RNA,” and “cyclic polynucleotide molecule” are used interchangeably and refer to a polynucleotide molecule having a structure without free ends (i.e., without free 3' and / or 5' ends), such as a polynucleotide molecule forming a cyclic or ring structure by covalent (e.g., covalently closed) or non-covalent bonds. A cyclic polynucleotide can be, for example, a covalently closed polynucleotide.

[0062] As used herein, the term "cyclization efficiency" is a measurement of the cyclic polynucleotide obtained relative to its acyclic starting material.

[0063] As used in this article, the terms “disease,” “disorder,” and “symptom” each refer to a sub-healthy state, such as a state that is typically diagnosed or will be treated by a medical professional.

[0064] As used herein, the term "expression-enhancing element" refers to a component of a polynucleotide construct that increases the expression of a polypeptide cargo encoded by the polynucleotide compared to a polynucleotide construct lacking an expression element. For example, in embodiments, the expression-enhancing element is a translational enhancer or a stabilizing element. In embodiments, the expression-enhancing element increases the expression of the polypeptide cargo by increasing the duration of circRNA before degradation, or it increases the concentration of the polypeptide cargo expressed over a fixed time period.

[0065] As used herein, the term "expression sequence" is a nucleic acid sequence that encodes a product (e.g., a polypeptide). Exemplary expression sequences encoding polypeptides may include a variety of nucleotide triplets, each of which may encode an amino acid and is referred to as a "codon".

[0066] As used herein, the term "fragment" in relation to polypeptide or nucleic acid sequences refers to a continuous portion of a polypeptide or nucleic acid sequence that is less than the entire sequence. For example, a polypeptide fragment refers to a continuous portion of a sequence (such as the sequences disclosed herein) that is less than the entire sequence (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the total length). It should be understood that all aspects of this disclosure consider fragments of all polypeptides disclosed herein.

[0067] As used herein, the term "fusion" refers to a single continuous molecule containing two or more distinct elements. For example, a fusion element described herein may include a translation enhancer fused (e.g., connected or linked) to a stabilizing element, a translation enhancer fused (e.g., connected or linked) to a spacer element, or a stabilizing element fused (e.g., connected or linked) to a spacer element. The fusion element may have functional characteristics derived from each of the original elements. In some embodiments, the translation enhancer is connected to the spacer element at its 5' end. In some embodiments, the translation enhancer is connected to the spacer element at its 3' end. In some embodiments, the stabilizing element is connected to the spacer element at its 5' end. In some embodiments, the stabilizing element is connected to the spacer element at its 3' end. In some embodiments, the translation enhancer is connected to the stabilizing element at its 5' end. In some embodiments, the translation enhancer is connected to the translation stabilizing element at its 3' end.

[0068] As used herein, the term "GC content" refers to the percentage of guanine (G) and cytosine (C) in a nucleic acid sequence. The formula for calculating GC content is (G+C) / (A+G+C+U)×100% (for RNA) or (G+C) / (A+G+C+T)×100% (for DNA). Similarly, the term "uridine content" refers to the percentage of uridine (U) in a nucleic acid sequence. The formula for calculating uridine content is U / (A+G+C+U)×100%. Likewise, the term "thymidine content" refers to the percentage of thymidine (T) in a nucleic acid sequence. The formula for calculating thymidine content is T / (A+G+C+T)×100%.

[0069] "Heterologous" means occurring in a context different from the naturally occurring (natural) context. A "heterologous" polynucleotide sequence indicates a polynucleotide sequence used in a manner different from how it is found in the natural genome of that sequence. For example, a "heterologous promoter" is used to drive the transcription of a sequence that is not naturally transcribed by that promoter; therefore, "heterologous promoter" sequences are often included in expression constructs via recombinant nucleic acid technology. The term "heterologous" is also used to refer to a given sequence placed in a non-natural relationship with another sequence; for example, heterologous coding or non-coding nucleotide sequences are often inserted into the genome via genome transformation technology to produce a genetically modified genome or a recombinant genome.

[0070] As used herein, the term "impurity" is an undesirable substance present in a composition, such as a pharmaceutical composition as described herein. In some embodiments, an impurity is a process-related impurity. In some embodiments, an impurity is a product-related substance in the final composition other than the desired product, such as an active pharmaceutical ingredient (e.g., a cyclic polynucleotide) as described herein. As used herein, the term "process-related impurity" is an undesirable substance, other than a linear polynucleotide as described herein, used, present, or generated in the manufacture of the final composition, formulation, or product, and is used in the process of manufacturing the composition, formulation, or product. In some embodiments, a process-related impurity is an enzyme used in the synthesis or cyclization of a polynucleotide. As used herein, the term "product-related substance" is a substance or byproduct generated during the synthesis of a composition, formulation, or product or any intermediate thereof. In some embodiments, a product-related substance is a deoxyribonucleotide fragment. In some embodiments, a product-related substance is a deoxyribonucleotide monomer. In some embodiments, the substance associated with the product is one or more of the following: derivatives or fragments of the polynucleotides described herein, such as fragments of 10, 9, 8, 7, 6, 5, or 4 ribonucleic acids, mononucleotides, dinucleotides, or trinucleotides.

[0071] As used herein, “increase in subject fitness” or “promote in subject fitness” means any beneficial alteration in the physiological or test organism’s activity resulting from the administration of the peptide or polypeptide described herein, including but not limited to any one or more of the following desired effects: (1) increasing tolerance to biological or abiotic stress by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (2) increasing yield or biomass by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (3) increasing the tolerance to biological or abiotic stress ...4) increasing the tolerance to biological or abiotic stress by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (5) increasing the tolerance to biological or abiotic stress by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (6) increasing the tolerance to biological or abiotic stress by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99 (3) Increase resistance to pests or pathogens by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4) Increase resistance to herbicides by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (5) Increase the population of the tested organism (e.g., an agriculturally important insect) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (6) Increase resistance to herbicides by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (7) Increase resistance to herbicides by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (8) Increase the population of the tested organism (e.g., an agriculturally important insect) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more. (6) Increase the reproductive rate of the test organism (e.g., insects, such as bees or silkworms) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (7) Increase the migration of the test organism (e.g., insects, such as bees or silkworms) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (8) Increase the body weight of the test organism (e.g., insects, such as bees or silkworms) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more. (9) to increase the metabolic rate or activity of a test organism (e.g., an insect, such as a bee or silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (10) to increase pollination (e.g., the number of plants pollinated in a given time) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more ...(11) To increase the yield of by-products (e.g., honey from bees or silk from silkworms) of a test organism (e.g., insects, such as bees or silkworms) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (12) To increase the content of nutrients (e.g., proteins, fatty acids, or amino acids) of a test organism (e.g., insects) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. %, 95%, 99%, 100% or more; or (13) increasing the resistance of the test organism to pest-killing agents (e.g., neonicotinoids (e.g., imidacloprid) or organophosphate insecticides (e.g., thiophosphates, e.g., fenitrothion)) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (14) improving the health of the test organism (e.g., human or non-human animal) or reducing disease in the test organism (e.g., human or non-human animal). An improvement in host fitness can be determined compared to test organisms that have not been treated with polynucleotides. Conversely, “reducing the fitness of the subject” means any adverse alteration of the physiological or test organism’s activity resulting from the administration of the peptides or polypeptides described herein, including but not limited to any one or more of the following anticipated effects: (1) reducing tolerance to biological or abiotic stress by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (2) reducing yield or biomass by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (3) adjusting flowering time by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4) reducing tolerance to harmful organisms. Or reduce the resistance of pathogens by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4) reduce the resistance to herbicides by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (5) reduce the resistance of the tested organism (e.g., in agriculture) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (6) To reduce the population of the test organism (e.g., insects, such as bees or silkworms) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more;(7) To reduce the migration of a test organism (e.g., an insect, such as a bee or a silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100%, or more; (8) To reduce the body weight of a test organism (e.g., an insect, such as a bee or a silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100%, or more; (9) To reduce the migration of a test organism (e.g., an insect, such as a bee or a silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100%, or more; For example, a decrease in the metabolic rate or activity of a bee or silkworm by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (10) a decrease in pollination (e.g., the number of plants pollinated in a given time) by a test organism (e.g., an insect, such as a bee or silkworm) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (11) a decrease in the metabolic rate or activity of a bee or silkworm by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (12) Reduce the yield of by-products (e.g., honey from bees or silk from silkworms) of the test organism (e.g., insects, such as bees or silkworms) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; and reduce the content of nutrients (e.g., proteins, fatty acids, or amino acids) of the test organism (e.g., insects) by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 9 ... 5%, 99%, 100% or more; or (13) reducing the resistance of the test organism to pest-killing agents (e.g., neonicotinoids (e.g., imidacloprid) or organophosphate insecticides (e.g., thiophosphates, e.g., fenitrothion)) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (14) reducing the health of the test organism (e.g., human or non-human animal) or reducing disease in the test organism (e.g., human or non-human animal). A reduction in host fitness can be determined compared to a test organism that has not been treated with polynucleotides. It will be apparent to those skilled in the art that certain changes in the physiology, phenotype, or activity of the subject (e.g., adjustment of the flowering time of a plant) can be considered to increase or decrease the fitness of the subject, depending on the context (e.g., adaptation to changes in climate or other environmental conditions). For example, delaying the flowering time (e.g., a reduction of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% in plants that flower on a given calendar date) can be a beneficial adaptation to a later or cooler spring and is therefore considered to improve plant fitness.Conversely, in the context of an earlier or warmer spring, the same delay in flowering time can be considered to reduce plant fitness.

[0072] As used herein, the terms “linear RNA,” “linear polynucleotide,” and “linear polynucleotide molecule” are used interchangeably and refer to a mononucleotide or polynucleotide molecule having a 5’ and a 3’ end. One or both of the 5’ and 3’ ends may be free ends or may be linked to the other. In some embodiments, the linear RNA has a modified or protected 5’ or 3’ end from degradation (e.g., protected by a 5’ or 3’ end protectant). In some embodiments, the linear RNA has a non-covalently linked 5’ or 3’ end. Linear RNA includes RNA that has not yet undergone cyclization (e.g., pre-cyclized) and can be used as starting material for cyclization.

[0073] As used herein, the term "linear counterpart" is a polynucleotide molecule (and fragment thereof) having the same or similar nucleotide sequence as a cyclic polynucleotide (e.g., any percentage of sequence similarity between 100%, 95%, 90%, 85%, 80%, 75%, or any between) and having two free ends (i.e., the uncirculated form of the cyclic polynucleotide (and fragment thereof)). In some embodiments, a linear counterpart (e.g., the pre-circulated form) is a polynucleotide molecule (and fragment thereof) having the same or similar nucleotide sequence as a cyclic polynucleotide (e.g., any percentage of sequence similarity between 100%, 95%, 90%, 85%, 80%, 75%, or any between) and the same or similar nucleic acid modifications and having two free ends (i.e., the uncirculated form of the cyclic polynucleotide (and fragment thereof)). In some embodiments, the linear counterpart is a polynucleotide molecule (and fragments thereof) having the same or similar nucleotide sequence as the cyclic polynucleotide (e.g., any percentage of sequence similarity of 100%, 95%, 90%, 85%, 80%, 75%, or between) and different nucleic acid modifications or no nucleic acid modifications and having two free ends (i.e., the uncircularized form of the cyclic polynucleotide (and fragments thereof)). In some embodiments, the fragment of the polynucleotide molecule that is the linear counterpart is any portion of the linear counterpart polynucleotide molecule that is shorter than the linear counterpart polynucleotide molecule. In some embodiments, the linear counterpart further comprises a 5' cap. In some embodiments, the linear counterpart further comprises a polyadenosine tail. In some embodiments, the linear counterpart further comprises a 3' UTR. In some embodiments, the linear counterpart further comprises a 5' UTR.

[0074] As used herein, the term "modified ribonucleotide" is a nucleotide having at least one modification for a sugar, nucleobase, or nucleoside bond.

[0075] The term "pharmaceutical composition" is intended to further disclose that the cyclic polynucleotide contained in the pharmaceutical composition may be used to treat a human or animal body by means of a therapy (e.g., veterinary use). Therefore, this means equivalent to "cyclic polynucleotide for use in a therapy".

[0076] The term "poly-A-based spacer element" or "poly-A spacer element" refers to a spacer element comprising a non-translated continuous region of a nucleic acid molecule with a length of at least 4 nucleotides, and consisting of one or more individual adenine (A) residues combined with one or more (A), thymine (T), cytosine (C), guanine (G), or uracil (U) residues. For example, in some embodiments, the poly-A-based spacer element is a poly-A region, which may be a sequence of adenine residues. In other embodiments, the poly-A-based spacer element is a poly-AT region, which is a combination of adenine and thymine residues. In other embodiments, the poly-A-based spacer element is a poly-AU region, which may be a combination of adenine and uracil residues. In some embodiments, the poly-A-based spacer element is a poly-AG region, which is a combination of adenine and guanine residues. The poly-A-based spacer element contains between 50% and 100% (e.g., between 50% and 90%, 50% and 80%, 50% and 70%, 50% and 60%, 60% and 100%, 70% and 100%, 80% and 100%, 90% and 100%, 70% and 90%, or 60% and 80%) of adenine residues.

[0077] As used herein, the term "polynucleotide" refers to a molecule containing one or more nucleic acid subunits or nucleotides and is used interchangeably with "nucleic acid" or "oligonucleotide". A polynucleotide may contain one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide may contain a nucleoside and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphate (PO3) groups. A nucleotide may contain a nucleobase, a pentose sugar (ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. A polynucleotide, ribonucleic acid, or RNA may refer to a macromolecule containing multiple ribonucleotides polymerized via phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose. In some instances, a polynucleotide is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a derivative or variant thereof. In some cases, polynucleotides include, for example, short interfering RNA (siRNA), microRNA (miRNA), plasmid DNA (pDNA), short hairpin RNA (shRNA), small nuclear RNA (snRNA), messenger RNA (mRNA), precursor mRNA (premRNA), and antisense RNA (asRNA), and encompass nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some cases, polynucleotide molecules are circular. Polynucleotides can have various lengths. Nucleic acid molecules can have lengths of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1000 bases (kb), 2kb, 3kb, 4kb, 5kb, 10kb, 50kb, or greater. Polynucleotides can be isolated from cells or tissues. As illustrated in this article, polynucleotide sequences can include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.

[0078] "Polydeoxyribonucleic acid," "deoxyribonucleic acid," and "DNA" refer to a macromolecule containing multiple deoxyribonucleic acids polymerized via phosphodiester bonds. Nucleotides can be monophosphates or polyphosphates. A nucleotide refers to a deoxyribonucleoside polyphosphate containing a detectable tag (such as a luminescent tag) or marker (e.g., a fluorophore), such as, for example, deoxyribonucleoside triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphates (dATP), deoxycytidine triphosphates (dCTP), deoxyguanosine triphosphates (dGTP), uridine triphosphates (dUTP), and deoxythymidine triphosphates (dTTP) dNTPs. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits can be A, C, G, T, or U, or any other subunit that is specific to one or more complementary A, C, G, T, or U, or complementary to a purine (i.e., A or G or its variants) or a pyrimidine (i.e., C, T, or U or its variants).

[0079] Polynucleotides, such as polynucleotides or polydeoxynucleotides, may include one or more nucleotide variants, including one or more non-standard nucleotides, one or more non-natural nucleotides, one or more nucleotide analogs, and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentene adenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, and 5-methoxyaminomethyluracil. Nucleotides include 2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentene adenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetic acid, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, 3-(3-amino-3-carboxypropyl)uridine, 2,6-diaminopurine, etc. In some cases, the nucleotides may include modifications to their phosphate moiety, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include modifications with longer phosphate ester chains (e.g., phosphate ester chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate ester moieties) and modifications with thiol moieties (e.g., α-thiotriphosphate and β-thiotriphosphate). Nucleic acid molecules may also be modified at base moieties (e.g., at one or more atoms that are typically available to form hydrogen bonds with complementary nucleotides and / or at one or more atoms that are typically not available to form hydrogen bonds with complementary nucleotides), sugar moieties, or phosphate backbones. Nucleic acid molecules may also contain amine-modified groups, such as aminoallyl 1-dUTP (aa-dUTP) and aminohexylacrylamide-dCTP (aha-dCTP), to allow covalent attachment of amine reactive moieties (such as N-hydroxysuccinimide ester (NHS)).The alternatives to standard DNA or RNA base pairs in the oligonucleotides disclosed herein can provide higher density (in bits per cubic millimeter), greater safety (resistance to accidental or targeted synthesis of natural toxins), easier identification of photo-programmed polymerases, or lower secondary structure. Such alternative base pairs compatible with natural and mutant polymerases used for de novo and / or amplified synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. [Nature Chemical Biology] 2012 July; 8(7):612-4, which is incorporated herein by reference for all purposes.

[0080] As used herein, “polypeptide” refers to a polymer of amino acid residues (natural or non-natural) most commonly linked together by peptide bonds. As used herein, the term refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologues, orthologs, paralogs, fragments of the foregoing, and other equivalents, variants, and analogs. Polypeptides can be single-molecule or multi-molecule complexes, such as dimers, trimers, or tetramers. They can also include single-chain or multi-chain polypeptides, such as antibodies or insulin, and can associate or link together. Disulfide bonds are most commonly found in multi-chain polypeptides. The term polypeptide can also be applied to amino acid polymers, where one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0081] As used herein, the term "polynucleotide cargo" includes any sequence comprising at least one polynucleotide. In embodiments, a polynucleotide cargo comprises one or more expression sequences, each encoding a polypeptide. In embodiments, a polynucleotide cargo comprises one or more non-coding sequences, such as polynucleotides having regulatory or catalytic functions. In embodiments, a polynucleotide cargo comprises a combination of expression sequences and non-coding sequences. In embodiments, a polynucleotide cargo comprises one or more polynucleotide sequences as described herein, such as one or more regulatory elements, internal ribosome entry site (IRES) elements, or spacer elements.

[0082] As used herein, the term "prevention" means reducing the likelihood of developing a disease, disorder, or condition, or alternatively, reducing the severity or frequency of symptoms in a subsequently developing disease or disorder. The polynucleotides described herein may be administered to subjects at increased risk of developing a disease or disorder relative to the general population to prevent the development of the disease or condition or to reduce its severity. The polynucleotides described herein may be administered as a preventative agent (e.g., prior to the development of any symptoms or manifestations of the disease or disorder).

[0083] As used herein, the term "purify (purifying and purification)" refers to one or more steps or processes for removing impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or byproducts (e.g., linear RNA) from a sample containing a mixture of circular RNA and linear RNA, as well as other substances, to produce a composition containing an enriched population of circular RNA, wherein the levels of impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or byproducts (e.g., linear RNA) are reduced compared to the original mixture, or the linear RNA or substance is reduced by 40% or more (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% or more by weight) relative to the starting mixture.

[0084] As used herein, the terms “pure” and “purity” refer to the degree to which an analyte (e.g., circular RNA) is isolated and free of other components. In the context of nucleic acids (e.g., polynucleotides), the purity of isolated nucleic acids (e.g., circular RNA) can be expressed as a population of nucleic acids free of any contaminants, impurities, or byproducts (e.g., linear RNA and other substances). For example, the purity of a population of circular RNA represents how much of the population, based on the total mass of the isolated material, is circular RNA, and can be determined using, for example, pure circular RNA as a reference. The purity levels found in this disclosure can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, greater than 95%, or greater than 99% (w / w). In some embodiments, the levels of contaminants, impurities, or byproducts do not exceed about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w). Purity can be determined by detecting the level of a specific analyte (e.g., circular RNA) or a specific impurity or byproduct (e.g., linear RNA) using gel electrophoresis, spectrophotometry (e.g., NanoDrop from Thermo Fisher Scientific), or other techniques suitable for measuring the purity of a nucleic acid population, and calculating the percentage (w / w) of the analyte relative to the total nucleic acid content (e.g., as determined by assays known in the art).

[0085] As used herein, the phrase “substantially free of one or more impurities or byproducts” means that a sample (such as a sample containing an enriched population of circular RNA) is free of one or more impurities or byproducts (e.g., one or more impurities or byproducts disclosed herein) or contains a minimum amount of one or more impurities or byproducts. The minimum amount of one or more impurities or byproducts may not exceed 20% (w / w) (e.g., not exceeding 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less). In another example, if one or more impurities or byproducts are present in amounts less than 15% (w / w) (e.g., not exceeding 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less), the sample or enriched population of circular RNA is substantially free of said one or more impurities or byproducts. In another example, if one or more impurities or byproducts are present in amounts less than 10% (w / w) (e.g., not exceeding 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less), the sample or enriched population of circular RNA is substantially free of said one or more impurities or byproducts. In another example, if one or more impurities or byproducts are present in amounts less than 5% (w / w) (e.g., no more than 4%, 3%, 2%, 1% (w / w) or less), the sample or enriched population of circular RNA is substantially free of said one or more impurities or byproducts. In yet another example, if one or more impurities or byproducts are present in amounts less than 1% (no more than 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% (w / w) or less), the sample or enriched population of circular RNA is substantially free of said one or more impurities or byproducts.

[0086] As used in this article, the term "regulatory element" refers to the portion of a cyclic polynucleotide sequence that modifies the expression of that sequence, such as a nucleic acid sequence.

[0087] As used herein, the term "replication element" is a sequence and / or motif that can be used to replicate or initiate the transcription of cyclic polynucleotides.

[0088] As used herein, the term "RNA equivalent" refers to an RNA sequence that is an RNA equivalent of a DNA sequence. Therefore, an RNA equivalent of a DNA sequence is a DNA sequence in which each thymidine (T) residue is replaced by a uridine (U) residue. This disclosure specifically considers that any of these DNA sequences can be converted into a corresponding RNA sequence and included in the RNA molecule described herein.

[0089] As used herein, the term "sequence identity" is determined by aligning two peptide or two nucleotide sequences using a global or local alignment algorithm. Sequences (e.g., when optimally aligned using default parameters via the GAP or BESTFIT program) can be described as "substantially identical" or "substantially similar" when they have at least a certain minimum percentage of sequence identity. GAP uses the Needleman and Wunsch global alignment algorithm to align the two sequences across their entire length, maximizing the number of matches and minimizing the number of gaps. Typically, using GAP's default parameters, the gap penalty is 50 (nucleotides) / 8 (proteins), and the gap extension penalty is 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is the nwsgapdna.cmp scoring matrix, while for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignment and percentage sequence identity scores can be determined using computer programs, such as GCG Wisconsin software package version 10.3 or EmbossWin version 2.10.0 (using the program "needle"), available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752, USA. Alternatively or additionally, the percentage of identity can be determined by searching a database using algorithms such as FASTA, BLAST, etc. Sequence identity refers to sequence identity over the entire length of the sequence.

[0090] A “signal sequence” refers to a polypeptide sequence, for example, between 10 and 45 amino acids in length, which is located at the N-terminus of the polypeptide sequence of a newborn protein and targets the polypeptide sequence to the secretion pathway.

[0091] As used herein, the term "spacer element" refers to any continuous nucleotide sequence (e.g., a continuous nucleotide sequence of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. Spacer elements may be present between any nucleic acid elements described herein. Spacer elements may also be present within nucleic acid elements described herein.

[0092] As used herein, the term "stabilizing element" refers to a polynucleotide element that increases the stability of a polynucleotide compared to a polynucleotide lacking a stabilizing element. Stabilizing elements can increase the stability of a polynucleotide, resulting in slower degradation.

[0093] As used herein, the term "subject" refers to a living organism, such as an animal, plant, or microorganism. In embodiments, the subject is a vertebrate (e.g., a mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., monkey, ape), an ungulate (e.g., domestic cattle, buffalo, bison, sheep, goats, pigs, camels, llamas, alpacas, deer, horses, donkeys), a carnivore (e.g., dog, cat), a rodent (e.g., rat, mouse), or a rabbit (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the following bird taxa: Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Paleognathea (e.g., ostrich, emu), Columbiformes (e.g., pigeon, wild pigeon), or Psittaciformes (e.g., parrot). In some embodiments, the subjects are invertebrates, such as arthropods (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In some embodiments, the subjects are invertebrate agricultural pests or invertebrates parasitizing invertebrate or vertebrate hosts. In some embodiments, the subjects are plants, such as angiosperms (which may be dicotyledons or monocotyledons) or gymnosperms (e.g., conifers, cycads, gynostemma pentaphyllum, ginkgo), ferns, horsetails, lycophytes, or bryophytes. In some embodiments, the subjects are eukaryotic algae (unicellular or multicellular). In some embodiments, the subjects are plants of agricultural or horticultural importance, such as intercropping crops, fruit-producing plants and trees, vegetables, trees, and ornamental plants (including ornamental flowers, shrubs, trees, ground cover plants, and turfgrass).

[0094] As used herein, the term "translation enhancer" refers to a polynucleotide element that allows for the translation of mRNA via recruitment of ribosomes, translation initiation factors, directly, or through interaction with RNA-binding proteins. Compared to polynucleotides lacking translation enhancers, polynucleotides containing translation enhancers may, for example, exhibit increased stability and / or increased expression of the polynucleotide cargo.

[0095] As used in this article, the term "termination element" is the part that terminates the translation of an expressed sequence in a cyclic polynucleotide, such as a nucleic acid sequence.

[0096] As used herein, the term “total ribonucleotide molecules” means the total amount of any ribonucleotide molecules as measured by the total mass of ribonucleotide molecules, including linear polynucleotide molecules, cyclic polynucleotide molecules, monomeric ribonucleotides, other polynucleotide molecules, their fragments and modified variants.

[0097] As used herein, the term "translation efficiency" is the rate or amount of protein or peptide produced from ribonucleotide transcripts. In some embodiments, translation efficiency may be expressed as the amount of protein or peptide produced from a given amount of transcript encoding a protein or peptide, for example, over a given time period, or in a given translation system, such as an in vitro translation system (like rabbit reticulocyte lysate) or an in vivo translation system (like eukaryotic or prokaryotic cells).

[0098] As used in this article, the term "translation initiation sequence" is a nucleic acid sequence that initiates the translation of a sequence expressed in a cyclic polynucleotide.

[0099] As used herein, the terms “treatment” (“treat” and “treating”) refer to preventive or therapeutic treatment of a subject’s disease or condition. The effects of treatment may include reversing, alleviating, reducing the severity of the disease or condition or one or more symptoms or manifestations of the disease or condition compared to the state or condition of the disease or condition without therapeutic treatment, curing the disease or condition or one or more symptoms or manifestations of the disease or condition, inhibiting the progression of the disease or condition or one or more symptoms or manifestations of the disease or condition, reducing the likelihood of recurrence of the disease or condition or one or more symptoms or manifestations of the disease or condition, or stabilizing (i.e., not worsening) the state of the disease or condition or preventing the spread of the disease or condition.

[0100] As used herein, a “variant” is a polypeptide that contains at least one change, such as substitution, insertion, deletion, and / or fusion, at one or more residue positions compared to a parent or wild-type polypeptide. Variants may contain 1 to 10, 10 to 20, 20 to 50, 50 to 100 or more changes. Attached Figure Description

[0101] Figures 1A-1F This is a schematic diagram of exemplary linear and cyclic polynucleotide constructs having one or more spacer elements and / or one or more expression-enhancing elements.

[0102] Figure 2 This is a table showing the circumduction efficiency (circRNA%) of single-spacer or double-spacer design constructs having one or more spacer elements of length between 50 and 300 nucleotides, wherein the constructs encode a Gluc polypeptide or human erythropoietin.

[0103] Figure 3A It is a table of translation enhancers (including motifs and sequences).

[0104] Figure 3BThis is a table showing the circumduction efficiency (circRNA%) of single- and dual-design constructs with spacer elements and / or translation enhancers encoding Gluc peptides.

[0105] Figure 4A This is a bar graph showing the expression of Gluc in HeLa cells transfected with circular RNA containing spacer elements and encoding a Gluc polypeptide at 24 and 48 hours post-transfection.

[0106] Figure 4B This is a diagram showing the expression of EPO in HeLa cells transfected with circular RNA containing spacer elements and encoding human erythropoietin at 24 and 48 hours post-transfection.

[0107] Figure 5 This is a bar graph showing the expression of Gluc in HeLa cells transfected with circular RNA encoding a Gluc polypeptide, either with a single-spacer design or a double-spacer design, at 24 hours post-transfection.

[0108] Figure 6A This is a bar graph showing the expression of Gluc in HeLa cells transfected with circular RNA designed with double spacers and encoding a Gluc polypeptide at 4, 24, and 48 hours post-transfection.

[0109] Figure 6B This is a bar graph showing the expression of EPO in HeLa cells transfected with circular RNA designed with double spacers and encoding human erythropoietin at 4, 24, and 48 hours post-transfection.

[0110] Figure 7A This is a bar graph showing the expression of Gluc in A549 cells transfected with circular RNA containing spacer elements and translation enhancers that encodes a Gluc polypeptide.

[0111] Figure 7B This is a bar graph showing the expression of EPO in A549 cells transfected with circular RNA containing spacer elements and translation enhancers that encode human erythropoietin at 24 hours post-transfection.

[0112] Figure 8 This is a bar graph showing the expression of EPO in HEK cells transfected with a cyclic polynucleotide encoding human erythropoietin on day 1 and day 2 post-transfection.

[0113] Figure 9 This is a bar graph showing the expression of EPO in HeLa cells transfected with a cyclic polynucleotide encoding human erythropoietin on day 1 and day 2 post-transfection.

[0114] Figure 10 This is a bar graph showing the in vivo expression of EPO encoded by a cyclic polynucleotide containing a translation enhancer.

[0115] Figure 11 This is a diagram showing the expression of EPO in A549 cells transfected with a cyclic polynucleotide with CVB3 IRES that has spacer elements and / or translational enhancers and encodes human erythropoietin at 24 hours post-transfection.

[0116] Figure 12 This is a diagram showing the expression of EPO in A549 cells transfected with a cyclic polynucleotide with EMCV IRES that has spacer elements and / or translational enhancers and encodes human erythropoietin at 24 hours post-transfection.

[0117] Figure 13 This is a diagram showing the expression of EPO in A549 cells transfected with a cyclic polynucleotide encoding human erythropoietin and SARS-CoV-2 RBD peptides at 24 hours post-transfection.

[0118] Figure 14A and Figure 14B This is a diagram showing the time course of EGFPd2 expression in A549 cells transfected with circular RNA containing spacer elements and translation enhancers that encode the EGFPd2 polypeptide. Figure 14A The expression of EGFPd2 over time is shown. Figure 14B The area under the curve is shown from 0 to 24 hours.

[0119] Figures 15A-15C This is a bar graph showing the expression of EPO in A549 cells transfected with circular RNA containing spacer elements and translation enhancers that encode human erythropoietin at 24 hours post-transfection.

[0120] Figure 16A and Figure 16B This is a bar graph showing the expression of EPO in A549 cells transfected with circular RNA containing spacer elements and translation enhancers that encode human erythropoietin at 24 hours post-transfection.

[0121] Figures 17A-17C This is a bar graph showing HiBiT expression in HEK cells transfected with circular RNA containing spacer elements and translation enhancers and encoding factor 9-albumin-HiBiT polypeptide at 24 hours post-transfection.

[0122] Figure 18A and Figure 18BThis is a bar graph showing the expression of Gluc in HeLa cells 48 hours after transfection, which are transfected with circular RNA that translates enhancers and encodes a Gluc polypeptide using different concentrations of the aptamer eIF4g with spacer elements and minimal or full-length eIF4g aptamers.

[0123] Figure 19 This is a bar graph showing CFTR expression in HEK293T cells transfected with one of the twelve (12) different circular RNAs encoding CFTR.

[0124] Figure 20 This is a bar graph showing the peptide expression detected on the cell surface of HEK293T cells transfected with one of thirteen (13) different circular RNAs encoding peptides.

[0125] Figure 21 This is a bar graph showing the peptide expression detected on the cell surface of HEK293T cells transfected with one of four different circular RNAs encoding peptides.

[0126] Figure 22 This is a graph showing the relative amounts of cyclic polynucleotides with modified CVB3 IRES that have a 5' spacer element and a 3' RNA stability element and encode the EGFPd2 polypeptide, present over time.

[0127] Figures 23A-23C This is a series of bar graphs showing the concentration of the peptide factor 9-HiBiT encoded by a cyclic polynucleotide having a 5' spacer element and a 3' translation enhancer and encoding factor 9-HiBiT 24 hours post-transfection.

[0128] Figure 24A and Figure 24B This is a graph showing the time history of expression data for EGFPd2 encoded by a cyclic polynucleotide with modified CVB3 IRES that has spacer elements and / or translation enhancers and encodes EGFPd2. Figure 24A EGFPd2 expression over time is shown, and Figure 24B The area under the curve is shown from 0 to 24 hours.

[0129] Figure 25A and Figure 25B This is a graph showing the time history of expression data for EGFPd2 encoded by a cyclic polynucleotide with modified CVB3 IRES that has a 5' translation enhancer and a 3' spacer element and encodes EGFPd2. Figure 25A EGFPd2 expression over time is shown, and Figure 25BThe area under the curve is shown from 0 to 24 hours.

[0130] Figure 26A and Figure 26B This demonstrates that 24 hours post-transfection, the peptide B-HiBiT, encoded by a 5' spacer element and a 3' translation enhancer, is produced by EV69 IRES ( Figure 26A ) or modified CVB3 IRES ( Figure 26B Bar graph showing the concentration of the polypeptide B-HiBiT encoded by the cyclic polynucleotide.

[0131] Figure 27 This is a bar graph showing the concentration of the polypeptide B-HiBiT encoded by a cyclic polynucleotide having multiple translation enhancers or multiple spacer elements.

[0132] Figure 28 The expression of polypeptide G encoded by a cyclic polynucleotide with modified CVB3 IRES, having spacer elements and / or translation enhancers, is shown 24 hours post-transfection.

[0133] Figure 29A and Figure 29B This shows the area under the curve for GFPd2 ( Figure 29A ) and the concentration of peptide B-HiBiT ( Figure 29B The bar chart shows the peptide encoded by a cyclic polynucleotide with a single-spacer design or a double-spacer design.

[0134] Figure 30A and Figure 30B This is a bar graph showing the area under the curve for GFPd2 encoded by cyclic polynucleotides with single or double spacer designs.

[0135] Figure 31A and Figure 31B This is a bar graph showing the area under the curve for the polypeptide B-HiBiT encoded by cyclic polynucleotides with single-spacer or double-spacer designs.

[0136] Figures 32A-32D This is a bar graph showing the area under the curve of GFPd2 encoded by a cyclic polynucleotide having one or more spacer elements and / or one or more translation enhancers, where the translation enhancer is FcIgG ( Figure 32A ), TP53I3 ( Figure 32B ), LSP1( Figure 32C ) or histone 4E ( Figure 32D ).

[0137] Figures 33A-33DThis is a bar graph showing the concentration of the polypeptide B-HiBiT encoded by a cyclic polynucleotide having one or more spacer elements and / or one or more translation enhancers, where the translation enhancer is FcIgG ( Figure 33A ), TP53I3 ( Figure 33B ), LSP1( Figure 33C ) or histone 4E ( Figure 33D ).

[0138] Figures 34A-34D This is a bar graph showing the area under the curve for GFPd2 encoded by a cyclic polynucleotide with a translation enhancer, where the translation enhancer is TBR16 (…). Figure 34A ), 12S ( Figure 34B ), TRAM1 ( Figure 34C ) and GPX4 ( Figure 34D ).

[0139] Figures 35A-35D This is a bar graph showing the concentration of the polypeptide B-HiBiT encoded by a cyclic polynucleotide with a translation enhancer, where the translation enhancer is TBR16 ( Figure 35A ), 12S ( Figure 35B ), TRAM1 ( Figure 35C ) and GPX4 ( Figure 35D ). Detailed Implementation

[0140] This disclosure is characterized by compositions comprising polynucleotides having one or more expression-enhancing elements or spacer elements. The polynucleotides described herein are particularly useful for increasing the stability of polynucleotide cargoes (e.g., genes or proteins) encoded by polynucleotides and / or increasing their expression.

[0141] This disclosure provides a polynucleotide comprising a first post-cyclized element; a first expression-enhancing element of at least 100 ribonucleotides in length; a polynucleotide cargo; a second expression-enhancing element; and a second post-cyclized element; wherein the first post-cyclized element and the second post-cyclized element together form a cyclization junction. This disclosure also provides a polynucleotide having a first post-cyclized element; a first spacer element of at least 100 ribonucleotides in length; a polynucleotide cargo; a second spacer element; and a second post-cyclized element; wherein the first post-cyclized element and the second post-cyclized element together form a cyclization junction. This disclosure further provides a polynucleotide having a first post-cyclized element; a first spacer element; a polynucleotide cargo; a second spacer element of at least 100 ribonucleotides in length; and a second post-cyclized element; wherein the first post-cyclized element and the second post-cyclized element together form a cyclization junction.

[0142] The polynucleotide constructs described herein can exhibit increased stability, thereby potentially increasing the length of time that polynucleotides can survive before degradation. Additionally, the polynucleotide constructs described herein can exhibit increased expression of the polynucleotide cargo encoded by the polynucleotides. As those skilled in the art will understand, each of the DNA sequences described herein includes an RNA equivalent sequence. Similarly, as those skilled in the art will understand, all RNA sequences described herein include DNA equivalent sequences. The molecules, methods of production, and uses are described in more detail below.

[0143] Cyclic polynucleotide elements

[0144] The cyclic polynucleotide from 5' to 3' may include a first cyclized element; one or more expression-enhancing elements; a polynucleotide cargo; and a second cyclized element. In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; a polynucleotide cargo; one or more expression-enhancing elements; and a second cyclized element.

[0145] In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; a first expression-enhancing element; a polynucleotide cargo; a second expression-enhancing element; and a second cyclized element.

[0146] In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; a spacer element; a polynucleotide cargo; an expression-enhancing element; and a second cyclized element. In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; an expression-enhancing element; a polynucleotide cargo; a spacer element; and a second cyclized element. In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; a first expression-enhancing element; a polynucleotide cargo; a second expression-enhancing element; and a second cyclized element. In some embodiments, the cyclic polynucleotide from 5' to 3' includes a first cyclized element; a first spacer element with a length of at least 100 ribonucleotides; a polynucleotide cargo; a second spacer element; and a second cyclized element.

[0147] The cyclic polynucleotides disclosed herein comprise a first cyclized element; (b) a first spacer element having at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides). The cyclic polynucleotides disclosed herein also comprise a polynucleotide cargo and a second spacer element. In some embodiments, the second spacer element is at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides) in length. For example, the length of the second spacer element can be between 120 and 500 ribonucleotides (e.g., between 120 and 400, between 120 and 300, between 120 and 200, between 120 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500). In some embodiments, the length of the second spacer element is between 100 and 300 ribonucleotides (e.g., between 100 and 280, between 100 and 260, between 100 and 240, between 100 and 220, between 100 and 200, between 100 and 180, between 100 and 160, between 100 and 140, between 100 and 120, between 120 and 300, between 140 and 300, between 160 and 300, between 180 and 300, between 200 and 300, between 220 and 300, between 240 and 300, between 260 and 300, or between 280 and 300). In some embodiments, the length of the second spacer element is between 200 and 500 ribonucleotides (e.g., between 200 and 450, between 200 and 400, between 200 and 350, between 200 and 300, between 200 and 250, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, between 450 and 500, between 300 and 500, or between 300 and 400).

[0148] Expression enhancement element

[0149] The polynucleotides described herein may include one or more expression-enhancing elements. In some embodiments, the cyclic or linear polynucleotide includes between one and five expression-enhancing elements (e.g., 1, 2, 3, 4, or 5 expression-enhancing elements). For example, the cyclic or linear polynucleotide may include a first expression-enhancing element and a second expression-enhancing element. One or more expression-enhancing elements may include a translational enhancer, a stabilizing element, a translational enhancer fused (e.g., linked, connected) to a spacer element, or a stabilizing element fused (e.g., linked, connected) to a spacer element. In some embodiments, the cyclic or linear polynucleotide includes both a translational enhancer and a stabilizing element.

[0150] The polynucleotides described herein may comprise combinations of elements as described in Table 1 in a 5' to 3' sequence. One or more spacer elements may be contained between any of the elements described in Table 1.

[0151] Table 1. Exemplary Builders

[0152]

[0153] Spacer elements can be fused with the 5' or 3' end of translation enhancers or stabilizing elements to form translation enhancers.

[0154] The polynucleotides described herein may include a first expression enhancing element or a second expression enhancing element. The first expression enhancing element may include a translational enhancer. The second enhancing element may include a translational enhancer. In some embodiments, the cyclic or linear polynucleotides described herein include one or more translational enhancers. In some embodiments, translational enhancers may be fused (e.g., linked or connected) to spacer elements. Translational enhancers may be present between any nucleic acid elements described herein. Translational enhancers may also be present within nucleic acid elements described herein. In some embodiments, the translational enhancer is a spacer element. In some embodiments, the translational enhancer is a stabilizing element.

[0155] In some embodiments, the translation enhancer originates from a gene encoding an RNA-binding protein. In some embodiments, the translation enhancer comprises a nucleic acid sequence comprising a fragment from a gene encoding an RNA-binding protein. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% < 99%, or 100%) sequence identity with a nucleic acid sequence comprising a fragment from a gene encoding an RNA-binding protein. In some embodiments, the translation enhancer originates from genes encoding: BYDV-like elements (BTE), translation enhancer elements (TED), PMV / PEMV-like translation enhancers (PTE), I-shaped structures (ISS), Y-shaped structures (YSS), t-shaped structures (TSS), dumbbell-shaped structures, viral RNA UTRs (including dengue virus, West Nile virus, Zika virus, and rotavirus), EMCV, CVB3, hepatitis B virus post-transcriptional regulatory elements, human genome fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g aptamer sequences. In some embodiments, the translation enhancer element originates from a plant virus. In some embodiments, the translation enhancer comprises a nucleic acid sequence containing fragments from a plant virus. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% < 99%, or 100%) sequence identity with a nucleic acid sequence comprising a fragment from a plant virus. In some embodiments, the plant virus is a barley yellow dwarf virus (BYDV)-like element (BTE) translation enhancer. Non-limiting examples of plant viruses having BTEs include BYDV, TNVD, OLV1, LWSV, SCNMV, CRSV, TBTV, GRV, OMMV, BBSV, RSDaV, and OPMV. BTEs bind to eIF4g with high affinity. In specific embodiments, the cyclic or linear polynucleotide comprises the BTE sequence described in Table 2. In some embodiments, the BTE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO: 1-22 in Table 2.

[0156] In some embodiments, the translation enhancer element is derived from a plant virus containing TED. Non-limiting examples of plant viruses containing TED include STNV, PLPV, PCRPV, ELV, RrLDV, PelRSV, and CbMV. TED binds to eIF4F with high affinity. In specific embodiments, the cyclic or linear polynucleotide comprises the TED sequence described in Table 3. In some embodiments, the TED comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO:23-29 in Table 3.

[0157] In some embodiments, the translation enhancer element is derived from a plant virus containing a millet mosaic virus / pea rhizovirus (PMV / PEMV)-like translation enhancer (PTE). Non-limiting examples of plant viruses having a PTE include SCV, PFBV, CarMV, HnRSV, PSNV, HCRSV, GaMV, CMMV, TPAV, JINRV, PEMV2, PMV, MCMV, BGLV, AdMV, and CLSV. The PTE binds to eIF4E with high affinity. In specific embodiments, the cyclic or linear polynucleotide comprises the PTE sequence described in Table 4. In some embodiments, the PTE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO:30-46 of Table 4.

[0158] In some embodiments, the translation enhancer element is derived from a plant virus containing an ISS translation enhancer. Non-limiting examples of plant viruses containing an ISS include MNeSV, MNSV264, CBV, MWLMV, JCSMV, and GoMVA. The ISS binds to eIF4E, which binds to eIF4G. In specific embodiments, the cyclic or linear polynucleotide comprises the TSS sequence described in Table 5. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO:47-53 in Table 5.

[0159] In some embodiments, the translation enhancer element is derived from a plant virus containing a YSS translation enhancer. Non-limiting examples of plant viruses containing YSS include TBSV, CIRV, CymRSV, CNV, AMCV, PNSV, GALV, PLCV, PeLV, and LNV. YSS binds to eIF4F. In specific embodiments, the cyclic or linear polynucleotide comprises the YSS sequence described in Table 6. In some embodiments, the YSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO:54-63 in Table 6.

[0160] In some embodiments, the translation enhancer element is derived from a plant virus containing a TSS translation enhancer. Non-limiting examples of plant viruses containing a TSS include TYMV, RCNM, TCV, and CCFV. The TSS binds to the 60S ribosomal subunit. In specific embodiments, the cyclic or linear polynucleotide comprises the TSS sequence described in Table 7. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO:64-67 in Table 7.

[0161] In some embodiments, the translation enhancer element is derived from a plant virus containing a dumbbell-shaped translation enhancer. A non-limiting example of a plant virus having a dumbbell-shaped translation enhancer includes CABYV-X. In specific embodiments, the cyclic or linear polynucleotide comprises the dumbbell-shaped translation enhancer sequence described in SEQ ID NO:68 of Table 8. In some embodiments, the dumbbell-shaped enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequence from SEQ ID NO:68 of Table 8.

[0162] In some embodiments, the translation enhancer element is derived from a mammalian gene. In some embodiments, the translation enhancer comprises a nucleic acid sequence containing a fragment from a mammalian gene. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% < 99%, or 100%) sequence identity with a nucleic acid sequence containing a fragment from a mammalian gene. The mammalian gene can be, but is not limited to, histone or cyclin D mRNA sequences that bind to eIF4E. In some embodiments, the translation enhancer element is derived from a synthetic sequence, including but not limited to eIF4G aptamers that bind to eIF4G. In some embodiments, the translation enhancer element is derived from a viral sequence. Non-limiting examples of translation enhancers derived from viral sequences are HCV and DENV. In certain embodiments, the cyclic or linear polynucleotide comprises the mammalian, synthetic, or viral translation enhancers described in Table 8. In some embodiments, the mammalian, synthetic, or viral translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from SEQ ID NO: 68-159 and 273-287 in Table 8.

[0163] In certain embodiments, the cyclic or linear polynucleotide comprises the translation enhancer elements described in Tables 2-8. In some embodiments, the translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with the sequences from Tables 2-8.

[0164] In some embodiments, the translation enhancer comprises a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) sequence identity with any one of SEQ ID NO: 1-183, 255, 256, 273-287, 290-303, or 305-333) sequence identity. In some embodiments, the translation enhancer comprises a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) identity with any one of SEQ ID NO: 1-183, 255, 256, 273-287, 290-303, or 305-333. In some embodiments, the translation enhancer comprises a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) identity with any one of SEQ ID NO: 1-183, 255, 256, 273-287, 290-303, or 305-333. In some embodiments, the translation enhancer comprises a nucleic acid sequence having a nucleic acid sequence having any one of SEQ ID NO: 1-183, 255, 256, 273-287, 290-303 or 305-333.

[0165] In some embodiments, the translation enhancement sub-element may be TBR16, 12S, TRAM1, or GPX4.

[0166] The translation enhancer element can be a 5'UTR or a 3'UTR. In some embodiments, the 5'UTR or 3'UTR is a human translation enhancer. In some embodiments, the 5'UTR or 3'UTR includes any one or a portion of the 5'UTR or 3'UTR described in Table 9.

[0167] Translation enhancer elements can have between 20 and 750 ribonucleotides (e.g., between 20 and 700, between 20 and 650, between 20 and 600, between 20 and 550, between 20 and 500, between 20 and 450, between 20 and 400, between 20 and 350, between 20 and 300, between 20 and 250, between 20 and 200, between 20 and 150, between 20 and 100, between 20 and 50). (Ribosylnucleotides between 50 and 100, between 50 and 750, between 100 and 750, between 150 and 750, between 200 and 750, between 250 and 750, between 300 and 750, between 350 and 750, between 400 and 750, between 450 and 750, between 500 and 750, between 550 and 750, between 600 and 750, between 650 and 750, and between 700 and 750). For example, the length of the translation enhancer can be between 100 and 500 ribonucleotides (e.g., between 100 and 450, between 100 and 400, between 100 and 350, between 100 and 300, between 100 and 250, between 100 and 200, between 100 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, or between 450 and 500).

[0168] Table 2. BTE sequences

[0169]

[0170]

[0171]

[0172]

[0173] Table 3. TED Sequences

[0174]

[0175] Table 4. PTE Sequences

[0176]

[0177]

[0178] Table 5. ISS Sequences

[0179]

[0180] Table 6. YSS Sequences

[0181]

[0182]

[0183] Table 7. TSS Sequences

[0184]

[0185] Table 8. Other translation enhancer elements

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192] The expression enhancement element may include a translation enhancer fused with a spacer element. The spacer element may be concatenated to the 5' end of the translation enhancer. In some embodiments, the spacer element may be concatenated to the 3' end of the translation enhancer.

[0193] Stability element

[0194] The polynucleotides described herein may include a first expression-enhancing element, wherein the first expression-enhancing element may include a stabilizing element. A second expression-enhancing element may include a stabilizing element. A second spacer element may include an expression-enhancing element. One or more of the expression-enhancing elements may be stabilizing elements. In some embodiments, the stabilizing element is a translational enhancer. In some embodiments, the stabilizing element is a spacer element.

[0195] The stabilizing element can be a 5'UTR or a 3'UTR. In some embodiments, the 5'UTR or 3'UTR is a human UTR. In some embodiments, the 5'UTR or 3'UTR comprises any one or a portion of the 5'UTR or 3'UTR described in Table 9 below. The 5'UTR or 3'UTR can originate from genes encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, PSMD5, GPX4, or PRKAB1. The 5'UTR or 3'UTR can be a 5'UTR or 3'UTR derived from human β-actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or mitochondrial-encoded 12S rRNA.

[0196] The stabilizing element may comprise between 50 and 2000 ribonucleotides (e.g., between 50 and 1500, 50 and 1000, 50 and 500, 50 and 100, 100 and 2000, 500 and 2000, 1000 and 2000, or 1500 and 2000). The stabilizing element may comprise between 20 and 750 ribonucleotides (e.g., between 20 and 700, 20 and 650, 20 and 600, 20 and 550, 20 and 500, 20 and 450, 20 and 400, 20 and 350, 20 and 300, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 50). Nucleotides between 50 and 100, between 50 and 750, between 100 and 750, between 150 and 750, between 200 and 750, between 250 and 750, between 300 and 750, between 350 and 750, between 400 and 750, between 450 and 750, between 500 and 750, between 550 and 750, between 600 and 750, between 650 and 750, and between 700 and 750. For example, the length of the stabilizing element can be between 100 and 500 ribonucleotides (e.g., between 100 and 450, between 100 and 400, between 100 and 350, between 100 and 300, between 100 and 250, between 100 and 200, between 100 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, or between 450 and 500 ribonucleotides).

[0197] The expression enhancement element may include a stabilizing element fused with a spacer sub-element. The spacer sub-element may be concatenated to the 5' end of the stabilizing element. In some embodiments, a spacer sub-element that does not encode the expression enhancement element may be concatenated to the 3' end of the stabilizing element.

[0198] The stabilizing element can be any known stabilizing element. In some embodiments, the stabilizing element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 9. In some embodiments, the stabilizing element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 9. In some embodiments, the stabilizing element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 9. In some embodiments, the stabilizing element has a nucleic acid sequence of any of the sequences described in Table 9.

[0199] Table 9. Stability Element Sequence

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206] Non-translated area

[0207] In some embodiments, the cyclic or linear polynucleotide contains an untranslated region (UTR). In some embodiments, a stabilizing element may contain a UTR. In some embodiments, a translation enhancer may contain a UTR. In some embodiments, the UTR is a 3' UTR. In some embodiments, the UTR is a 5' UTR. A UTR comprising a genomic region of a gene may be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expressed sequence described herein. In some embodiments, the UTR may be included downstream of the expressed sequence described herein. In some cases, a UTR of the first expressed sequence is identical, continuous, or overlaps with another UTR of the second expressed sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, such as ZKSCAN1.

[0208] The exemplary untranslated section is described in paragraphs

[0197] -

[201] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0209] In some embodiments, the cyclic polynucleotide includes a polyA sequence. An exemplary polyA sequence is described in paragraphs

[0202] -

[0205] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety. In some embodiments, the cyclic polynucleotide lacks the polyA sequence.

[0210] In some embodiments, the cyclic or linear polynucleotide contains a UTR in which one or more segments of adenosine and uridine are embedded. These AU enrichment signatures may increase the conversion rate of the expression product.

[0211] The introduction, removal, or modification of AU-rich elements (AREs) in UTRs can be used to modulate the stability or immunogenicity of cyclic or linear polynucleotides (e.g., the levels of one or more markers of immune or inflammatory responses). When engineering specific cyclic polynucleotides, one or more copies of AREs can be introduced into the cyclic polynucleotide, and said copies of AREs can modulate the translation and / or production of the expression product. Similarly, AREs can be identified and removed or engineered into cyclic polynucleotides to modulate intracellular stability, thereby affecting the translation and production of the resulting protein.

[0212] It should be understood that any UTR from any gene can be incorporated into the corresponding flanking region of a cyclic polynucleotide.

[0213] In some embodiments, the cyclic polynucleotide lacks a 5'-UTR and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks a 3'-UTR and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks a poly-A sequence and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks a termination element and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks an internal ribosome entry site and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks a cap and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide lacks a 5'-UTR, 3'-UTR, and IRES and is capable of expressing a protein from one or more of its expression sequences. In some embodiments, the cyclic or linear polynucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding a foreign gene, a sequence encoding a therapeutic agent, a regulatory element (e.g., a translation regulator, such as a translation enhancer or repressor), a translation initiation sequence, one or more regulatory nucleic acids targeting endogenous genes (e.g., siRNA, lncRNA, shRNA), and a sequence encoding a therapeutic mRNA or protein.

[0214] In some embodiments, the cyclic or linear polynucleotide lacks a 5'-UTR. In some embodiments, the cyclic polynucleotide lacks a 3'-UTR. In some embodiments, the cyclic polynucleotide lacks a poly-A sequence. In some embodiments, the cyclic or linear polynucleotide lacks a termination element. In some embodiments, the cyclic or linear polynucleotide lacks an internal ribosome entry site. In some embodiments, the cyclic or linear polynucleotide lacks susceptibility to degradation by exonucleases. In some embodiments, the fact that the cyclic polynucleotide lacks degradation susceptibility may mean that the cyclic polynucleotide is not degraded by exonucleases, or that the limited degree of degradation in the presence of exonucleases alone is comparable to or similar to that in the absence of exonucleases. In some embodiments, the cyclic polynucleotide is not degraded by exonucleases. In some embodiments, the degradation of the cyclic polynucleotide is reduced upon exposure to exonucleases. In some embodiments, the cyclic polynucleotide lacks binding to a cap-binding protein. In some embodiments, the cyclic polynucleotide lacks a 5' cap.

[0215] Spacer element

[0216] In some embodiments, the polynucleotide comprises one or more spacer elements. For example, a first expression-enhancing element or a second expression-enhancing element may comprise a spacer element fused to a translational enhancer or a spacer element fused to a stabilizing element. In some embodiments, the spacer may be fused to the 5' end of a translational enhancer or a stabilizing element. In some embodiments, the spacer may be fused to the 3' end of a translational enhancer or a stabilizing element. In some embodiments, the spacer element is a translational enhancer. Not all spacers are translational enhancers. In some embodiments, the spacer element is a stabilizing element. Not all spacers are stabilizing elements. A spacer element refers to any continuous nucleotide sequence (e.g., a continuous nucleotide sequence of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. Spacer elements may be present between any nucleic acid elements described herein. Spacer elements may also be present within nucleic acid elements described herein. A cyclic polynucleotide may comprise a first cyclized element; a first spacer element of at least 100 ribonucleotides in length; a polynucleotide cargo; a second spacer element; and a second cyclized element; and wherein the first cyclized element and the second cyclized element together form a cyclization junction. The cyclic polynucleotide may include a first cyclized element; a first spacer element; a polynucleotide cargo; a second spacer element having a length of at least 100 ribonucleotides; and a second cyclized element; wherein the first cyclized element and the second cyclized element together form a cyclization junction.

[0217] In some embodiments, the length of the spacer element is at least 100 ribonucleotides. The length of the spacer element can be between 100 and 500 ribonucleotides (e.g., between 100 and 400, between 100 and 300, between 100 and 200, between 200 and 500, between 300 and 500, between 400 and 500, between 200 and 400, or between 200 and 300). For example, the length of the spacer sub-elements that do not contain expression-enhancing elements can be between 120 and 500 (e.g., between 120 and 400, between 120 and 300, between 120 and 200, between 120 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500). In some embodiments, the spacer element comprises between 110 and 500 ribonucleotides (e.g., between 110 and 400, between 110 and 300, between 110 and 200, between 110 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500). In some embodiments, the spacer element comprises between 100 and 300 ribonucleotides (e.g., between 100 and 280, between 100 and 260, between 100 and 240, between 100 and 220, between 100 and 200, between 100 and 180, between 100 and 160, between 100 and 140, between 100 and 120, between 110 and 300, between 120 and 300, between 140 and 300, between 160 and 300, between 180 and 300, between 200 and 300, between 220 and 300, between 240 and 300, between 260 and 300, or between 280 and 300). In some embodiments, the length of the spacer element is between 200 and 500 ribonucleotides (e.g., between 200 and 450, 200 and 400, 200 and 350, 200 and 300, 200 and 250, 250 and 500, 300 and 500, 350 and 500, 400 and 500, 450 and 500, 300 and 500, or 300 and 400). In some embodiments, the spacer element has at least 50 ribonucleotides.For example, spacer elements may have between 50 and 500 ribonucleotides (e.g., between 50 and 100, between 50 and 150, between 50 and 200, between 50 and 250, between 50 and 300, between 50 and 350, between 50 and 400, between 50 and 450, between 100 and 500, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, and between 450 and 500).

[0218] In some embodiments, the length of the spacer element is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55) ribonucleotides. In some embodiments, the length of the spacer element is about 80 (e.g., 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, or 88) ribonucleotides. In some embodiments, the length of the spacer element is about 100 (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110) ribonucleotides. In some embodiments, the length of the spacer element is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 or 132) ribonucleotides. In some embodiments, the length of the spacer element is about 150 (e.g., 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164 or 165) ribonucleotides. In some embodiments, the length of the spacer element is about 200 (e.g., 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, or 220) ribonucleotides.

[0219] In some embodiments, the polynucleotide comprises a first spacer element and a second spacer element, wherein the first and second spacers are of the same length. In some embodiments, the first and second spacer elements are substantially the same length.

[0220] In some embodiments, the polynucleotide comprises a first spacer element and a second spacer element, wherein the first spacer element and the second spacer element have different lengths. In some embodiments, the difference between the length of the first spacer element and the length of the second region is 0 to 100 (e.g., 0 to 95, 0 to 90, 0 to 85, 0 to 80, 0 to 75, 0 to 70, 0 to 65, 0 to 60, 0 to 55, 0 to 50, 0 to 45, 0 to 40, 0 to 35, 0 to 30, 0 to 25, 0 to 20, 0 to 15, 0 to 10, 0 to 5, 5). (up to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 100, 75 to 100, 80 to 100, 85 to 100, 90 to 100 or 95 to 100) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides. In some embodiments, the length of the first spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55) ribonucleotides, and the length of the second spacer is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 or 132) ribonucleotides. In some embodiments, the length of the first spacer is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 or 132) ribonucleotides, and the length of the second spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55) ribonucleotides.

[0221] In some embodiments, the spacer sub-element can be a poly-A based spacer or a poly-A based spacer sub-element. In some embodiments, the first spacer is a poly-A based spacer or a poly-A based spacer sub-element. In some embodiments, the second spacer is a poly-A based spacer or a poly-A based spacer sub-element. In some embodiments, the first spacer and the second spacer can be poly-A based spacers or poly-A based spacer sub-element. A poly-A based spacer or a poly-A based spacer sub-element is equivalent to a poly-A region (e.g., a poly-AC region, a poly-AU region, a poly-AG region, or a poly-AT region), as described herein.

[0222] The first spacer element may consist of a polyA region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine residues. The first spacer element may also consist of a polyAC region containing between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine or cytosine residues. Adenosine and cytosine residues may be present in any ratio to each other. In some embodiments, the first spacer element may be composed of a polyAU region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. In some embodiments, the first spacer element may be composed of a polyAG region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. Adenosine and guanosine residues may be present in any ratio to each other. In some embodiments, the first spacer element may consist of a polyAT region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine or thymidine residues. Adenosine and thymidine residues may be present in any ratio to each other. In some embodiments, the first spacer element comprises a polyAT region containing between 100 and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides).

[0223] The second spacer element may be composed of a poly-A region containing 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine residues. The second spacer element may also be composed of a poly-AC region containing between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine or cytosine residues. In some embodiments, the second spacer element may consist of a poly-AU region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine or uridine residues. Adenosine and uridine residues may be present in any ratio to each other. In some embodiments, the second spacer element may be composed of a poly-AG region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. Adenosine and guanosine residues may be present in any ratio to each other. In some embodiments, the first spacer element may consist of a polyAT region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of adenosine or thymidine residues. In some embodiments, the second spacer element comprises a polyAT region containing between 100 and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides). Adenosine and thymidine residues may be present in any ratio to each other.

[0224] In some embodiments, the spacer element sequence may be a polyA region (e.g., polyAT, polyAU, polyAC, or polyAG) or a random sequence. In some embodiments, the spacer element may be referred to based on a combination of nucleotide content and length. For example, the AU120 spacer element may consist of a polyAU region containing between 80% and 100% adenosine or uridine residues and having a length of 120 nucleotides.

[0225] In some embodiments, the spacer element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity with any of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence of any one of the sequences described in Table 10.

[0226] Table 10. Sequence of Spacer Sub-elements

[0227]

[0228] An exemplary sequence of spacer elements is described in paragraphs

[0293] -

[0302] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0229] Internal ribosome entry site

[0230] In some embodiments, the cyclic or linear polynucleotides described herein comprise one or more internal ribosome entry site (IRES) elements. In some embodiments, the IRES is operatively linked to one or more expression sequences (e.g., each IRES is operatively linked to one or more expression sequences, wherein each expression sequence optionally encodes a polypeptide). In embodiments, the IRES is located between the heterologous promoter and the 5' end of the coding sequence.

[0231] Suitable IRES elements contained in polynucleotides include RNA sequences capable of binding to eukaryotic ribosomes. In some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.

[0232] In some embodiments, the IRES element is derived from the DNA of an organism, including but not limited to viruses, mammals, and fruit flies. Such viral DNA can be derived from, but is not limited to, complementary DNA (cDNA) of small RNA viruses, encephalomyocarditis virus (EMCV) cDNA, and poliovirus cDNA. In one embodiment, the IRES element is derived from the antennal leg gene of the fruit fly *Drosophila melanogaster*.

[0233] In some embodiments, the IRES sequence is the IRES sequence of the following viruses: Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, reticuloendothelial proliferative virus, human poliovirus 1, Plautia stall intestine virus, Kashmir bee virus, human rhinovirus 2 (HRV-2), Homalodisca coagulata virus-1, human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinitis virus, and tea geometrid moth. Calicivirus (obliqua), Encephalomyocarditis Virus (EMCV), Drosophila C virus, Crucifera tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus (AEV), Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennae (Drosophila) Antennapedia), human AQP4, human AT1R, human BAG-l, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-l, mouse Rbm3, Drosophila reaper, canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XI AP, Salivirus, Cosavirus, Parechovirus, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-l, simian small RNA virus, turnip shrunken virus, Aichi virus, Crohivirus, echovirus 11, eIF4G aptamer, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2).In yet another embodiment, IRES is the IRES sequence of Coxsackievirus B3 (CVB3). In yet another embodiment, IRES is the IRES sequence of encephalomyelitis virus. In yet another embodiment, IRES is the IRES sequence of Tillerson encephalomyelitis virus.

[0234] In some embodiments, the IRES sequence has a modified sequence compared to the wild-type IRES sequence. In some embodiments, when the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence is modified to be a cytosine residue. For example, the IRES sequence can be a CVB3 IRES sequence, wherein the terminal adenosine residue is modified to a cytosine residue. In some embodiments, the modified CVB3IRES may have the following nucleic acid sequence:

[0235] (SEQ ID NO:184)

[0236] In some embodiments, the IRES sequence is an enterovirus 71 (EV17) IRES. In some embodiments, the terminal guanosine residues of the EV17 IRES sequence are modified with cytosine residues. In some embodiments, the modified EV71 IRES may have the following nucleic acid sequence:

[0237] UUAAAACAGCUGUGGGUUGUCACCCACCCACAGGGUCCACUGGGCGCUAGUACACUGGUAUCUCGGUACCUUUGUACGCCUGUUUUAUACCCCCUCCCUGAUUUGCAACUUAGAAGCAACGCAAACCAGAUCAAUAGUAGGUGUGACAUACCAGUCGCAUCUUGAUCAAGCACUUCUGUAUCCCCGGACCGAGUAUCAAUAGACUGUGCACACGGUUGAAGGAGAAAACGUCCGUUACCCGGCUAACUACUUCGAGAAGCCUAGUAACGCCAUUGAAGUUGCAGAGUGUUUCGCUCAGCACUCCCCCCGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGCGGCCUGCCUAUGGGGUAACCCAUAGGACGCUCUAAUACGGACAUGGCGUGAAGAGUCUAUUGAGCUAGUUAGUAGUCCUCCGGCCCCUGAAUGCGGCUAAUCCUAACUGCGGAGCACAUACCCUUAAUCCAAAGGGCAGUGUGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCCGUGUUUCUUUUUAUUCUUGUAUUGGCUGCUUAUGGUGACAAUUAAAGAAUUGUUACCAUAUAGCUAUUGGAUUGGCCAUCCAGUGUCAAACAGAGCUAUUGUAUAUCUCUUUGUUGGAUUCACACCUCUCACUCUUGAAACGUUACACACCCUCAAUUACAUUAUACUGCUGAACACGAAGCGGCCACC(SEQID NO:185)

[0238] In some embodiments, the IRES sequence is a synthetic IRES. A “synthetic IRES” is an IRES modified relative to a wild-type IRES to regulate its structure and / or activity. For example, in some embodiments, an IRES modified to incorporate an aptamer sequence is a synthetic IRES. In some embodiments, the polynucleotide comprises at least one IRES flanked by at least one (e.g., 2, 3, 4, 5, or more) expression sequences. In some embodiments, the IRES is flanked by at least one (e.g., 2, 3, 4, 5, or more) expression sequences. In some embodiments, the polynucleotide comprises one or more IRES sequences on one or both sides of each expression sequence, resulting in the separation of one or more peptides and / or one or more polypeptides. For example, the polynucleotide described herein may comprise a first IRES operatively linked to a first expression sequence and a second IRES operatively linked to a second expression sequence.

[0239] In some embodiments, the polynucleotides described herein comprise IRES (e.g., IRES operatively linked to a coding region). For example, polynucleotides can contain any IRES as described in the following: Chen et al. Nature Biotechnology 41:262-272, 2023; Chen et al. Mol. Cell 81(20):4300-4318, 2021; Jopling et al. Oncogene 20:2664-2670, 2001; Baranick et al. PNAS 105(12):4733-4738, 2008; Lang et al. Molecular Biology of the Cell 13(5):1792-1801, 2002; Dorokhov et al. PNAS 99(8):5301-5306, 2002; Wang et al. Nucleic Acids Nucleic Acids Research 33(7):2248-2258, 2005; Petz et al. Nucleic Acids Research 35(8):2473-2482, 2007; Chen et al. Science 268:415-417, 1995; Fan et al. Nature Communications 13(1):3751-3765, 2022, International Publication No. WO 2021 / 263124 and International Publication No. WO 2022 / 271965, which are hereby incorporated in full by reference.

[0240] signal sequence

[0241] In some embodiments, the polypeptides expressed by the cyclic or linear polynucleotides disclosed herein comprise secretory proteins, such as proteins that naturally contain a signal sequence, or proteins that do not typically encode a signal sequence but are modified to contain a signal sequence. In some embodiments, one or more polypeptides contain a secretory signal. For example, the secretory signal may be a naturally encoded secretory signal of a secretory protein. In another instance, the secretory signal may be a modified secretory signal of a secretory protein. In other embodiments, one or more polypeptides do not contain a secretory signal.

[0242] In some embodiments, the polynucleotide encodes multiple copies of the same polypeptide (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more). In some embodiments, at least one copy of the polypeptide contains a signal sequence, and at least one copy of the polypeptide does not contain a signal sequence. In some embodiments, the cyclic polynucleotide encodes multiple polypeptides, wherein at least one of the multiple polypeptides contains a signal sequence, and at least one copy of the multiple polypeptides does not contain a signal sequence.

[0243] In some embodiments, the signal sequence is a wild-type signal sequence, which is present at the N-terminus of the corresponding wild-type polypeptide, for example, when endogenously expressed. In some embodiments, the signal sequence is heterologous to the polypeptide, for example, it is not present when the wild-type polypeptide is endogenously expressed. The polynucleotide sequence encoding the polypeptide can be modified to remove the nucleotide sequence encoding the wild-type signal sequence and / or add a sequence encoding the heterologous signal sequence.

[0244] The encoded polypeptide may include a signal sequence that directs the polypeptide to the secretion pathway. In some embodiments, the signal sequence may direct the polypeptide to reside in certain organelles (e.g., the endoplasmic reticulum, Golgi apparatus, or endosomes). In some embodiments, the signal sequence directs the polypeptide to be secreted from the cell. For secreted proteins, the signal sequence may be cleaved post-secretion to produce a mature protein. In other embodiments, the signal sequence may be embedded in the cell membrane or certain organelles to create a transmembrane segment that anchors the protein to the cell membrane, endoplasmic reticulum, or Golgi apparatus. In some embodiments, the signal sequence for a transmembrane protein is a short sequence at the N-terminus of the polypeptide. In other embodiments, a first transmembrane domain acts as a first signal sequence to target the protein to the membrane.

[0245] In some embodiments, the secretion signal is a human interleukin-2 (IL-2) secretion signal. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 90% sequence identity to MYRMQLLSCIALSLALVTNS (SEQ ID NO: 186). In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 186.

[0246] In some embodiments, the secretion signal is a Gaussian luciferase secretion signal. In some embodiments, the Gaussian luciferase secretion signal has an amino acid sequence having at least 90% sequence identity with MGVKVLFALICIAVAEAK (SEQ ID NO: 187). In some embodiments, the Gaussian luciferase secretion signal has an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 187. In some embodiments, the Gaussian luciferase secretion signal has an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 187. In some embodiments, the Gaussian luciferase secretion signal has an amino acid sequence having 100% sequence identity with SEQ ID NO: 187.

[0247] In some embodiments, the secretion signal is an EPO (e.g., human EPO) secretion signal. In some embodiments, the EPO secretion signal has an amino acid sequence having at least 90% sequence identity with MGVHECPAWLWLLLSLLSLPLGLPVLGA (SEQ ID NO: 188). In some embodiments, the EPO secretion signal has an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 188. In some embodiments, 88. In some embodiments, the EPO secretion signal has an amino acid sequence having 100% sequence identity with SEQ ID NO: 188.

[0248] In some embodiments, the secretion signal is a wild-type SARS-CoV-2 secretion signal. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence with at least 90% sequence identity to MFVFLVLLPLVSS (SEQ ID NO:189). In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO:189. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO:189. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO:189.

[0249] In some embodiments, the polypeptide encoded by the polynucleotide contains a secretion signal sequence, a transmembrane insertion signal sequence, or does not contain a signal sequence.

[0250] Control element

[0251] In some embodiments, the polynucleotides described herein (e.g., polynucleotide cargoes) include one or more regulatory elements. In some embodiments, the polynucleotide contains regulatory elements, such as sequences that modify the expression of an expression sequence within the polynucleotide.

[0252] A regulatory element may comprise a sequence adjacent to the expression sequence encoding the expressed product. The regulatory element may be operatively linked to the adjacent sequence. The regulatory element may increase the amount of expressed product compared to the amount expressed in the absence of the regulatory element. The regulatory element may be used to increase the expression of one or more polypeptides encoded by a polynucleotide. Similarly, the regulatory element may be used to decrease the expression of one or more polypeptides encoded by a polynucleotide. In some embodiments, one regulatory element is used to increase the expression of a polypeptide, while another regulatory element is used to decrease the expression of another polypeptide on the same polynucleotide. Additionally, a regulatory element may increase the amount of product expressed by multiple tandemly attached expression sequences. Thus, a regulatory element may enhance the expression of one or more expression sequences. Multiple regulatory elements may also be used, for example, to differentially regulate the expression of different expression sequences.

[0253] In some embodiments, the regulatory element is a translation regulator. A translation regulator can modulate the translation of an expressed sequence in a polynucleotide. A translation regulator can be a translation enhancer or a translation repressor. In some embodiments, the polynucleotide contains at least one translation regulator adjacent to at least one expressed sequence. In some embodiments, the polynucleotide contains a translation regulator adjacent to each expressed sequence. In some embodiments, the translation regulator is present on one or both sides of each expressed sequence, resulting in the separation of expression products, such as one or more peptides and / or one or more polypeptides.

[0254] In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.

[0255] In some embodiments, regulatory elements, as provided herein, include selective translation sequences. As used herein, the term "selective translation sequence" refers to a nucleic acid sequence that selectively initiates or activates the translation of an expression sequence in a polynucleotide, such as certain riboswitch aptamers. Regulatory elements may also include selective degradation sequences. As used herein, the term "selective degradation sequence" refers to a nucleic acid sequence that initiates the degradation of a polynucleotide or polynucleotide expression product. In some embodiments, the regulatory element is a translation regulator. A translation regulator can regulate the translation of an expression sequence in a polynucleotide. A translation regulator can be a translation enhancer or a translation repressor. In some embodiments, a translation initiation sequence can act as a regulatory element.

[0256] In some embodiments, the polynucleotide produces stoichiometric ratios of expression products. Rolling circle translation continuously produces expression products at substantially equal ratios. In some embodiments, the polynucleotide has stoichiometric translation efficiency such that expression products are produced at substantially equal ratios. In some embodiments, the polynucleotide has stoichiometric translation efficiencies for multiple expression products (e.g., products from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more expression sequences). In some embodiments, the polynucleotide produces expression products at substantially different ratios. For example, the translation efficiencies of the multiple expression products may have ratios such as 1:10,000, 1:7000, 1:5000, 1:1000, 1:700, 1:500, 1:100, 1:50, 1:10, 1:5, 1:4, 1:3 or 1:2. In some embodiments, regulatory elements may be used to modify the ratios of the multiple expression products.

[0257] Other examples of control elements are described in paragraphs

[0154] -

[0161] of International Patent Publication No. WO 2019 / 118919, which are hereby incorporated by reference in their entirety.

[0258] Cutting structural domain

[0259] The cyclic or linear polynucleotides disclosed herein may contain cleavage domains (e.g., interleaved elements or cleavage sequences).

[0260] As used herein, the term "interlacing element" is a portion, such as a nucleotide sequence, that induces ribosome pausing during translation. In some embodiments, an interlacing element is a non-conserved sequence of an amino acid with a strong α-helical tendency, followed by the conserved sequence -D(V / I)ExNPGP (SEQ ID NO:190), where x = any amino acid. In some embodiments, the interlacing element may comprise a chemical portion, such as glycerol, a non-nucleic acid linker, a chemical modification, a modified nucleic acid, or any combination thereof.

[0261] In some embodiments, the cyclic or linear polynucleotide includes at least one interleaving element adjacent to the expressed sequence. In some embodiments, the cyclic or linear polynucleotide includes an interleaving element adjacent to each expressed sequence. In some embodiments, the interleaving element is present on one or both sides of each expressed sequence, resulting in separation of the expressed products. In some embodiments, the interleaving element is part of one or more expressed sequences. In some embodiments, the cyclic or linear polynucleotide includes one or more expressed sequences, and each of the one or more expressed sequences is separated from a subsequent expressed sequence by an interleaving element on the cyclic or linear polynucleotide. In some embodiments, the interleaving element prevents (a) two rounds of translation of a single expressed sequence or (b) one or more rounds of translation of two or more expressed sequences to generate a single polypeptide. In some embodiments, the interleaving element is a sequence separated from the one or more expressed sequences. In some embodiments, the interleaving element includes a portion of the expressed sequence of the one or more expressed sequences.

[0262] Examples of interleaved elements are described in paragraphs

[0172] -

[0175] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0263] To avoid the generation of continuous expression products while maintaining rolling circle translation, interleaving elements may be included to induce ribosome arrest during translation. In some embodiments, the interleaving element is located at the 3' end of at least one of one or more expression sequences. The interleaving element may be configured to cause ribosome arrest during rolling circle translation of cyclic or linear polynucleotides. The interleaving element may include, but is not limited to, 2A-like or CHYSEL (SEQ ID NO: 191) (cis-acting hydrolase element) sequences. In some embodiments, the interleaving element encodes a sequence having a C-terminal common sequence of X1X2X3EX5NPGP, wherein X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid (SEQ ID NO: 192). Some non-limiting examples of interleaved elements include GDVESNPGP (SEQ ID NO:193), GDIEENPGP (SEQ ID NO:194), VEPNPGP (SEQ ID NO:195), IETNPGP (SEQ ID NO:196), GDIESNPGP (SEQ ID NO:197), GDVELNPGP (SEQ ID NO:198), GDIETNPGP (SEQ ID NO:199), GDVENPGP (SEQ ID NO:200), GDVEENPGP (SEQ ID NO:201), GDVEQNPGP (SEQ ID NO:202), IESNPGP (SEQ ID NO:203), GDIELNPGP (SEQ ID NO:204), HDIETNPGP (SEQ ID NO:205), HDVETNPGP (SEQ ID NO:206), HDVEMNPGP (SEQ ID NO:207), GDMESNPGP (SEQ ID NO:208), and GDVETNPGP (SEQ ID NO:199). NO:209), GDIEQNPGP (SEQ ID NO:210) and DSEFNPGP (SEQ ID NO:211).

[0264] In some embodiments, the interleaving element described herein cleaves the expression product, such as between G and P in the shared sequence described herein. As a non-limiting example, a cyclic or linear polynucleotide includes at least one interleaving element to cleave the expression product. In some embodiments, the cyclic or linear polynucleotide includes an interleaving element adjacent to at least one expression sequence. In some embodiments, the cyclic or linear polynucleotide includes an interleaving element following each expression sequence. In some embodiments, the cyclic or linear polynucleotide includes an interleaving element present on one or both sides of each expression sequence, resulting in the translation of one or more individual peptides and / or polypeptides by each expression sequence.

[0265] In some embodiments, the interleaving element comprises one or more modified or non-natural nucleotides that induce ribosome pausing during translation. Non-natural nucleotides may include peptide nucleic acids (PNAs), morpholino and locked nucleic acids (LNAs), and glycol nucleic acids (GNAs) and threononucleotides (TNAs). Examples of such nucleotides differ from naturally occurring DNA or RNA by altering the molecular backbone. Exemplary modifications may include modifications to sugars, nucleotide bases, internucleotide bonds (e.g., modifications to the phosphate / phosphodiester bond / phosphodiester backbone), and any combination thereof that can induce ribosome pausing during translation. Some of the exemplary modifications provided herein are described elsewhere herein.

[0266] In some embodiments, the interleaving element is present in other forms within the cyclic or linear polynucleotide. For example, in some exemplary cyclic or linear polynucleotides, the interleaving element includes a terminating element of a first expressed sequence in the cyclic or linear polynucleotide and a nucleotide spacer sequence separating the terminating element from a first translation initiation sequence subsequently expressed by the first expressed sequence. In some instances, the first interleaving element of the first expressed sequence is upstream (5') of the first translation initiation sequence subsequently expressed by the first expressed sequence in the cyclic or linear polynucleotide. In some cases, the first expressed sequence and the subsequent expressed sequence are two separate expressed sequences in the cyclic or linear polynucleotide. The distance between the first interleaving element and the first translation initiation sequence allows for sequential translation of the first expressed sequence and its subsequent expressed sequence. In some embodiments, the first interleaving element includes a terminating element and separates the expression product of the first expressed sequence from the expression product of its subsequent expressed sequence, thereby producing discrete expression products. In some cases, a circular or linear polynucleotide containing a first interleaving element upstream of the first translation initiation sequence of a subsequent expression sequence is translated sequentially, while a corresponding circular or linear polynucleotide containing an interleaving element of the second expression sequence upstream of the second translation initiation sequence of a subsequent expression sequence is not translated sequentially. In some cases, only one expression sequence exists in the circular or linear polynucleotide, and the first expression sequence and its subsequent expression sequence are the same expression sequence. In some exemplary circular or linear polynucleotides, the interleaving element contains a first termination element of the first expression sequence in the circular or linear polynucleotide, and a nucleotide spacer sequence separating the termination element from the downstream translation initiation sequence. In some such instances, the first interleaving element in the circular or linear polynucleotide is upstream (5') of the first translation initiation sequence of the first expression sequence. In some cases, the distance between the first interleaving element and the first translation initiation sequence allows for sequential translation of the first expression sequence and any subsequent expression sequence. In some embodiments, the first interleaving element separates one round of expression product of the first expression sequence from the next round of expression product of the first expression sequence, thereby producing discrete expression products. In some cases, cyclic or linear polynucleotides containing the first interleaving element upstream of the first translation initiation sequence of the first expression sequence in a cyclic or linear polynucleotide are translated sequentially, while corresponding cyclic or linear polynucleotides containing the interleaving element upstream of the second translation initiation sequence of the corresponding cyclic or linear polynucleotide are not translated sequentially. In some cases, the distance between the second interleaving element and the second translation initiation sequence in the corresponding cyclic or linear polynucleotide is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times the distance between the first interleaving element and the first translation initiation sequence in the cyclic or linear polynucleotide.In some cases, the distance between the first interleaving element and the first translation start is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt or greater. In some embodiments, the distance between the second interleaving element and the second translation initiation is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or greater than the distance between the first interleaving element and the first translation initiation. In some embodiments, the cyclic or linear polynucleotide comprises more than one expression sequence.

[0267] In some embodiments, multiple expression sequences encoded by cyclic ribonucleotides may be separated by IRES between each expression sequence. For example, the cyclic polynucleotide may include a first IRES operatively linked to a first expression sequence and a second IRES operatively linked to a second expression sequence. The IRES between all expression sequences may be the same. The IRES between expression sequences may be different.

[0268] In some embodiments, multiple expression sequences may be separated by a 2A self-cleaving peptide. For example, a cyclic polynucleotide may encode an IRES operatively linked to an open reading frame encoding a first expression sequence, 2A, and a second expression sequence. In some embodiments, 2A may have the sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 212).

[0269] In some embodiments, multiple expression sequences may be separated by protease cleavage sites (e.g., furin cleavage sites). For example, a cyclic polynucleotide may encode an IRES operatively linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., furin cleavage site), and a second expression sequence. In some embodiments, the furin cleavage site may have a GRLRR sequence (SEQ ID NO: 213).

[0270] In some embodiments, multiple expression sequences may be separated by a 2A self-cleaving peptide and a protease cleavage site (e.g., a furin cleavage site). For example, a cyclic polynucleotide may encode an IRES operatively linked to an open reading frame encoding a first expression sequence, 2A, a protease cleavage site (e.g., a furin cleavage site), and a second expression sequence. The cyclic polynucleotide may also encode an IRES operatively linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., a furin cleavage site), 2A, and a second expression sequence. A tandem 2A and furin cleavage site may be referred to as furin-2A (which includes furin-2A or 2A-furin protease arranged in either orientation).

[0271] Furthermore, multiple expression sequences encoded by cyclic ribonucleotides can be separated by both the IRES and 2A sequences. For example, the IRES can be between one expression sequence and a second expression sequence, while the 2A peptide can be between the second and a third expression sequence. The selection of a specific IRES or 2A self-cleaving peptide can be used to control the expression level of the expression sequence under the control of the IRES or 2A sequence. For example, depending on the selected IRES and / or 2A peptide, expression on the peptide can be higher or lower.

[0272] In some embodiments, the cyclic or linear polynucleotide includes at least one cleavage sequence. In some embodiments, the cleavage sequence is adjacent to the expression sequence. In some embodiments, the cleavage sequence is between two expression sequences. In some embodiments, the cleavage sequence is included in the expression sequence. In some embodiments, the cyclic or linear polynucleotide includes between 2 and 10 cleavage sequences. In some embodiments, the cyclic or linear polynucleotide includes between 2 and 5 cleavage sequences. In some embodiments, multiple cleavage sequences are between multiple expression sequences; for example, the cyclic or linear polynucleotide may include three expression sequences and two cleavage sequences, such that there is one cleavage sequence between each expression sequence. In some embodiments, the cyclic or linear polynucleotide includes a cleavage sequence, such as in a sacrificial circRNA, a cleavable circRNA, or a self-cleaving circRNA. In some embodiments, the cyclic or linear polynucleotide includes two or more cleavage sequences, resulting in the separation of the cyclic or linear polynucleotide into multiple products, such as miRNA, linear RNA, smaller cyclic or linear polynucleotides, etc.

[0273] In some embodiments, the cleavage sequence includes a ribozyme RNA sequence. Ribozymes (derived from ribonucleases, also known as RNases or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze the hydrolysis of one of their own phosphodiester bonds, or catalyze the hydrolysis of bonds in other RNAs, but natural ribozymes have also been found to catalyze aminotransferase activity in ribosomes. Catalytic RNAs can be “evolved” through in vitro methods. Similar to the riboswitching activity discussed above, ribozymes and their reaction products can regulate gene expression. In some embodiments, the catalytic RNA or ribozyme can be contained within a larger non-coding RNA, allowing the ribozyme to exist in many copies within the cell for the purpose of chemically transforming large molecules. In some embodiments, both the aptamer and the ribozyme can be encoded in the same non-coding RNA.

[0274] In some embodiments, the cleavage sequence encodes a cleavable peptide adapter. For example, a polynucleotide may encode two or more expression sequences encoded by a single open reading frame (ORF). For example, two or more expression sequences may be encoded by a single open reading frame whose expression is controlled by IRES. In some embodiments, the ORF further encodes a peptide adapter, for example, such that the expression product of the ORF encodes two or more expression sequences, each expression sequence being separated by a sequence encoding a peptide adapter (e.g., a adapter of 5-200, 5-100, 5-50, 5-20, 50-100, or 50-200 amino acids). The peptide adapter may include a cleavage site, such as a cleavage site recognized and cleaved by a protease (e.g., an endogenous protease in a subject after administration of the polynucleotide). In such embodiments, a single expression product comprising the amino acid sequences of two or more expression sequences is cleaved upon expression, thereby separating the two or more expression sequences post-expression. Exemplary protease cleavage sites are known to those skilled in the art, for example, amino acid sequences that serve as protease cleavage sites recognized by metalloproteinases (e.g., matrix metalloproteinases (MMPs), such as any one or more of MMPs 1-28), disintegrin and metalloproteinases (ADAMs, such as any one or more of ADAMs 2, 7-12, 15, 17-23, 28-30, and 33), serine proteases, urokinase-type plasminogen activators, matriptases, cysteine ​​proteases, aspartic proteases, or cathepsins. In some embodiments, the protease is MMP9 and / or MMP2. In some embodiments, the protease is a matriptase.

[0275] In some embodiments, the cyclic or linear polynucleotides described herein are sacrificial cyclic or linear polynucleotides, cleavable cyclic or linear polynucleotides, or self-cleavable cyclic or linear polynucleotides. Circular or linear polynucleotides can deliver cellular components, including, for example, RNA, lncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA. In some embodiments, the cyclic or linear polynucleotide comprises miRNAs separated by: (i) a self-cleavable element; (ii) a cleavage recruitment site; (iii) a degradable adapter; (iv) a chemical adapter; and / or (v) a spacer element sequence. In some embodiments, the circRNA comprises siRNAs separated by: (i) a self-cleavable element; (ii) a cleavage recruitment site (e.g., ADAR); (iii) a degradable adapter (e.g., glycerol); (iv) a chemical adapter; and / or (v) a spacer element sequence. Non-limiting examples of self-cutting components include hammerhead structures, splicing elements, hairpins, hepatitis D virus (HDV), Varkud satellite (VS), and glmS ribozyme.

[0276] In some embodiments, the cyclic polynucleotide includes at least one interleaving element adjacent to the expressed sequence. In some embodiments, the cyclic polynucleotide includes an interleaving element adjacent to each expressed sequence. In some embodiments, the interleaving element is present on one or both sides of each expressed sequence, resulting in the separation of expression products, such as one or more peptides and / or one or more polypeptides. In some embodiments, the interleaving element is part of one or more expressed sequences. In some embodiments, the cyclic polynucleotide includes one or more expressed sequences, and each of the one or more expressed sequences is separated from a subsequent expressed sequence by an interleaving element on the cyclic polynucleotide. In some embodiments, the interleaving element prevents (a) two rounds of translation of a single expressed sequence or (b) one or more rounds of translation of two or more expressed sequences to generate a single polypeptide. In some embodiments, the interleaving element is a sequence separated from the one or more expressed sequences. In some embodiments, the interleaving element includes a portion of an expressed sequence in the one or more expressed sequences.

[0277] Translation start sequence

[0278] In some embodiments, the cyclic or linear polynucleotide encodes an expression sequence and includes a translation initiation sequence, such as a start codon. In some embodiments, the polynucleotide includes a translation initiation sequence operatively linked to the expression sequence. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the translation initiation sequence includes a Kozak sequence. In some embodiments, the cyclic or linear polynucleotide includes a translation initiation sequence adjacent to the expression sequence, such as a Kozak sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, the translation initiation sequence (e.g., a Kozak sequence) is present on one or both sides of each expression sequence, resulting in separation of the expression products. In some embodiments, the cyclic or linear polynucleotide includes at least one translation initiation sequence adjacent to the expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the cyclic or linear polynucleotide. In some embodiments, the translation initiation sequence is within a single-stranded region of the cyclic or linear polynucleotide. Further examples of translation start sequences are described in paragraphs

[0163] -

[0165] of International Patent Publication No. WO 2019 / 118919, which are hereby incorporated by reference in their entirety.

[0279] Cyclic or linear polynucleotides may contain more than one start codon, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, or more than 60 start codons. Translation may begin at the first start codon or downstream of the first start codon.

[0280] In some embodiments, cyclic or linear polynucleotides may be initiated by a codon that is not the first start codon (e.g., AUG). Translation of cyclic or linear polynucleotides may be initiated by alternative translation initiation sequences, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, and TTG / UUG. In some embodiments, translation is initiated at an alternative translation initiation sequence under selective conditions (e.g., stress-induced conditions). As a non-limiting example, translation of a polynucleotide may be initiated at an alternative translation initiation sequence (such as ACG). As another non-limiting example, translation of a polynucleotide may be initiated at an alternative translation initiation sequence CTG / CUG. As another non-limiting example, translation of a polynucleotide may be initiated at an alternative translation initiation sequence GTG / GUG. As another non-restrictive example, polynucleotides can be translated at alternative translation initiation sequences that are repetitive non-AUG(RAN) sequences, such as those containing short segments of repetitive RNA (e.g., CGG, GGGGCC, CAG, CTG).

[0281] In some embodiments, translation is initiated by treating eukaryotic initiation factor 4A (eIF4A) with Rocaglates (by blocking the 43S scan, translation is inhibited, resulting in premature upstream translation initiation and reduced protein expression of transcripts carrying RocA-eIF4A target sequences; see, for example, nature.com / articles / nature17978).

[0282] Termination element

[0283] In some embodiments, the polynucleotide described herein (e.g., a polynucleotide cargo) includes at least one termination element. In some embodiments, the polynucleotide includes a termination element operatively linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.

[0284] In some embodiments, the polynucleotide comprises one or more expression sequences, and each expression sequence may or may not have a terminating element. In some embodiments, the polynucleotide comprises one or more expression sequences, and the expression sequences lack terminating elements, such that the polynucleotide is translated sequentially. The exclusion of terminating elements can result in rolling circle translation or sequential expression of the expression product.

[0285] In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, each of which may or may not have a terminating element. In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, and the expression sequences lack terminating elements, such that the cyclic polynucleotide is translated sequentially. The exclusion of the terminating element due to the absence of ribosome stagnation or shedding can result in rolling circle translation or sequential expression of the expression product (e.g., a peptide or polypeptide). In this embodiment, rolling circle translation expresses sequential expression products through each expression sequence. In some other embodiments, the terminating element of the expression sequence may be part of an interleaving element. In some embodiments, one or more expression sequences in the cyclic polynucleotide contain terminating elements. However, rolling circle translation or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences may occur in the cyclic polynucleotide. In such cases, the expression product may detach from the ribosome when the ribosome encounters a terminating element (e.g., a stop codon) and terminates translation. In some embodiments, translation terminates when at least one subunit of the ribosome, such as the ribosome, remains in contact with the cyclic polynucleotide.

[0286] In some embodiments, the cyclic polynucleotide includes a termination element at the end of one or more expressed sequences. In some embodiments, one or more expressed sequences contain two or more consecutive termination elements. In such embodiments, translation terminates and rolling circle translation terminates. In some embodiments, the ribosome is completely dissociated from the cyclic polynucleotide. In some such embodiments, the generation of subsequent (e.g., second, third, fourth, fifth, etc.) expressed sequences in the cyclic polynucleotide may require the ribosome to re-engage with the cyclic polynucleotide before translation initiation. Typically, the termination element comprises an in-frame nucleotide triplet that signals translation termination, such as UAA, UGA, UAG. In some embodiments, one or more termination elements in the cyclic polynucleotide are reading frame shift termination elements, such as, but not limited to, off-frame or -1 and +1 shifted reading frames that can terminate translation (e.g., hidden termination). Frame shift termination elements include nucleotide triplets appearing in the second and third reading frames of the expressed sequence, TAA, TAG, and TGA. Reading frame shift termination elements may be important for preventing mRNA misreading that is generally harmful to cells. In some embodiments, the terminating element is a terminating codon.

[0287] Further examples of the terminating element are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0288] Polynucleotide cargo

[0289] In some embodiments, the cyclic polynucleotide encodes a polynucleotide cargo. The polynucleotide cargo described herein comprises any sequence containing at least one polynucleotide. In some embodiments, the polynucleotide cargo comprises an expression sequence, a non-coding sequence, or both. In some embodiments, the polynucleotide cargo comprises an expression sequence encoding a polypeptide. In some embodiments, the polynucleotide cargo comprises an IRES operatively linked to the expression sequence encoding the polypeptide. In some embodiments, the polynucleotide cargo comprises an expression sequence encoding a polypeptide that has a biological effect on a subject.

[0290] For example, a polynucleotide cargo may contain at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments, the polynucleotide cargo comprises 1-20,000 nucleotides, 1-10,000 nucleotides, 1-5,000 nucleotides, 100-20,000 nucleotides, 100-10,000 nucleotides, 100-5,000 nucleotides, 500-20,000 nucleotides, 500-10,000 nucleotides, 500-5,000 nucleotides, 1,000-20,000 nucleotides, 1,000-10,000 nucleotides, or 1,000-5,000 nucleotides.

[0291] In some embodiments, the polynucleotide cargo comprises one or more expressed (or coding) sequences, each of which encodes a polypeptide. In some embodiments, the polynucleotide cargo comprises one or more non-coding sequences. In some embodiments, the polynucleotide cargo consists entirely of one or more non-coding sequences. In some embodiments, the polynucleotide cargo comprises a combination of expressed (or coding) and non-coding sequences.

[0292] In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is at least 51% (e.g., at least 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%). In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is at most 52%, 53%, 54%, 55%, 56%, 57%, 58%, or 59%, or 60%. In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is 51% to 60%, 52% to 60%, 53% to 60%, 54% to 60%, 55% to 60%, 52% to 58%, or 53% to 58%.

[0293] In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is greater than 10% (e.g., greater than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is 20% to 28%, 21% to 26%, 10% to 24%, 15% to 24%, 20% to 24%, 21% to 24%, 22% to 24%, 23% to 24%, 10% to 23%, 15% to 23%, 20% to 23%, 21% to 23%, or 22% to 23%.

[0294] The GC content of an expression sequence encoding a polypeptide refers to the GC content of an expression sequence that encodes only the polypeptide, without any other coding regions encoding peptides other than the polypeptide. Similarly, the uridine content or thymidine content of an expression sequence encoding a polypeptide refers to the uridine content of an expression sequence that encodes only the polypeptide, without any other coding regions encoding peptides other than the polypeptide. In some embodiments, the calculation of the GC content or uridine (or thymidine) content of an expression sequence encoding a polypeptide considers only the continuous nucleic acid sequence starting from the first nucleoside of the start codon of the open reading frame (OPF) encoding the polypeptide to the last nucleoside of the stop codon of the same OPF. In other embodiments, the calculation of the GC content or uridine (or thymidine) content of an expression sequence encoding a polypeptide considers only the continuous nucleic acid sequence starting from the first nucleoside of the codon of the N-terminal amino acid residue encoding the polypeptide to the last nucleoside of the codon of the C-terminal amino acid residue encoding the polypeptide.

[0295] In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content greater than 20%. In some embodiments, the uridine content of the nucleic acid sequence encoding the polypeptide is greater than 10% (e.g., greater than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content of the nucleic acid sequence encoding the polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content of the nucleic acid sequence encoding the polypeptide is 20% to 28%, 21% to 26%, 10% to 24%, 15% to 24%, 20% to 24%, 21% to 24%, 22% to 24%, 23% to 24%, 10% to 23%, 15% to 23%, 20% to 23%, 21% to 23%, or 22% to 23%. In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of 20% to 28%.

[0296] In some embodiments, polynucleotides prepared as described herein are used as effectors in therapy or agriculture. For example, cyclic polynucleotides prepared by methods described herein (e.g., the cell-free method described herein) can be administered to a subject (e.g., in pharmaceutical or agricultural compositions). In another example, cyclic polynucleotides prepared by methods described herein (e.g., the cell-free method described herein) can be delivered to cells.

[0297] In some embodiments, the polynucleotide includes any feature or any combination of features as disclosed in International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.

[0298] polypeptide expression sequence

[0299] In some embodiments, the polynucleotides described herein (e.g., cyclic polynucleotides) comprise one or more expressed (or encoding) sequences, each expressing sequence encoding a polypeptide. In some embodiments, the cyclic polynucleotides comprise two, three, four, five, six, seven, eight, nine, ten, or more expressed (or encoding) sequences.

[0300] Each encoded polypeptide can be linear or branched. In various embodiments, the length of the polypeptide is about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, the length is less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids. Peptides containing less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or fewer may be useful.

[0301] The polypeptides included herein may include naturally occurring polypeptides or non-naturally occurring polypeptides. In some embodiments, a polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, a polypeptide may be a functionally active variant of any polypeptide described herein, such that it has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the sequence of the polypeptide described herein or a naturally occurring polypeptide in a designated region or throughout the sequence. In some cases, a polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or greater) identity with the target protein.

[0302] Examples of peptides include, but are not limited to, fluorescent tags or markers, antigens, therapeutic peptides, or peptides used in agricultural applications.

[0303] Therapeutic peptides can be hormones, neurotransmitters, growth factors, enzymes (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), cytokines, antigen-binding peptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single-chain antibodies, nanobodies, or other peptides containing Ig heavy or light chains), Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, interferons, interleukins, and thrombolytics.

[0304] Peptides used in agricultural applications can be bacteriocins, lysins, antimicrobial peptides, antifungal peptides, C-rich peptides from root nodules, bacterial cell regulatory peptides, peptide toxins, insecticidal peptides (e.g., insecticidal or nematicidal peptides), antigen-binding peptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single-chain antibodies, nanobodies, or other peptides containing Ig heavy or light chains), enzymes (e.g., nucleases, amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones, and transcription factors.

[0305] In some embodiments, cyclic polynucleotides express non-human proteins.

[0306] In some embodiments, a cyclic polynucleotide expresses an antibody, such as an antibody fragment or a portion thereof. In some embodiments, the antibody expressed by the cyclic polynucleotide can be any isotype, such as IgA, IgD, IgE, IgG, or IgM. In some embodiments, the cyclic polynucleotide expresses a portion of the antibody, such as the light chain, heavy chain, Fc fragment, CDR (complementarity-determining region), Fv fragment, or Fab fragment, or other portions thereof. In some embodiments, the cyclic polynucleotide expresses one or more portions of the antibody. For example, the cyclic polynucleotide may comprise more than one expressed (or encoding) sequence, each sequence expressing a portion of the antibody, and their sum may constitute the antibody. In some cases, the cyclic polynucleotide comprises one expression sequence encoding the antibody heavy chain and another expression sequence encoding the antibody light chain. In some cases, when the cyclic polynucleotide is expressed in a cellular or cell-free environment, the light and heavy chains may undergo appropriate modifications, folding, or other post-translational modifications to form a functional antibody.

[0307] In the embodiments, the polypeptide includes multiple polypeptides, such as multiple copies of a polypeptide sequence or multiple different polypeptide sequences. In the embodiments, the multiple polypeptides are linked by linker amino acids or spacer amino acids.

[0308] In the embodiments, the polynucleotide cargo contains a sequence encoding a signal peptide. Many signal peptide sequences have been described; for example, the Tat (diarginine translocation) signal sequence is typically an N-terminal peptide sequence containing a shared SRRxFLK "diarginine" motif, used to translocate folded proteins containing such Tat signal peptides across the lipid bilayer. See also, for example, a signal peptide database publicly available at www.signalpeptide.de. Signal peptides can also be used to direct proteins to specific organelles; see, for example, experimentally determined and computationally predicted signal peptides disclosed in the Spdb signal peptide database, which is publicly available at proline.bic.nus.edu.sg / spdb.

[0309] In this embodiment, the polynucleotide cargo contains a sequence encoding a cell-penetrating peptide (CPP). Hundreds of CPP sequences have been described; see, for example, the cell-penetrating peptide database CPPsite, which is publicly available at crdd[dot]osdd[dot]net / raghava / cppsite / . Common examples of CPP sequences are polyarginine sequences, such as octaargine or nonaargine, which can be fused to the C-terminus of a CGI peptide.

[0310] In the embodiments, the polynucleotide cargo contains a sequence encoding a self-assembled peptide; see, for example, Miki et al. (2021) Nature Communications, 21:3412, DOI:10.1038 / s41467-021-23794-6.

[0311] In some embodiments, the expressed (or encoded) sequence comprises a polyA sequence (e.g., at the 3' end of the expressed sequence). In some embodiments, the polyA sequence is longer than 10 nucleotides. In one embodiment, the polyA sequence is longer than 15 nucleotides (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed based on the description of the poly-A sequence in

[0202] -

[0204] of International Patent Publication No. WO 2019 / 118919A1, which is incorporated herein by reference in its entirety. In some embodiments, the expression sequence lacks the poly-A sequence (e.g., at the 3' end of the expression sequence).

[0312] In some embodiments, the cyclic polynucleotide includes a polyatomy (PA), lacks a PA, or has a modified PA to modulate one or more features of the cyclic polynucleotide. In some embodiments, the cyclic polynucleotide lacking a PA or having a modified PA improves one or more functional features, such as immunogenicity (e.g., the level of one or more markers of immune or inflammatory responses), half-life, and / or expression efficiency.

[0313] Therapeutic peptides

[0314] In some embodiments, the cyclic polynucleotides described herein (e.g., polynucleotide cargoes of cyclic polynucleotides) comprise at least one expression sequence encoding a therapeutic polypeptide. A therapeutic polypeptide is a polypeptide that provides some therapeutic benefit when administered to or expressed in a subject. Administration to or expression in a subject of a therapeutic polypeptide can be used to treat or prevent a disease, disorder, or condition or its symptoms. In some embodiments, the cyclic polynucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more therapeutic polypeptides.

[0315] In some embodiments, the cyclic polynucleotide contains an expression sequence encoding a therapeutic protein. The protein can treat a disease in a subject in need. In some embodiments, the therapeutic protein can compensate for a mutated, underexpressed, or missing protein in a subject in need. In some embodiments, the therapeutic protein can target, interact with, or bind to cells, tissues, or viruses in a subject in need.

[0316] Therapeutic peptides can be peptides that can be secreted by cells or located in the cytoplasm, nucleus, or membrane compartments of cells.

[0317] Therapeutic peptides can be hormones, neurotransmitters, growth factors, enzymes (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), cytokines, transcription factors, antigen-binding peptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single-chain antibodies, nanobodies, or other peptides containing Ig heavy or light chains), Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, interferons, interleukins, thrombolytics, antigens (e.g., tumor, viral, or bacterial antigens), nucleases (e.g., endonucleases, such as Cas proteins, e.g., Cas9), membrane proteins (e.g., chimeric antigen receptors (CARs), transmembrane receptors, G protein-coupled receptors (GPCRs), receptor tyrosine kinases (RTKs), antigen receptors, ion channels, or membrane transporters), secretory proteins, gene-editing proteins (e.g., CRISPR-Cas, TALEN, or zinc fingers), or gene-writing proteins (see, for example, International Patent Publication No. WO). 2020 / 047124, which is incorporated herein by reference in its entirety.

[0318] In some embodiments, the therapeutic peptide is an antibody, such as a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the cyclic polynucleotide can be any isotype, such as IgA, IgD, IgE, IgG, or IgM. In some embodiments, the cyclic polynucleotide expresses a portion of the antibody, such as the light chain, heavy chain, Fc fragment, CDR (complementarity-determining region), Fv fragment, or Fab fragment, or other portions thereof. In some embodiments, the cyclic polynucleotide expresses one or more portions of the antibody. For example, the cyclic polynucleotide may contain more than one expression sequence, each expressing a portion of the antibody, and their sum may constitute the antibody. In some cases, the cyclic polynucleotide contains one expression sequence encoding the antibody heavy chain and another expression sequence encoding the antibody light chain. When the cyclic polynucleotide is expressed in cells, the light and heavy chains may undergo appropriate modifications, folding, or other post-translational modifications to form a functional antibody.

[0319] In some embodiments, cyclic polynucleotides prepared as described herein are used as effectors in therapy or agriculture. For example, cyclic polynucleotides prepared by the methods described herein (e.g., the cell-free methods described herein) can be administered to a subject (e.g., in pharmaceutical or agricultural compositions). In embodiments, the subject is a vertebrate (e.g., a mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the method subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., monkey, ape), ungulate (e.g., cattle, buffalo, sheep, goats, pigs, camels, llamas, alpacas, deer, horses, donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse), or rabbit (e.g., rabbit). In this embodiment, the subject is a bird, such as a member of the following bird taxa: Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Palaemaggine (e.g., ostrich, emu), Columbiformes (e.g., pigeon, wild pigeon), or Psittaciformes (e.g., parrot). In this embodiment, the subject is an invertebrate, such as arthropods (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In this embodiment, the subject is an invertebrate agricultural pest or an invertebrate parasitic on an invertebrate or vertebrate host. In this embodiment, the subject is a plant, such as angiosperms (which may be dicotyledons or monocotyledons) or gymnosperms (e.g., conifers, cycads, gynostemma pentaphyllum, ginkgo), ferns, phytophytes, lycophytes, or bryophytes. In this embodiment, the subject is a eukaryotic algae (unicellular or multicellular). In this embodiment, the subjects are plants of agricultural or horticultural importance, such as interrow crops, fruit-producing plants and trees, vegetables, trees, and ornamental plants (including ornamental flowers, shrubs, trees, ground cover plants, and lawn grasses).

[0320] Secreted polypeptide effectors

[0321] In some embodiments, the cyclic polynucleotides described herein (e.g., polynucleotide cargoes of cyclic polynucleotides) comprise at least one coding sequence encoding a secreted polypeptide effector. Exemplary expressible secreted polypeptide effectors or proteins include, for example, cytokines and cytokine receptors, polypeptide hormones and receptors, growth factors, coagulation factors, therapeutic alternative enzymes and therapeutic non-enzymatic effectors, regeneration, repair and fibrosis factors, transforming factors, and proteins that stimulate cell regeneration, non-limiting examples of which are described herein, for example, in the following table.

[0322] Cytokines and cytokine receptors

[0323] In some embodiments, the effectors described herein include cytokines of Table 2 or functional variants or fragments thereof, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 11 (by reference to their UniProt IDs). In some embodiments, the functional variants bind to the corresponding cytokine receptors, and their Kd is no more than 10%, 20%, 30%, 40%, or 50% higher or lower than that of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, the effectors include fusion proteins comprising a first region (e.g., a cytokine peptide of Table 1 or a functional variant or fragment thereof) and a second heterologous region. In some embodiments, the first region is a first cytokine peptide of Table 11. In some embodiments, the second region is a second cytokine peptide of Table 11, wherein the first and second cytokine peptides form a cytokine heterodimer with respect to each other in wild-type cells. In some embodiments, the peptides of Table 11 or functional variants thereof contain signal sequences, such as endogenous or heterologous signal sequences for the effector.

[0324] In some embodiments, the effectors described herein comprise antibodies or fragments thereof that bind to the cytokines listed in Table 11. In some embodiments, antibody molecules comprise signal sequences.

[0325] Table 11. Exemplary cytokines and cytokine receptors

[0326]

[0327]

[0328] 1 The sequence can be obtained from the NCBI database at ncbi.nlm.nih.gov / gene on the World Wide Web; Maglott D et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii:gku1055.

[0329] 2 The sequence is available in the Uniprot database at uniprot.org / uniprot on the World Wide Web; UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49:D1 (2021).

[0330] Peptide hormones and receptors

[0331] In some embodiments, the effectors described herein include hormones or functional variants thereof listed in Table 12, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 12 (by reference to their UniProt IDs). In some embodiments, the functional variant binds to the corresponding receptor and its Kd is not more than 10%, 20%, 30%, 40%, or 50% higher than that of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, the peptides or functional variants thereof listed in Table 12 contain a signal sequence, such as an endogenous or heterologous signal sequence for the effector.

[0332] In some embodiments, the effectors described herein include antibody molecules (e.g., scFv) that bind to hormones listed in Table 12. In some embodiments, the effectors described herein include antibody molecules (e.g., scFv) that bind to hormone receptors listed in Table 12. In some embodiments, the antibody molecule contains a signal sequence.

[0333] Table 12. Exemplary peptide hormones and receptors

[0334]

[0335] 1 The sequence is available on the NCBI database at “ncbi.nlm.nih.gov / gene” on the World Wide Web (Maglott D et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii:gku1055).

[0336] 2 The sequence is available in the Uniprot database on the World Wide Web website “uniprot.org / uniprot / ”; UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49:D1(2021).

[0337] growth factors

[0338] In some embodiments, the effectors described herein include the growth factors or functional variants thereof listed in Table 13, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 13 (by reference to their UniProt IDs). In some embodiments, the functional variants bind to the corresponding receptors and have a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher than that of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, the peptides or functional variants thereof listed in Table 13 contain signal sequences, such as endogenous or heterologous signal sequences for the effector.

[0339] In some embodiments, the effectors described herein include antibodies or fragments thereof that bind to the growth factors listed in Table 13. In some embodiments, the effectors described herein include antibody molecules (e.g., scFv) that bind to the growth factor receptors listed in Table 13. In some embodiments, the antibody molecule contains a signaling sequence.

[0340] Table 13. Exemplary Growth Factors

[0341]

[0342]

[0343] 1 The sequence is available in the NCBI database at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0344] 2 The sequences are available in the Uniprot database on the World Wide Web website uniprot.org / uniport.

[0345] clotting factors

[0346] In some embodiments, the effectors described herein comprise the peptides of Table 14 or functional variants thereof, for example, proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 14 by reference to their UniProt IDs. In some embodiments, the functional variants catalyze the same reactions as the corresponding wild-type proteins, for example, at a catalytic rate that is at least 10%, 20%, 30%, 40%, or 50% lower or higher than that of the wild-type proteins. In some embodiments, the peptides of Table 14 or functional variants thereof comprise signal sequences, such as endogenous or heterologous signal sequences for the effector.

[0347] Table 14. Coagulation-related factors

[0348]

[0349] 1 The sequence is available in the NCBI database at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0350] 2 The sequences are available in the Uniprot database on the World Wide Web website "uniprot.org / uniprot".

[0351] Therapeutic enzyme replacement

[0352] In some embodiments, the effectors described herein include enzymes of Table 15 or functional variants thereof, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 15 (by reference to their UniProtID). In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, for example, at a catalytic rate not less than or not more than 10%, 20%, 30%, 40%, or 50% lower than that of the wild-type protein.

[0353] Table 15. Exemplary enzyme effectors for enzyme deficiency

[0354]

[0355]

[0356]

[0357]

[0358] 1 The sequence is available in the NCBI database at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0359] 2 The sequences are available in the Uniprot database on the World Wide Web website uniprot.org / uniprot.

[0360] Other non-enzymatic effectors

[0361] In some embodiments, the therapeutic peptides described herein include the peptides of Table 16 or functional variants thereof, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 16 (by reference to their UniProt IDs).

[0362] Table 16. Exemplary non-enzymatic effectors and corresponding indications

[0363]

[0364]

[0365] 1 The sequence is available in the NCBI database at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0366] 2 The sequences are available in the Uniprot database on the World Wide Web website uniprot.org / uniprot.

[0367] Regeneration, repair and fibrosis factors

[0368] The therapeutic peptides described herein also include, for example, growth factors or functional variants thereof disclosed in Table 17, such as proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 17 (by reference to their NCBI Protein Registry Numbers). Also included are antibodies or fragments thereof targeting such growth factors, or miRNAs that promote regeneration and repair.

[0369] Table 17. Exemplary regeneration, repair, and fibrosis factors

[0370]

[0371] 1 The sequence is available at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0372] 2 The sequence is available at ncbi.nlm.nih.gov / protein on the World Wide Web.

[0373] Transformation factor

[0374] The therapeutic peptides described herein also include transforming factors, such as protein factors that transform fibroblasts into differentiated cells, such as the factors disclosed in Table 18 or their functional variants, such as proteins that have at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 18 (by reference to their UniProt ID).

[0375] Table 18: Peptides indicating organ repair via fibroblast transformation

[0376] target NCBI Gene Accession Number 1 ]] NCBI protein accession number 2 ]] MESP1 Gene ID: 55897 EAX02066 ETS2 Gene ID: 2114 NP_005230 HAND2 Gene ID: 9464 NP_068808 Cardiomycin Gene ID: 93649 NP_001139784 ESRRA Gene ID: 2101 AAH92470 miR1 MI0000651 not applicable miR133 MI000450 not applicable TGFb Gene ID: 7040 NP_000651.3 WNT Gene ID: 7471 NP_005421 JAK Gene ID: 3716 NP_001308784 NOTCH Gene ID: 4851 XP_011517019

[0377] 1 The sequence is available at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0378] 2 The sequence is available at ncbi.nlm.nih.gov / protein on the World Wide Web.

[0379] Proteins that stimulate cell regeneration

[0380] The therapeutic peptides described herein also include proteins that stimulate cell regeneration, such as the proteins disclosed in Table 19 or their functional variants, such as proteins that have at least 80%, 85%, 90%, 95%, 967%, 98%, or 99% identity with the protein sequences disclosed in Table 19 (by reference to their UniProt IDs).

[0381] Table 19. Exemplary proteins that stimulate cell regeneration

[0382] target Gene Accession No. 1 ]] Protein Accession No. 2 ]]> MST1 NG_016454 NP_066278 STK30 <![CDATA[ Gene ID: 26448 ]]> NP_036103 MST2 Gene ID: 6788 NP_006272 SAV1 Gene ID: 60485 NP_068590 LATS1 Gene ID: 9113 NP_004681 LATS2 Gene ID: 26524 NP_055387 YAP1 NG_029530 NP_001123617 CDKN2b NG_023297 NP_004927 CDKN2a NG_007485 NP_478102

[0383] 1 The sequence is available at ncbi.nlm.nih.gov / gene on the World Wide Web.

[0384] 2 The sequence is available at ncbi.nlm.nih.gov / protein on the World Wide Web.

[0385] Cystic fibrosis transmembrane transport regulator (CFTR)

[0386] In some embodiments, the effectors described herein include the CFTR gene of Table 20 or a functional variant or fragment thereof, for example, a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the protein sequence disclosed in Table 20.

[0387] Table 20. Exemplary CFTR genes

[0388]

[0389]

[0390]

[0391]

[0392]

[0393] In some embodiments, the cyclic polynucleotide comprises one or more expression sequences (coding sequences) and is configured for sustained expression in cells within a subject's body. In some embodiments, the cyclic polynucleotide is configured such that the expression of the one or more expression sequences in cells at later time points is equal to or greater than the expression at earlier time points. In such embodiments, the expression of the one or more expression sequences may remain at a relatively stable level or may increase over time. The expression of the expression sequences may be relatively stable over extended time periods. For example, in some cases, the expression of one or more expression sequences in cells does not decrease by 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% over time periods of at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23, or more days. In some cases, the expression of one or more expressed sequences in cells is maintained at a level that varies by no more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% for at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23 or more days.

[0394] Plant-modified peptides

[0395] In some embodiments, the polynucleotides described herein (e.g., polynucleotide cargoes of polynucleotides) comprise at least one expression sequence encoding a plant-modifying polypeptide. A plant-modifying polypeptide is a polypeptide that can alter a plant's genetic characteristics (e.g., increase gene expression, decrease gene expression, or otherwise alter the nucleotide sequence of DNA or RNA), epigenetic characteristics, or physiological or biochemical characteristics in a manner that causes changes in plant physiology or phenotype (e.g., increases or decreases plant fitness). In some embodiments, the polynucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more different plant-modifying polypeptides, or multiple copies of one or more plant-modifying polypeptides. Plant-modifying polypeptides can alter the physiology or phenotype of multiple plants or increase or decrease the fitness of multiple plants, or they can be polypeptides that influence such or such alterations in one or more specific plants (e.g., plants of a specific species or genus).

[0396] Examples of peptides that may be used in this article may include enzymes (e.g., metabolic recombinases, helicases, integrases, RNases, DNases, or ubiquitinated proteins), porogens, signal transduction ligands, cell-penetrating peptides, transcription factors, receptors, antibodies, nanobodies, gene-editing proteins (e.g., CRISPR-Cas endonucleases, TALENs, or zinc fingers), riboproteins, protein aptamers, or molecular chaperones.

[0397] Agricultural polypeptides

[0398] In some embodiments, the polynucleotides described herein (e.g., polynucleotide cargoes of polynucleotides) comprise at least one expression sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide suitable for agricultural use. In embodiments, the agricultural polypeptide is applied to plants or seeds (e.g., by foliar spraying, powdering, injection, or seed coating) or the plant environment (e.g., by soil irrigation or granular soil application) to alter the plant's physiology, phenotype, or fitness. Embodiments of agricultural polypeptides include polypeptides that alter the level, activity, or metabolism of one or more microorganisms residing in or on plants or non-human animal hosts, resulting in increased fitness of the host. In some embodiments, the agricultural polypeptide is a plant polypeptide. In some embodiments, the agricultural polypeptide is an insect polypeptide. In some embodiments, the agricultural polypeptide has a biological effect upon contact with non-human vertebrates, invertebrates, microorganisms, or plant cells.

[0399] In some embodiments, the polynucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.

[0400] Examples of peptides suitable for agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, C-rich peptides from root nodules, and bacterial cell-regulating peptides. Such peptides can be used to alter the levels, activity, or metabolism of target microorganisms to increase the fitness of insects such as bees and silkworms. Examples of agriculturally useful peptides include peptide toxins, such as those naturally produced by entomopathogenic nematode bacteria (e.g., Bacillus thuringiensis, Photorhabdus luminescens, Serratia entomophila, or Xenorhabdus nematophila), as known in the art. Examples of agriculturally useful peptides include peptides (including small peptides such as cyclic dipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, such as antimicrobial or antifungal peptides for controlling diseases in plants, or insecticidal peptides (e.g., insecticidal or nematicidal peptides) for controlling invertebrate pests such as insects or nematodes. Examples of agriculturally useful peptides include antibodies, nanobodies, and fragments thereof, such as antibody or nanobodies fragments that retain at least some (e.g., at least 10%) of the specific binding activity of the whole antibody or nanobodies. Examples of agriculturally useful peptides include transcription factors, such as plant transcription factors; see, for example, the AtTFDB database listing families of transcription factors identified in the model plant Arabidopsis thaliana, which is publicly available at agris-knowledgebase.org / AtTFDB / . Examples of agriculturally useful peptides include nucleases, such as exonucleases or endonucleases (e.g., Cas nucleases, such as Cas9 or Cas12a). Examples of agriculturally useful peptides further include cell-penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), and peptide pheromones (e.g., yeast mating pheromones, invertebrate reproductive and larval signaling pheromones, see, for example, Altstein (2004) Peptides, 25:1373-1376).

[0401] Termination element

[0402] In some embodiments, the polynucleotide described herein includes at least one termination element. In some embodiments, the polynucleotide includes a termination element operatively linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.

[0403] In some embodiments, the polynucleotide comprises one or more expression sequences, and each expression sequence may or may not have a terminating element. In some embodiments, the polynucleotide comprises one or more expression sequences, and the expression sequences lack terminating elements, such that the polynucleotide is translated sequentially. The exclusion of terminating elements can result in rolling circle translation or sequential expression of the expression product.

[0404] In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, each of which may or may not have a terminating element. In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, and the expression sequences lack terminating elements, such that the cyclic polynucleotide is translated sequentially. The exclusion of the terminating element due to the absence of ribosome stagnation or shedding can result in rolling circle translation or sequential expression of the expression product (e.g., a peptide or polypeptide). In this embodiment, rolling circle translation expresses sequential expression products through each expression sequence. In some other embodiments, the terminating element of the expression sequence may be part of an interleaving element. In some embodiments, one or more expression sequences in the cyclic polynucleotide contain terminating elements. However, rolling circle translation or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences may occur in the cyclic polynucleotide. In such cases, the expression product may detach from the ribosome when the ribosome encounters a terminating element (e.g., a stop codon) and terminates translation. In some embodiments, translation terminates when at least one subunit of the ribosome, such as the ribosome, remains in contact with the cyclic polynucleotide.

[0405] In some embodiments, the cyclic polynucleotide includes a termination element at the end of one or more expression sequences. In some embodiments, the one or more expression sequences include two or more consecutive termination elements. In such embodiments, translation terminates and rolling circle translation terminates. In some embodiments, the ribosome is completely dissociated from the cyclic polynucleotide. In some such embodiments, the generation of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences in the cyclic polynucleotide may require the ribosome to re-engage with the cyclic polynucleotide before translation initiation. Typically, the termination element comprises an in-frame nucleotide triplet (e.g., UAA, UGA, UAG) that signals translation termination. In some embodiments, one or more termination elements in the cyclic polynucleotide...

[0406] These are frameshift termination elements, such as, but not limited to, off-frame or -1 and +1 frameshift reading frames that can terminate translation (e.g., hidden terminators). Frameshift termination elements include nucleotide triplets appearing in the second and third reading frames of the expressed sequence, TAA, TAG, and TGA. Frameshift termination elements may be important for preventing mRNA misreadings that are generally harmful to cells. In some embodiments, the termination element is a stop codon.

[0407] In some embodiments, the expression sequence comprises a polyA sequence (e.g., at the 3' end of the expression sequence, such as the 3' of a termination element). In some embodiments, the polyA sequence is longer than 10 nucleotides. In one embodiment, the polyA sequence is longer than 15 nucleotides (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed based on the description of the poly-A sequence in

[0202] -

[0204] of International Patent Publication No. WO 2019 / 118919 A1, which is incorporated herein by reference in its entirety. In some embodiments, the expression sequence lacks the poly-A sequence (e.g., at the 3' end of the expression sequence).

[0408] In some embodiments, the cyclic polynucleotide includes a polyatomy (PA), lacks a PA, or has a modified PA to modulate one or more features of the cyclic polynucleotide. In some embodiments, the cyclic polynucleotide lacking a PA or having a modified PA improves one or more functional features, such as immunogenicity (e.g., the level of one or more markers of immune or inflammatory responses), half-life, and / or expression efficiency.

[0409] Further examples of the terminating element are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0410] Modification

[0411] Relative to a reference sequence (especially a parental polynucleotide), a polynucleotide may contain one or more substitutions, insertions and / or additions, deletions and covalent modifications included within the scope of this disclosure.

[0412] In some embodiments, the polynucleotide comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, polyA sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications already identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. NuclAcids Res. 27:196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the polynucleotide comprises at least one nucleoside selected from the group consisting of those described in International Patent Publication No. WO 2019 / 118919 A1

[0311] , which is incorporated herein by reference in its entirety.

[0413] Polynucleotides may contain any useful modifications, such as those targeting sugars, nucleobases, or nucleoside internucleotides (e.g., targeting linked phosphate esters / phosphodiester bonds / phosphodiester backbones). One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol group, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halogen (e.g., chlorinated or fluorinated). In some embodiments, modifications (e.g., one or more modifications) are present in each sugar and nucleoside internucleotide. Modifications may be modifications to deoxyribonucleic acid (DNA), threonine nucleic acid (TNA), glycolic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof. Other modifications are described herein.

[0414] In some embodiments, the polynucleotide includes at least one N(6)-methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the m6A modification may reduce the immunogenicity of the polynucleotide (e.g., reduce the level of one or more markers of immune or inflammatory responses).

[0415] In some embodiments, the modification may include chemically or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modification are described in Lewis and Pan, “RNA modifications and structures cooperate to guide RNA-protein interactions”, Nat Reviews Mol Cell Biology, 2017, 18:202-210.

[0416] In some embodiments, chemical modification of the ribonucleotide of a polynucleotide can enhance immune evasion. Polynucleotides can be synthesized and / or modified using methods well-established in the art, such as those described in Current Protocols in Nucleic Acid Chemistry, Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA (incorporated herein by reference). Modifications include, for example, end modifications, such as 5' end modifications (phosphorylation (mono, di, and triphosphorylation), conjugation, reverse linkage, etc.), 3' end modifications (conjugation, DNA nucleotides, reverse linkage, etc.), base modifications (e.g., base substitution with a stable base, an unstable base, or a base paired with an expanded library of pairing partners), base removal (debaseted nucleotides), or base conjugation. Modified ribonucleotide bases may also include 5-methylcytidine and pseudouridine. In some embodiments, base modifications can modulate the expression, immune response, stability, and subcellular localization of polynucleotides, among other functional roles. In some embodiments, modifications include diorthogonal nucleotides, such as non-natural bases. See, for example, Kimoto et al., Chem Commun (Camb), 2017, 53:12309, DOI:10.1039 / c7cc06661a, which is incorporated herein by reference in its entirety.

[0417] In some embodiments, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions of one or more ribonucleotides of a polynucleotide, and backbone modifications include modifications or substitutions of phosphodiester bonds. Specific examples of polynucleotides include, but are not limited to, polynucleotides comprising a modified backbone or non-natural internucleotide bonds (such as internucleotide modifications, including modifications or substitutions of phosphodiester bonds). Polynucleotides having a modified backbone particularly include those without a phosphorus atom in their backbone. For the purposes of this application, and as sometimes referred to in the art, modified RNAs without a phosphorus atom in their internucleotide backbone may also be considered oligonucleotides. In certain embodiments, the polynucleotide will comprise ribonucleotides having a phosphorus atom in their internucleotide backbone.

[0418] The modified polynucleotide backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (such as 3'-alkylenephosphonates and chiral phosphonates), phosphonites, aminophosphates (such as 3'-aminoaminophosphates and aminoalkylaminophosphates), thionophosphoramidates, thionoalkylphosphonates, thionoalkyl phosphate triesters, and borane phosphates having normal 3'-5' bonds, analogs of these with 2'-5' linkages, and those with opposite polarities, wherein adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. In some embodiments, the polynucleotide may be negatively or positively charged.

[0419] Modified nucleotides that can be incorporated into polynucleotides can be modified at the nucleoside internucleotide linker (e.g., the phosphate backbone). Here, in the context of the polynucleotide backbone, the phrases "phosphate ester" and "phosphate diester" are used interchangeably. The backbone phosphate ester group can be modified by substituting one or more oxygen atoms with different substituents. Furthermore, modified nucleosides and nucleotides can include the overall substitution of the unmodified phosphate ester moiety by another nucleoside internucleotide linker as described herein. Examples of modified phosphate ester groups include, but are not limited to, thiophosphates, selenophosphite, boranophosphates / boranophosphate esters, hydrophosphonates, aminophosphates, diaminophosphates, alkyl or arylphosphonates, and triphosphates. In dithiophosphates, both non-linked oxygen atoms are replaced by sulfur. The phosphate linker can also be modified by substituting the linking oxygen atoms with nitrogen (bridged aminophosphates), sulfur (bridged thiophosphates), and carbon (bridged methylenephosphonates).

[0420] Providing α-thiosubstituted phosphate moieties to impart stability to RNA and DNA polymers via non-natural thiophosphate backbones. Thiophosphate DNA and RNA exhibit enhanced nuclease resistance and thus longer half-lives in the cellular environment. Thiophosphates linked to polynucleotides hold promise for reducing innate immune responses by attenuating the binding / activation of cellular innate immune molecules.

[0421] In certain embodiments, the modified nucleosides include α-thio-nucleosides (e.g., 5'-O-(l-thiophosphate)-adenosine, 5'-O-(l-thiophosphate)-cytidine (α-thiocytidine), 5'-O-(l-thiophosphate)-guanosine, 5'-O-(l-thiophosphate)-uridine, or 5'-O-(l-thiophosphate)-pseuuridine).

[0422] This document describes other nucleoside bonds that may be used in accordance with this disclosure, including nucleoside bonds that do not contain a phosphorus atom.

[0423] In some embodiments, the polynucleotide may comprise one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into the polynucleotide, such as through bifunctional modifications. Cytotoxic nucleosides may include, but are not limited to, vidarabine, 5-azacytidine, 4'-thiocytarabine, cyclopentenylcytidine, cladribine, clofarabine, cytarabine, cytosine cytarabine, l-(2-C-cyano-2-deoxy-β-D-arabino-pentafuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, fluorouridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-l-(tetrahydrofuran-2-yl)pyrimidin-2,4(1H,3H)-dione), trisatabine, tezacitabine, 2'-deoxy-2'-methylenecytidine (DMDC), and 6-mercaptopurine. Other examples include fludarabine phosphate, N4-behenyl-1-β-D-arabinopentafuranosylcytosine, N4-octadecyl-1-β-D-arabinopentafuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabinopentafuranosyl)cytosine, and P-4055 (cytarabine 5'-arabinoside).

[0424] Polynucleotides may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or all of A, G, U, C, I, pU) may or may not be uniformly modified in the polynucleotide, or in a given predetermined sequence region thereof. In some embodiments, the polynucleotide contains pseudouridine. In some embodiments, the polynucleotide contains inosine, which, relative to viral RNA, helps the immune system characterize the polynucleotide as endogenous. Incorporation of inosine can also mediate improved RNA stability / reduced degradation. See, for example, Yu, Z et al., (2015) RNAediting by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284, which is incorporated herein by reference in its entirety.

[0425] In some embodiments, all nucleotides in the polynucleotide (or a given sequence region thereof) are modified. In some embodiments, the modification may include m6A to enhance expression; inosine to weaken the immune response; pseudouridine to increase RNA stability or translational readout (interleaving elements); m5C to increase stability; and 2,2,7-trimethylguanosine to facilitate subcellular translocation (e.g., nuclear localization).

[0426] Different sugar modifications, nucleotide modifications, and / or internucleotide bonds (e.g., backbone structures) can be present at various positions on a polynucleotide. Those skilled in the art will understand that nucleotide analogs or one or more other modifications can be located at any one or more positions on the polynucleotide without substantially reducing its function. Modifications can also be non-coding region modifications. Polynucleotides may comprise from about 1% to about 100% (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%). Modified nucleotides of 0% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%.

[0427] Generation method

[0428] This disclosure provides methods for generating cyclic polynucleotides, including, for example, recombinant techniques or chemical synthesis. For example, DNA molecules used to generate RNA loops may include DNA sequences of naturally occurring nucleic acid sequences, their modified forms, or DNA sequences encoding synthetic polypeptides that are not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques, including but not limited to classical mutagenesis and recombinant techniques such as site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures, and linking mixture groups to “build” mixtures and combinations thereof of nucleic acid molecules.

[0429] Cyclic polynucleotides can be prepared according to any available technology, including but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, the linear primary construct or linear polynucleotide used for cyclization can be cyclized or linked to generate the circRNA described herein. In some embodiments, the linear polynucleotide used for cyclization can be cyclized in vitro prior to formulation and / or delivery. In some embodiments, the cyclic polynucleotide can be a mixture with the linear polynucleotide. In some embodiments, the linear polynucleotide has the same nucleic acid sequence as the cyclic polynucleotide.

[0430] Cycloning or concatenation can occur through methods such as chemical, enzymatic, splint ligation, or ribozyme catalysis. The newly formed 5'-3' bond can be an intramolecular or intermolecular bond. For example, splint ligases (such as...) Ligases can be used for splint ligation. According to this method, a single-stranded polynucleotide (splice) (such as single-stranded DNA or RNA) can be engineered to hybridize with both ends of a linear polynucleotide such that the ends are side-by-side upon hybridization with the single-stranded splint. Therefore, a splint ligase can catalyze the ligation of the side-by-side ends of a linear polynucleotide to produce circRNA. In some embodiments, DNA or RNA ligases can be used for the synthesis of cyclic polynucleotides. As a non-limiting example, the ligase can be a circ ligase or a circular ligase.

[0431] In some embodiments, the 5' or 3' end of the linear polynucleotide may encode a ligase ribozyme sequence, such that during in vitro transcription, the resulting linear polynucleotide for cyclization includes an active ribozyme sequence capable of linking the 5' end of the linear polynucleotide for cyclization to the 3' end. The ligase ribozyme may be derived from type I introns, hepatitis D virus, hairpin ribozymes, or may be selected via SELEX (ligand system evolution by exponential enrichment).

[0432] In another example, linear polynucleotides can be cyclized or linked using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with a region or feature near the 5' end or 3' end of the linear polynucleotide for cyclization to cyclize or link the linear polynucleotide for cyclization. In another aspect, the at least one non-nucleic acid moiety may be located at, linked to, or adjacent to the 5' end or 3' end of the linear polynucleotide for cyclization. The non-nucleic acid moiety may be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety may be a bond, such as a hydrophobic bond, ionic bond, biodegradable bond, or cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a linker portion. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or peptide portion, such as an aptamer or non-nucleic acid linker as described herein.

[0433] In some embodiments, the linear polynucleotide used for cyclization may comprise a 5' triphosphate of a nucleic acid, for example, by contacting the 5' triphosphate with RNA 5' pyrophosphate hydrolase (RppH) or ATP diphosphate hydrolase (dephosphorylase) to convert it to a 5' monophosphate. In some embodiments, at least a portion of the linear polynucleotide contains a monophosphate moiety at its 5' end. In some embodiments, a group of polynucleotides comprising both cyclic and linear polynucleotides is contacted with RppH before cleavage of at least a portion of the linear polynucleotide with a 5' exonuclease and / or a 3' exonuclease. Alternatively, the conversion of the 5' triphosphate of the linear polynucleotide used for cyclization to a 5' monophosphate may be accomplished by a two-step reaction comprising: (a) contacting the 5' nucleotide of the linear polynucleotide used for cyclization with a phosphatase (e.g., thermosensitive phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) after step (a), contacting the 5' nucleotide with a kinase to which a single phosphate ester has been added (e.g., a polynucleotide kinase). On the other hand, the linear polynucleotide used for cyclization can be cyclized or ligated via self-splicing. In some embodiments, the linear polynucleotide may contain a sequence mediating self-ligation. In some embodiments, the linear polynucleotide may contain a cyclic E sequence (e.g., in PSTVd) for self-ligation. In some embodiments, the linear polynucleotide may contain an HDV sequence, such as a conserved HDV replication domain sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACU CUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGU UCGAGCAUGAGCC (SEQ ID NO:271) (Beeharry et al. 2004) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGU AAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO:272), for self-ligation. In another embodiment, the linear polynucleotide may contain self-circulated introns, such as 5' and 3' splice junctions, or self-circulated catalytic introns, such as type I, type II, or type III introns. Non-limiting examples of self-splicing sequences of type I introns may include self-splicing intron-exon sequences derived from the T4 phage gene td, and intercalated (IVS) rRNA sequences from Tetrahymena, the pre-tRNA-Leu gene of cyanobacterium Anabaena, or pre-rRNA of Tetrahymena.

[0434] In some embodiments, the polynucleotide comprises a catalytic intron fragment, such as the 3' half and the 5' half of a type I catalytic intron fragment. The first and second annealing regions may be located within the catalytic intron fragment. The type I catalytic intron is a self-splicing ribozyme that catalyzes its own cleavage from mRNA, tRNA, and rRNA precursors via a bimetallic ion phosphoryl transfer mechanism. Importantly, the RNA itself self-catalyzes the removal of the intron without requiring exogenous enzymes, such as ligases.

[0435] In some embodiments, the 3' half and the 5' half of the type I catalytic intron fragment are derived from the pre-tRNA-Leu gene of Anabaena or the pre-rRNA of Tetrahymena.

[0436] In some embodiments, the 3' half and the 5' half of the type I catalytic intron fragment are derived from the pre-tRNA-Leu gene of *Anoplophora stylosa*, and the 3' exon fragment contains a first annealed region, and the 5' exon fragment contains a second annealed region. The first annealed region may contain, for example, 5 to 50, for example, 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides, and the second annealed region may contain, for example, 5 to 50, for example, 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides.

[0437] In some embodiments, the 3' half and 5' half of the type I catalytic intron fragment are derived from Tetrahymena prerRNA, and the 3' half of the type I catalytic intron fragment contains a first annealed region, and the 5' exon fragment contains a second annealed region. In some embodiments, the 3' exon contains the first annealed region, and the 5' half of the type I catalytic intron fragment contains the second annealed region. The first annealed region may contain, for example, 6 to 50, for example, 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealed region may contain, for example, 6 to 50, for example, 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0438] In some embodiments, the 3' half and the 5' half of the type I catalytic intron fragment are derived from the pre-tRNA-Leu gene of Anabaena, the pre-rRNA gene of Tetrahymena, or the td gene of T4 phage.

[0439] In some embodiments, the 3' half and the 5' half of the type I catalytic intron fragment are derived from the T4 phage td gene. The 3' exon fragment may contain a first annealed region, and the 5' portion of the type I catalytic intron fragment may contain a second annealed region. The first annealed region may contain, for example, 2 to 16, for example, 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealed region may contain, for example, 2 to 16, for example, 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0440] In some embodiments, the 3' half of the type I catalytic intron fragment is the 5' end of a linear polynucleotide.

[0441] In some embodiments, the 5' half of the type I catalytic intron fragment is the 3' end of a linear polynucleotide.

[0442] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATG-3' (SEQ ID NO: 215).

[0443] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3' (SEQ ID NO: 216).

[0444] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:215, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:216.

[0445] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-CTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG-3' (SEQ ID NO: 217).

[0446] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGAT-3' (SEQ ID NO: 218).

[0447] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:217, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:218.

[0448] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-GGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATG-3' (SEQ ID NO: 219).

[0449] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACT-3' (SEQ ID NO: 220).

[0450] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:219, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:220.

[0451] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-TAAACAACTAACAGCTTTAGAAGGTGCAGAGACTAGACGGGAGCTACCCTAACGGATTCAGCCGAGGGTAAAGGATAGTCCAATTCTCAACATCGCGATTGTTGATGGCAGCGAAAGTTGCAGAGAGAATGAAAATCCGCTGACTGTAAAGGTCGTGAGGGTTCGAGTCCCTCCGCCCCCA-3' (SEQ ID NO: 221).

[0452] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTGGCAGCTCTCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCCTGAGCCAAGCTAAAGC-3' (SEQ ID NO: 222).

[0453] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:221, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:222.

[0454] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-TTAAACTCAAAATTTAAAATCCCAAATTCAAAATTCCGGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTAAAGCCGAGGGTAAAGGGAGAGTCCAATTCTCAAAGCCTGAAGTTGCTGAAGCAACAAGGCAGTAGTGAAAGCTGCGAGAGAATGAAAATCCGTTGACTGTAAAAAGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3' (SEQ ID NO: 223).

[0455] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTTAAGTGGAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCAGAAAATTTAGACTTGAGATTTGATTTTGGAG-3' (SEQ ID NO: 224).

[0456] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:223, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:224.

[0457] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-GGCTTTCAATTTGAAATCAGAAATTCAAAATTCAGGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTAAAGGCGAGGGTAAAGGGAGAGTCCAATTCTTAAAGCCTGAAGTTGTGCAAGCAACAAGGCAACAGTGAAAGCTGTGGAAGAATGAAAATCCGTTGACCTTAAACGGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3' (SEQ ID NO: 225).

[0458] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTCAAGTGGAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCGGAAATTTTAGAATCAAGATTTTATTTT-3' (SEQ ID NO: 226).

[0459] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:225, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:226.

[0460] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3' (SEQ ID NO: 227).

[0461] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3' (SEQ ID NO: 228).

[0462] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:227, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:228.

[0463] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-ACAACAGATAACTTACTAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3' (SEQ ID NO: 229).

[0464] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAGTAAGTT-3' (SEQ ID NO: 230).

[0465] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:229, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:230.

[0466] In some embodiments, the 3' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AACAACAGATAACTTACTAGTTACTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3' (SEQ ID NO: 231).

[0467] In some embodiments, the 5' half of the type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity with the sequence of 5'-AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3' (SEQ ID NO: 232).

[0468] In some embodiments, the 3' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:231, and the 5' half of the type I catalytic intron fragment has the sequence of SEQ ID NO:232.

[0469] In some embodiments, the type I catalytic intron fragment is derived from the T4 phage nrdB gene or the nrdD gene. In some embodiments, the 3' half of the type I catalytic intron fragment contains a sequence having at least 80% sequence identity with 5'-TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3' (SEQ ID NO:233).

[0470] In some embodiments, the 3' half of the type I catalytic intron fragment of (A) contains a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3' (SEQ ID NO:233).

[0471] In some embodiments, half of the type I catalytic intron fragment originates from the T4 phage nrdB gene. In some embodiments, half of the type I catalytic intron fragment originates from the T4 phage nrdB gene, and half of the type I catalytic intron fragment originates from the T4 phage nrdB gene.

[0472] In some embodiments, the 5' half of the type I catalytic intron contains a sequence having at least 80% sequence identity with 5'-AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3' (SEQ ID NO: 235).

[0473] In some embodiments, the 5' half of the type I catalytic intron contains a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3' (SEQ ID NO: 235).

[0474] In some embodiments, half of the type I catalytic intron fragment originates from the T4 phage nrdD gene.

[0475] In some embodiments, the 3' half of the type I catalytic intron fragment contains a sequence having at least 80% sequence identity with 5'-CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG-3' (SEQ ID NO:237).

[0476] In some embodiments, the 3' half of the type I catalytic intron fragment contains a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG-3' (SEQ ID NO:237).

[0477] In some embodiments, half of the type I catalytic intron fragment originates from the T4 phage nrdD gene. In some embodiments, half of the type I catalytic intron fragment originates from the T4 phage nrdD gene, and half of the type I catalytic intron fragment originates from the T4 phage nrdD gene.

[0478] In some embodiments, the 5' half of the type I catalytic intron contains a sequence having at least 80% sequence identity with 5'-TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTGCTAAATCAG-3' (SEQ ID NO:239).

[0479] In some embodiments, the 5' half of the type I catalytic intron comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTGCTAAATCAG-3' (SEQ ID NO:239).

[0480] In some embodiments, the 3' exon fragment contains a sequence having at least 80% sequence identity with 5'-GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO:241).

[0481] In some embodiments, the 3' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO:241).

[0482] In some embodiments, the 3' exon fragment contains a sequence that has at least 80% sequence identity with 5'-GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO:243).

[0483] In some embodiments, the 3' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO:243).

[0484] In some embodiments, the 5' exon fragment comprises a sequence having at least 80% sequence identity with 5'-TTTTTATGTATCTTTTGCGT-3' (SEQ ID NO: 245).

[0485] In some embodiments, the 5' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-TTTTTATGTATCTTTTGCGT-3' (SEQ ID NO: 245).

[0486] In some embodiments, the 3' exon fragment comprises a sequence having at least 80% sequence identity with 5'-ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA-3' (SEQ ID NO:247).

[0487] In some embodiments, the 3' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA-3' (SEQ ID NO:247).

[0488] In some embodiments, the 3' exon fragment comprises a sequence having at least 80% sequence identity with 5'-ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA-3' (SEQ ID NO:249).

[0489] In some embodiments, the 3' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA-3' (SEQ ID NO:249).

[0490] In some embodiments, the 5' exon fragment comprises a sequence having at least 80% sequence identity with 5'-TGCATTCCAAGCTTATGAGT-3' (SEQ ID NO: 251).

[0491] In some embodiments, the 5' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with 5'-TGCATTCCAAGCTTATGAGT-3' (SEQ ID NO: 251).

[0492] On the other hand, the linear polynucleotides used for cyclization can be cyclized or linked by non-nucleic acid moieties, which induce attractive forces between atoms or molecular surfaces at, near, or connected to the 5' and 3' ends of the linear polynucleotide used for cyclization. In one embodiment, one or more linear polynucleotides are cyclized or linked by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonance bonds, agnostic bonds, dipole bonds, conjugations, hyperconjugations, and antibonds.

[0493] In some embodiments, the linear polynucleotide for cyclization may contain ribozyme RNA sequences near the 5' and 3' ends. The ribozyme RNA sequence may be covalently linked to the peptide when the sequence is exposed to the remainder of the ribozyme. In one aspect, peptides covalently linked to ribozyme RNA sequences near the 5' and 3' ends may interact with each other, causing linear polynucleotide cyclization or linkage. In another example, after linkage using various methods known in the art (such as, but not limited to, protein ligation), peptides covalently linked to ribozyme RNA near the 5' and 3' ends may result in the cyclization or linkage of a linear primary construct or linear mRNA. A non-limiting list of ribozymes used in the linear primary constructs or linear polynucleotides of the present invention, or a non-exhaustive list of methods for incorporating or covalently linking peptides, is described in U.S. Patent Application No. US20030082768, the contents of which are incorporated herein by reference in their entirety.

[0494] On the other hand, cyclization chemistry can be used to generate cyclic polynucleotides. Such methods can include, but are not limited to, click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, aminophosphate linking, hemiacetal-imine crosslinking, base modification, and any combination thereof. In some chemistry methods, the 5' and 3' ends of the linear polynucleotide used for cyclization contain chemically reactive groups that can form new covalent bonds between the 5' and 3' ends of the molecule when these groups are brought close together. The 5' end may contain an NHS ester reactive group, and the 3' end may contain a 3' amino-terminal nucleotide, such that in an organic solvent, the 3' amino-terminal nucleotide on the 3' end of the linear RNA molecule will undergo nucleophilic attack on the 5'-NHS-ester moiety, forming a new 5'- / 3'-amide bond.

[0495] On the other hand, cyclic polynucleotides can be generated using a deoxyribonucleotide template transcribed in a cell-free system (e.g., via in vitro transcription) to produce linear RNA. Linear polynucleotides produce splice-compatible polynucleotides that can self-splice to produce cyclic polynucleotides.

[0496] In some embodiments, this disclosure provides a method for generating cyclic polynucleotides (e.g., in a cell-free system) by: providing linear polynucleotides; and self-splicing linear polynucleotides under conditions suitable for splicing 3' and 5' splice sites of linear polynucleotides; thereby generating cyclic polynucleotides.

[0497] In some embodiments, this disclosure provides a method for generating cyclic polynucleotides by: providing a deoxyribonucleotide encoding a linear polynucleotide; transcribing the deoxyribonucleotide in a cell-free system to generate a linear polynucleotide; optionally purifying the splice-compatible linear polynucleotide; and self-splicing the linear polynucleotide under conditions suitable for splicing the 3' and 5' splice sites of the linear polynucleotide, thereby generating a cyclic polynucleotide.

[0498] In some embodiments, this disclosure provides a method for generating cyclic polynucleotides by: providing a deoxyribonucleotide encoding a linear polynucleotide; and transcribing the deoxyribonucleotide in a cell-free system to generate a linear polynucleotide ( wherein the transcription occurs in solution under conditions suitable for splicing the 3' and 5' splice sites of the linear polynucleotide), thereby generating a cyclic polynucleotide. In some embodiments, the linear polynucleotide comprises a 5' break intron and a 3' break intron (e.g., a self-splicing construct for generating the cyclic polynucleotide). In some embodiments, the linear polynucleotide comprises a 5' annealed region and a 3' annealed region.

[0499] Suitable conditions for in vitro transcription and / or self-splicing may include any conditions (e.g., solutions or buffers, such as aqueous buffers or solutions) that mimic physiological conditions in one or more aspects. In some embodiments, suitable conditions include Mg2+ ions or salts thereof between 0.1 and 100 mM (e.g., 1-100 mM, 1-50 mM, 1-20 mM, 5-50 mM, 5-20 mM, or 5-15 mM). In some embodiments, suitable conditions include K+ ions or salts thereof, such as KCl, between 1 and 1000 mM (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include Cl- ions or salts thereof such as KCl between 1-1000 mM (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include Mn2+ ions or salts thereof such as MnCl2 between 0.1-100 mM (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1-1000 μM, 1-500 μM, 1-200 μM, 50-500 μM, 100-500 μM, 100-300 μM, 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include ribonucleoside triphosphates (NTPs) between 0.1 mM and 100 mM (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-10 mM, 1-100 mM, 1-50 mM, or 1-10 mM). In some embodiments, suitable conditions include a pH of 4 to 10 (e.g., a pH of 5 to 9, a pH of 6 to 9, or a pH of 6.5 to 8.5). In some embodiments, suitable conditions include a temperature of 4°C to 50°C (e.g., 10°C to 40°C, 15°C to 40°C, 20°C to 40°C, or 30°C to 40°C).

[0500] In some embodiments, linear polynucleotides are produced from deoxyribonucleic acid (e.g., deoxyribonucleic acid as described herein, such as a DNA vector, a linearized DNA vector, or cDNA). In some embodiments, linear polynucleotides are transcribed from deoxyribonucleic acid in a cell-free system (e.g., in vitro transcription).

[0501] On the other hand, cyclic polynucleotides can be produced in cells (e.g., prokaryotic or eukaryotic cells). In some embodiments, exogenous polynucleotides (e.g., linear polynucleotides as described herein or DNA molecules encoding the linear polynucleotides described herein) are provided to the cells. Linear polynucleotides can be transcribed in the cells from exogenous DNA molecules provided to the cells. Linear polynucleotides can also be transcribed in the cells from exogenous recombinant DNA molecules transiently provided to the cells. In some embodiments, the exogenous DNA molecules do not integrate into the cell's genome. In some embodiments, linear polynucleotides are transcribed in the cells from recombinant DNA molecules integrated into the cell's genome.

[0502] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell comprising the polynucleotides described herein is a bacterial cell or an archaea cell. For example, prokaryotic cells including the polynucleotides described herein can be *Escherichia coli*, halophilic archaea (e.g., *Haloferax volcaniii*), *Sphingomonas*, cyanobacteria (e.g., *Synechococcus elongatus*, *Spirulina* (*Arthrospira*), and *Synechocystis* spp.), *Streptomyces*, actinomycetes (e.g., *Nonomuraea*, *Kitasatospora*, or *Thermobifida*), and *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus anthracis*, *Bacillus cereus*). Prokaryotic cells include *Cereus*, beta-proteobacteria (e.g., *Burkholderia*), alpha-proteobacteria (e.g., *Agrobacterium*), *Pseudomonas* (e.g., *Pseudomonas putida*), and *Enterobacteria*. Prokaryotic cells can be grown in culture media. Prokaryotic cells can be contained in bioreactors.

[0503] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic cell is a unicellular fungal cell, such as yeast cells (e.g., *Saccharomyces cerevisiae* and other yeast genera (*Saccharomyces* spp.), *Brettanomyces* spp., *Schizosaccharomyces* spp., *Torulaspora* spp., and *Pichia* spp.)). In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. The unicellular animal cell may be a cell isolated from a multicellular animal and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular animal cell is dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. The unicellular plant cell may be a cell isolated from a multicellular plant and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular plant cell is dedifferentiated. In some embodiments, the unicellular plant cell is derived from plant callus tissue. In some embodiments, the single-celled cell is a plant cell protoplast. In some embodiments, the single-celled eukaryotic cell is a single-celled eukaryotic algal cell, such as a single-celled green algae, diatom, Euglena, or dinoflagellate. Non-limiting examples of target single-celled eukaryotic algae include Dunaliella salina, Chlorella vulgaris, Chlorella zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris species, Protosiphon botryoides, Botryococcus braunii, Cryptococcus species, Chlamydomonas reinhardtii and other Chlamydomonas species. In some embodiments, the single-celled eukaryotic cell is a protist cell. In some embodiments, the single-celled eukaryotic cell is a protozoan cell.

[0504] In some embodiments, the eukaryotic cell is the cell of a multicellular eukaryote. For example, the multicellular eukaryote may be selected from the group consisting of vertebrates, invertebrates, multicellular fungi, multicellular algae, and multicellular plants. In some embodiments, the eukaryote is a human. In some embodiments, the eukaryote is a non-human vertebrate. In some embodiments, the eukaryote is an invertebrate. In some embodiments, the eukaryote is a multicellular fungus. In some embodiments, the eukaryote is a multicellular plant. In embodiments, the eukaryotic cell is a human cell or a cell of a non-human mammal such as non-human primates (e.g., monkeys, apes), ungulates (e.g., bovids, including cattle, buffalo, bison, sheep, goats, and musk oxen; pigs; camelids, including camels, llamas, and alpacas; deer, antelopes; and equines, including horses and donkeys), carnivores (e.g., dogs, cats), rodents (e.g., rats, mice, guinea pigs, hamsters, squirrels), or rabbits (e.g., rabbits, hares). In this embodiment, the eukaryotic cell is a bird cell, such as a member of the bird groups Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Palaeognathae (e.g., ostrich, emu), Columbiformes (e.g., pigeon, wild pigeon), or Psittaciformes (e.g., parrot). In this embodiment, the eukaryotic cell is a cell of arthropods (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In this embodiment, the eukaryotic cell is a cell of a multicellular plant, such as angiosperms (which can be dicotyledons or monocotyledons) or gymnosperms (e.g., conifers, cycads, gynostemmas, ginkgo), ferns, phytophytes, lycophytes, or bryophytes. In this embodiment, the eukaryotic cell is a cell of a eukaryotic multicellular algae.

[0505] The eukaryotic cells can be grown in a culture medium. The eukaryotic cells can be contained in a bioreactor.

[0506] In some embodiments, any method for producing the cyclic polynucleotides described herein can be carried out in a bioreactor. A bioreactor is any vessel in which a chemical or biological process involving a living organism or a biochemically active substance derived from such an organism is carried out. Bioreactors are compatible with the cell-free methods described herein for producing cyclic RNA. Vessels used in bioreactors may include culture flasks, culture dishes, or culture bags, and may be disposable, autoclaved, or sterilizable. Bioreactors may be made of glass, or they may be polymer-based, or they may be made of other materials.

[0507] Examples of bioreactors include, but are not limited to, stirred tank (e.g., well-mixed) bioreactors and tubular (e.g., plug flow) bioreactors, airlift bioreactors, membrane stirred tanks, rotary stirred tank filters, vibrating mixers, fluidized bed reactors, and membrane bioreactors. The operation mode of a bioreactor can be a batch or continuous process. A bioreactor is continuous when reagent and product streams continuously enter and exit the system. A batch bioreactor may have a continuous recirculation stream but no continuous reagent feed or product harvest. Some methods disclosed herein relate to the large-scale production of cyclic polynucleotides. For large-scale production methods, the methods can be carried out in volumes from 1 liter (L) to 50 L or greater (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L or greater). In some embodiments, the method can be carried out in volumes of 5L to 10L, 5L to 15L, 5L to 20L, 5L to 25L, 5L to 30L, 5L to 35L, 5L to 40L, 5L to 45L, 10L to 15L, 10L to 20L, 10L to 25L, 20L to 30L, 10L to 35L, 10L to 40L, 10L to 45L, 10L to 50L, 15L to 20L, 15L to 25L, 15L to 30L, 15L to 35L, 15L to 40L, 15L to 45L, or 15 to 50L. In some embodiments, the bioreactor can produce at least 1g of circular RNA. In some embodiments, the bioreactor may produce 1-200 g of circular RNA (e.g., 1-10 g, 1-20 g, 1-50 g, 10-50 g, 10-100 g, 50-100 g, or 50-200 g of circular RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200 g per liter), per batch or reaction (e.g., 1-200 g per batch or reaction), or per unit time (e.g., 1-200 g per hour or per day). In some embodiments, more than one bioreactor may be used in series to increase production capacity (e.g., one, two, three, four, five, six, seven, eight, or nine bioreactors may be used in series).

[0508] In some embodiments, the cyclization efficiency is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, the cyclization efficiency is at least about 40%. In some embodiments, the cyclization efficiency is between about 10% and about 100%; for example, the cyclization efficiency is about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, the cyclization efficiency is between about 20% and about 80%. In some embodiments, the cyclization efficiency is between about 30% and about 60%. In some embodiments, the cyclization efficiency is about 40%.

[0509] Other methods for preparing the cyclic polynucleotides described herein are described in, for example, Khudyakov and Fields, Artificial DNA: Methods and Applications, CRC Press (2002); Zhao, Synthetic Biology: Tools and Applications (1st edition), Academic Press (2013); Muller and Appel, RNABiol, 2017, 14(8):1018-1027; and Egli and Herdewijn, Chemistry and Biology of Artificial Nucleic Acids (1st edition), Wiley-VCH (2012). Other methods for preparing cyclic polynucleotides are described in, for example, International Publication No. WO2022 / 247943, US Patent No. US11000547, International Publication No. 2018 / 191722, International Publication No. WO 2019 / 236673, International Publication No. WO 2020 / 023595, International Publication No. WO 2022 / 204460, International Publication No. WO 2022 / 204464, International Publication No. WO 2022 / 204466 and International Publication No. 2022 / 261490.

[0510] Other methods for synthesizing cyclic polynucleotides have also been described elsewhere (see, for example, U.S. Patent Nos. US 6210931, US 5773244, US 5766903, US 5712128, US 5426180, U.S. Publication No. US20100137407, International Publication Nos. WO 1992001813 and WO 2010084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); the contents of each of these are incorporated herein by reference in their entirety).

[0511] Purification methods

[0512] The methods described herein may include one or more purification steps. For example, in some embodiments, the linear polynucleotides are substantially enriched or pure (e.g., purified) prior to the self-splicing linear polynucleotides. In other embodiments, the linear polynucleotides are not purified prior to the self-splicing linear polynucleotides. In some embodiments, the resulting circular RNA is purified.

[0513] Purification may include the separation or enrichment of desired reaction products from one or more undesirable components, such as any unreacted starting material, byproducts, enzymes, or other reaction components. For example, purification of linear polynucleotides after transcription in a cell-free system (e.g., in vitro transcription) may include the separation or enrichment of self-splicing linear polynucleotides from a DNA template. Purification of post-splicing circular RNA products may be used to separate or enrich cyclic polynucleotides from their corresponding linear polynucleotides. Methods for purifying polynucleotides are known to those skilled in the art and include enzymatic purification or chromatographic methods.

[0514] In some embodiments, the purification method produces cyclic polynucleotides having less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polynucleotides.

[0515] In some embodiments, the reference standard for the amount of linear polynucleotide molecules present in a formulation (e.g., a pharmaceutical or agricultural formulation) is the presence of no more than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, or 200 ng / ml. Linear polynucleotide molecules at concentrations of 1, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 1 μg / ml, 10 μg / ml, 50 μg / ml, 100 μg / ml, 200 g / ml, 300 μg / ml, 400 μg / ml, 500 μg / ml, 600 μg / ml, 700 μg / ml, 800 μg / ml, 900 μg / ml, 1 mg / ml, 1.5 mg / ml, or 2 mg / ml.

[0516] In some embodiments, a reference standard for the amount of cyclic polynucleotide molecules present in a formulation (e.g., a pharmaceutical or agricultural formulation) is that the molecules constitute at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), and 95% (w / w) of the total ribonucleotide molecules in the formulation. 4% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 99.1% (w / w), 99.2% (w / w), 99.3% ( w / w), 99.4% (w / w), 99.5% (w / w), 99.6% (w / w), 99.7% (w / w), 99.8% (w / w), 99.9% (w / w), or 100% (w / w).

[0517] In some embodiments, the reference standard for the amount of linear polynucleotide molecules present in a formulation (e.g., a pharmaceutical or agricultural formulation) is that the linear polynucleotide molecules account for no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), or 50% (w / w) of the total ribonucleotide molecules in the formulation.

[0518] In some embodiments, the reference standard for the amount of cleaved polynucleotide molecules present in a formulation (e.g., a pharmaceutical or agricultural formulation) is that the cleaved polynucleotide molecules account for no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) of the total ribonucleotide molecules in the formulation.

[0519] In some embodiments, the reference standard for the amount of combined nicked and linear polynucleotide molecules present in a formulation (e.g., a pharmaceutical or agricultural formulation) is that the combined nicked and linear polynucleotide molecules account for no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), or 50% (w / w) of the total ribonucleotide molecules in the formulation. In some embodiments, the formulation (e.g., a pharmaceutical or agricultural formulation) is an intermediate formulation of a final cyclic polynucleotide finished product. In some embodiments, the formulation (e.g., a pharmaceutical or agricultural formulation) is an active pharmaceutical ingredient (API). In some embodiments, the formulation (e.g., a pharmaceutical or agricultural formulation) is a finished product intended for administration to a subject.

[0520] In some embodiments, the formulation of cyclic polynucleotides (e.g., pharmaceutical or agricultural formulations) is further processed (before, during, or after the reduction of linear polynucleotides) to substantially remove DNA, protein contaminants (e.g., cellular proteins (such as host cell proteins) or protein process impurities), endotoxins, single nucleotide molecules, and / or process-related impurities.

[0521] Linear polynucleotide elements

[0522] Linear polynucleotides contain elements as described herein.

[0523] The linear polynucleotides described herein are polynucleotide molecules having a 5' end and a 3' end. In some embodiments, linear RNA has a free 5' end or a 3' end. In some embodiments, linear RNA has a modified or protected 5' end or a 3' end that is resistant to degradation. In some embodiments, linear RNA has a non-covalently linked 5' or 3' end. In some embodiments, linear RNA is mRNA.

[0524] In some embodiments, the linear polynucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, or at least about 6,000 nucleotides. 1 nucleotide, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

[0525] The linear polynucleotides disclosed herein may include any element or combination of elements described herein, such as any element or combination of elements described above with respect to cyclic polynucleotides. Linear polynucleotides may include any one or more IRES, signal sequences, regulatory elements, cleavage domains, translation initiation sequences, untranslated regions, termination elements, or modifications as described herein (e.g., with respect to the cyclic polynucleotides above). Linear polynucleotides may include any number or configuration of such elements as described herein (e.g., with respect to the cyclic polynucleotides above).

[0526] How to use

[0527] The polynucleotides described herein (e.g., in pharmaceutical or agricultural compositions) can be administered to a subject. For example, cyclic or linear polynucleotides described herein (e.g., in pharmaceutical or agricultural compositions) can be administered to a subject. In some embodiments, the cyclic or linear polynucleotides described herein are delivered to cells.

[0528] In some embodiments, the polynucleotides described herein (e.g., cyclic polynucleotides, linear polynucleotides) (e.g., in pharmaceutical or agricultural compositions) are used to treat, improve, and / or prevent syndromes, conditions, diseases, and / or disorders.

[0529] Administration method

[0530] The polynucleotides described herein (e.g., cyclic polynucleotides, linear polynucleotides) (e.g., in pharmaceutical or agricultural compositions) can be administered to cells, tissues, or subjects in single or multiple doses.

[0531] A method of administering multiple doses of a composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in a pharmaceutical or agricultural composition) includes providing two or more compositions to cells, tissues, or a subject (e.g., a mammal) over a period of time. According to some embodiments, multiple doses of a composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in a pharmaceutical or agricultural composition) may be administered to a subject over a defined time period. A method according to this aspect of the invention comprises sequentially administering multiple doses of a composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in a pharmaceutical or agricultural composition) to a subject. As used herein, “sequentially administering” means administering each dose of a composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in a pharmaceutical or agricultural composition) to a subject at different time points (e.g., on different days separated by predetermined intervals (e.g., hours, days, weeks, or months)). In some embodiments, the present invention provides a method comprising sequentially administering to a subject a single initial dose of a composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) as described herein (e.g., in a pharmaceutical or agricultural composition), followed by administration of one or more second doses of the composition, and optionally followed by administration of one or more third doses of the composition.

[0532] The terms “initial dose,” “second dose,” and “third dose” refer to the order of administration of the composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in pharmaceutical or agricultural compositions). Thus, the “initial dose” is the dose administered at the start of a treatment regimen (also known as the “baseline dose”); the “second dose” is the dose administered after the initial dose; and the “third dose” is the dose administered after the second dose. The initial, second, and third doses may all contain the same amount of the composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in pharmaceutical or agricultural compositions), and in some embodiments, may differ from each other in terms of administration frequency. In some embodiments, the amount of the composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein contained in the initial, second, and / or third doses (e.g., in pharmaceutical or agricultural compositions) may differ from each other during treatment (e.g., appropriately increased or decreased). In some embodiments, one or more (e.g., 2, 3, 4, or 5) doses are administered as a “loading dose” at the start of the treatment regimen, followed by subsequent doses (e.g., a “maintenance dose”) administered at a smaller frequency.

[0533] In some embodiments, each second and / or third dose is administered immediately after the preceding dose. As used herein, the phrase "immediately preceding dose" means, in a sequence of multiple administrations, a dose of the composition of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) described herein (e.g., in pharmaceutical or agricultural compositions) administered to the subject without intermediate doses prior to the administration of the next dose in the sequence. In some embodiments, each second and / or third dose is administered daily, every 2, 3, 4, 5, 6, or 7 days after the immediately preceding dose. In some embodiments, each second and / or third dose is administered every 0.5 weeks, 1 week, 2 weeks, 3 weeks, or 4 weeks after the immediately preceding dose.

[0534] Methods according to this aspect of the invention may include administering to a subject any number of second and / or third doses of a composition of the polynucleotides described herein (e.g., cyclic polynucleotides, linear polynucleotides) (e.g., in pharmaceutical or agricultural compositions). For example, in some embodiments, only a single second dose is administered to the subject. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8 or more) second doses are administered to the subject. Similarly, in some embodiments, only a single third dose is administered to the subject. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8 or more) third doses are administered to the subject.

[0535] In some embodiments, the frequency of administering the second and / or third dose to the subject may vary during the treatment regimen. The frequency of administration may also be adjusted during the treatment process.

[0536] In some embodiments, multiple doses are provided to produce a level of the composition or to express a level of the encoded peptide in cells, tissues, or a subject. In some embodiments, multiple doses are provided to produce or maintain a level of the composition or to produce or maintain a level of the encoded peptide in cells, tissues, or a subject for a period of time, such as at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, or 150 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, 21, or 24 months, or at least 1, 2, 3, 4, or 5 years.

[0537] In some embodiments, the method includes providing (e.g., administering) at least a first composition and a second composition to cells, tissues, or a subject (e.g., a mammal, such as a human). In some embodiments, the method further includes providing (e.g., administering) a third composition, a fourth composition, a fifth composition, a sixth composition, a seventh composition, an eighth composition, a ninth composition, a tenth composition, or more compositions. In some embodiments, additional compositions are provided over the duration of cell lifespan. In some embodiments, additional compositions are provided (e.g., administered) when cells, tissues, or a subject benefit from the compositions.

[0538] In some embodiments, the first composition in a multiple-dose regimen comprises a first amount of the polynucleotides disclosed herein (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the second composition in a multiple-dose regimen comprises a second amount of the polynucleotides disclosed herein (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more compositions in a multiple-dose regimen comprise third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amounts of the polynucleotides disclosed herein (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the second amount of the polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is the same as the first amount of the polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the third amount of the polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is the same as the first amount of the polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amounts of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) are the same as the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the second amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is less than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the third amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is less than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amounts of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) are less than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the second amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is greater than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the third amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) is greater than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides). In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amounts of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) are greater than the first amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides).In some embodiments, the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the second composition varies by no more than 1%, 5%, 10%, 15%, 20%, or 25% of the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the first composition. In some embodiments, the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the second composition is no more than 1%, 5%, 10%, 15%, 20%, or 25% less than the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the first composition. In some embodiments, the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the second composition is 0.1 to 1000 times higher than the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the first composition. In some embodiments, the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the second composition is 0.1, 1, 5, 10, 100, or 1000 times higher than the amount of polynucleotides (e.g., cyclic polynucleotides, linear polynucleotides) in the first composition. In some embodiments, the amount of polynucleotides (e.g., cycl...

Claims

1. A cyclic polynucleotide, said cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) The element after the first ringing; (b) A first spacer element with a length of at least 100 ribonucleotides; (c) Polynucleotide cargo; (d) the second spacer element; and (e) The second ring-shaped element; Furthermore, the first circulated element and the second circulated element together form a circulated connection point.

2. A cyclic polynucleotide, said cyclic polynucleotide comprising, from 5' to 3', in the following order: (a) The element after the first ringing; (b) First spacer element; (c) Polynucleotide cargo; (d) A second spacer element with a length of at least 100 ribonucleotides; and (e) The second ring-shaped element; Furthermore, the first circulated element and the second circulated element together form a circulated connection point.

3. The cyclic polynucleotide of claim 1 or 2, wherein the length of the first spacer element is between 100 and 500 ribonucleotides.

4. The cyclic polynucleotide of claim 3, wherein the length of the second spacer element is between 100 and 500 ribonucleotides.

5. The cyclic polynucleotide of claim 4, wherein the first spacer element and the second spacer element each comprise 110 to 500 ribonucleotides.

6. The cyclic polynucleotide of claim 5, wherein the first spacer element and the second spacer element each comprise 120 to 500 ribonucleotides.

7. The cyclic polynucleotide of claim 6, wherein the length of each of the first spacer element and the second spacer element is 150 to 500 ribonucleotides.

8. The cyclic polynucleotide of claim 7, wherein the length of each of the first spacer element and the second spacer element is 200 to 500 ribonucleotides.

9. The cyclic polynucleotide of claim 4, wherein the length of each of the first spacer element and the second spacer element is 100 to 300 ribonucleotides.

10. The cyclic polynucleotide of claim 9, wherein the length of each of the first spacer element and the second spacer element is 100 to 200 ribonucleotides.

11. The cyclic polynucleotide of claim 9, wherein the length of each of the first spacer element and the second spacer element is 110 to 300 ribonucleotides.

12. The cyclic polynucleotide of claim 11, wherein the length of each of the first spacer element and the second spacer element is 120 to 300 ribonucleotides.

13. The cyclic polynucleotide of claim 12, wherein the length of each of the first spacer element and the second spacer element is 150 to 300 ribonucleotides.

14. The cyclic polynucleotide of any one of claims 1-13, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 500 nucleotides.

15. The cyclic polynucleotide of claim 14, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 nucleotides.

16. The cyclic polynucleotide of claim 15, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 nucleotides.

17. The cyclic polynucleotide of any one of claims 1-16, wherein the first spacer element or the second spacer element comprises: (i) A polyA region containing 80% to 100% adenosine residues; (ii) A polyAC region containing between 80% and 100% adenosine or cytosine residues; (iii) A poly-AU region containing between 80% and 100% adenosine or uridine residues; or (iii) A poly-AG region containing between 80% and 100% adenosine or guanosine residues.

18. The cyclic polynucleotide of any one of claims 1-17, wherein the cyclic polynucleotide exhibits at least twice the stability compared to a polynucleotide not having the first spacer element or the second spacer element.

19. The cyclic polynucleotide of any one of claims 1-18, wherein, after administration of the cyclic polynucleotide to a subject, the cyclic polynucleotide is detectable for at least twice as long as a polynucleotide without the first spacer element or the second spacer element.

20. The cyclic polynucleotide of any one of claims 1-19, wherein the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has an expression at least 4-fold greater than that of a polynucleotide that does not have the first spacer element or the second spacer element.

21. The cyclic polynucleotide of any one of claims 1-20, wherein the polynucleotide cargo comprises an expression sequence.

22. The cyclic polynucleotide of claim 21, wherein the polynucleotide cargo comprises an IRES operatively linked to the expression sequence.

23. The cyclic polynucleotide of claim 21 or 22, wherein the expressed sequence further comprises a 3' untranslated region or a 5' untranslated region.

24. The cyclic polynucleotide of any one of claims 21-23, wherein the expressed sequence encodes a polypeptide.

25. The cyclic polynucleotide of any one of claims 1-24, wherein the polynucleotide comprises between 500 and 20,000 ribonucleotides.

26. The cyclic polynucleotide of claim 25, wherein the polynucleotide comprises between 2,000 and 20,000 ribonucleotides.

27. The cyclic polynucleotide of any one of claims 1-26, wherein the cyclic junction comprises a splice junction.

28. The cyclic polynucleotide of claim 27, wherein the first cyclized element comprises a first exon fragment and the second cyclized element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are connected by the splice junction.

29. The cyclic polynucleotide of any one of claims 1-28, wherein the cyclization junction comprises an oligonucleotide clamp that hybridizes with the first cyclized element and with the second cyclized element.

30. The cyclic polynucleotide of claim 29, wherein the oligonucleotide clamp is a DNA clamp or an RNA clamp.

31. The cyclic polynucleotide of claim 29 or 30, wherein the first cyclized element comprises a region capable of hybridizing with a first region of the oligonucleotide intercalation plate, and the second cyclized element comprises a region capable of hybridizing with a second region of the oligonucleotide intercalation plate.

32. A linear polynucleotide, said linear polynucleotide comprising, from 5' to 3', in the following order: (a) The element after the first ringing; (b) A first spacer element with a length of at least 100 ribonucleotides; (c) Polynucleotide cargo; (d) the second spacer element; and (e) The second ring-shaped element; Furthermore, the first circulated element and the second circulated element together form a circulated connection point.

33. A linear polynucleotide, said linear polynucleotide comprising, from 5' to 3', in the following order: (a) The element after the first ringing; (b) First spacer element; (c) Polynucleotide cargo; (d) A second spacer element with a length of at least 100 ribonucleotides; and (e) The second ring-shaped element; Furthermore, the first circulated element and the second circulated element together form a circulated connection point.

34. The linear polynucleotide of claim 32 or 33, wherein the length of the first spacer element is between 100 and 500 ribonucleotides.

35. The linear polynucleotide of claim 34, wherein the length of the second spacer element is between 100 and 500 ribonucleotides.

36. The linear polynucleotide of claim 35, wherein the first spacer element and the second spacer element each comprise 110 to 500 ribonucleotides.

37. The linear polynucleotide of claim 36, wherein the first spacer element and the second spacer element each comprise 120 to 500 ribonucleotides.

38. The linear polynucleotide of claim 37, wherein the length of each of the first spacer element and the second spacer element is 150 to 500 ribonucleotides.

39. The linear polynucleotide of claim 38, wherein the length of each of the first spacer element and the second spacer element is 200 to 500 ribonucleotides.

40. The linear polynucleotide of claim 35, wherein the length of each of the first spacer element and the second spacer element is 100 to 300 ribonucleotides.

41. The linear polynucleotide of claim 40, wherein the length of each of the first spacer element and the second spacer element is 100 to 200 ribonucleotides.

42. The linear polynucleotide of claim 40, wherein the length of each of the first spacer element and the second spacer element is 110 to 300 ribonucleotides.

43. The linear polynucleotide of claim 42, wherein the length of each of the first spacer element and the second spacer element is 120 to 300 ribonucleotides.

44. The linear polynucleotide of claim 43, wherein the length of each of the first spacer element and the second spacer element is 150 to 300 ribonucleotides.

45. The linear polynucleotide of any one of claims 32-44, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 500 nucleotides.

46. ​​The linear polynucleotide of claim 45, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 nucleotides.

47. The linear polynucleotide of claim 46, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 nucleotides.

48. The linear polynucleotide of any one of claims 32-47, wherein the first spacer or the second spacer element comprises: (i) A polyA region containing 80% to 100% adenosine residues; (ii) A polyAC region containing between 80% and 100% adenosine or cytosine residues; (iii) A poly-AU region containing between 80% and 100% adenosine or uridine residues; or (iv) PolyAG regions containing between 80% and 100% adenosine or guanosine residues.

49. The linear polynucleotide of any one of claims 32-48, wherein the polynucleotide exhibits at least twice the stability compared to a polynucleotide not having the first spacer element or the second spacer element.

50. The linear polynucleotide of any one of claims 32-49, wherein, after administration of the polynucleotide to a subject, the polynucleotide is detectable for at least twice as long as a polynucleotide without the first spacer element or the second spacer element.

51. The linear polynucleotide of any one of claims 32-50, wherein the polynucleotide cargo encodes a polypeptide, wherein the polypeptide has an expression at least 4-fold greater than that of a polynucleotide that does not have the first spacer element or the second spacer element.

52. The linear polynucleotide of any one of claims 32-51, wherein the polynucleotide cargo comprises an expression sequence.

53. The linear polynucleotide of claim 52, wherein the polynucleotide cargo comprises an IRES operatively linked to the expression sequence.

54. The linear polynucleotide of claim 52 or 53, wherein the expressed sequence further comprises a 3' untranslated region or a 5' untranslated region.

55. The linear polynucleotide of any one of claims 52-54, wherein the expressed sequence encodes a polypeptide.

56. The linear polynucleotide of any one of claims 32-55, wherein the polynucleotide comprises between 500 and 20,000 ribonucleotides.

57. The linear polynucleotide of claim 56, wherein the polynucleotide comprises between 2,000 and 20,000 ribonucleotides.

58. The linear polynucleotide of any one of claims 32-57, wherein the cyclization junction comprises a splice junction.

59. The linear polynucleotide of claim 58, wherein the first cyclized element comprises a first exon fragment and the second cyclized element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are connected by the splice junction.

60. The linear polynucleotide of any one of claims 32-59, wherein the cyclization junction comprises an oligonucleotide clamp that hybridizes with the first cyclized element and with the second cyclized element.

61. The linear polynucleotide of claim 60, wherein the oligonucleotide clamp is a DNA clamp or an RNA clamp.

62. The linear polynucleotide of claim 60 or 61, wherein the first cyclized element comprises a region capable of hybridizing with a first region of the oligonucleotide intercalation plate, and the second cyclized element comprises a region capable of hybridizing with a second region of the oligonucleotide intercalation plate.

63. The linear polynucleotide according to any one of claims 32-62, wherein: The first cyclization element comprises a first catalytic intron fragment, a first splice site dinucleotide, and a first exon fragment; and The second cyclization element comprises a second catalytic intron fragment, a second splice site dinucleotide, and a second exon fragment.

64. The linear polynucleotide of claim 63, wherein the first catalytic intron fragment and the second catalytic intron fragment are capable of self-splicing together to covalently link the first exon region and the second exon region to produce a cyclic polynucleotide.

65. The linear polynucleotide of claim 63 or 64, wherein the first catalytic intron fragment and the second catalytic intron fragment are derived from the pre-tRNA-Leu gene of Anabaena or the pre-rRNA of Tetrahymena.

66. The linear polynucleotide of any one of claims 32-65, wherein the first cyclization element comprises a region capable of hybridizing with a first region of the oligonucleotide intercalation plate, and the second cyclization element comprises a region capable of hybridizing with a second region of the oligonucleotide intercalation plate.

67. A DNA vector comprising an RNA polymerase promoter operatively linked to a sequence encoding a linear polynucleotide as described in any one of claims 32-66.

68. A cyclic polynucleotide, said cyclic polynucleotide being produced from a linear polynucleotide as described in any one of claims 32-66 or from a DNA vector as described in claim 67.

69. A pharmaceutical composition comprising a linear polynucleotide, a cyclic polynucleotide, or a DNA carrier as described in any one of claims 1-66, and a pharmaceutically acceptable excipient.

70. A method for expressing a polypeptide in a cell or a subject, the method comprising providing the cell or the subject with a linear polynucleotide, a cyclic polynucleotide, a DNA carrier, or a pharmaceutical composition as described in any one of claims 1-69.

71. A method for generating a cyclic polynucleotide from a linear polynucleotide as described in any one of claims 32-66, the method comprising providing the linear polynucleotide under conditions suitable for self-splicing of the linear polynucleotide to generate the cyclic polynucleotide.

Images