Method for detecting rape transgenic nucleic acid sequence based on micro-fluidic chip and application thereof

By using biochar as a solid-phase carrier and an improved extraction solution formulation, a simplified microfluidic chip structure was constructed, solving the problems of cumbersome operation and high cost in the detection of genetically modified rapeseed. This enabled rapid and convenient nucleic acid elution and detection, improving detection efficiency and accuracy.

CN121137201APending Publication Date: 2025-12-16XINJIANG ENTRY-EXIT INSPECTION & QUARANTINE BUREAU INSPECTION & QUARANTINE TECH CENT +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510489393.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-06-19
Filing Date
2025-04-18
Publication Date
2025-12-16

AI Technical Summary

Technical Problem

Existing technologies for detecting genetically modified rapeseed suffer from problems such as cumbersome operation, long time consumption, high cost, and strong equipment dependence. In particular, microfluidic chips and magnetic bead extraction methods are limited in large-scale applications, making it difficult to achieve rapid and convenient nucleic acid elution and detection.

Method used

Using biochar as a solid-phase carrier, combined with improved extraction and elution formulations, a simplified microfluidic chip structure was constructed to achieve rapid extraction, elution, and detection of nucleic acids. This method is suitable for the simultaneous detection of various genetically modified rapeseed varieties, reducing costs and improving efficiency.

Benefits of technology

It enables efficient and rapid detection of six genetically modified rapeseed varieties, reduces detection costs, improves detection accuracy and sensitivity, is applicable to various solid-phase carriers, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121137201A_ABST
    Figure CN121137201A_ABST
Patent Text Reader

Abstract

The invention provides a method for detecting a nucleic acid sequence of rape transgenes based on a micro-fluidic chip and application of the method, aiming at six transgenes of rape, optimal primer probe groups are respectively screened, a detection system is constructed, the detection system comprises an extracting solution, an eluent, a detection reagent and the micro-fluidic chip, the extracting solution simultaneously contains biochar and a nucleic acid extraction reagent, the eluent contains a nucleic acid detection reagent, and the micro-fluidic chip is used for detecting the nucleic acid sequence of the rape transgenes. By improving the formula of the extracting solution, the compatibility of the biochar and the DNA extracting reagent is improved, the nucleic acid extraction efficiency of the biochar is effectively improved, the formulas of the eluent and the detection reagent are optimized, the structure and the preparation process of the micro-fluidic chip are improved, the structure is simpler, the cost is lower, and the application range is wider. The whole process of rapid extraction, elution, amplification and nucleic acid detection of biochar from finished oil can be completed, simultaneous and efficient detection of six transgenes is realized, the required time is shorter, and the accuracy of a detection result can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The present application claims priority to the Chinese prior application with the application number 2024107898334 and the filing date of June 19, 2024; the entire contents of which are incorporated herein as part of the present application. TECHNICAL FIELD

[0002] The present application relates to the technical field of nucleic acid detection, in particular, to a method for detecting transgenic nucleic acid sequences of Brassica napus based on a microfluidic chip and application thereof. BACKGROUND

[0003] Brassica napus is an important economic crop, and its transgenic technology has been quite mature. Transgenic Brassica napus is mainly used to improve the stress resistance of crops, increase yield, and improve quality. At present, several transgenic Brassica napus varieties have been approved for commercial planting worldwide. However, the safety of transgenic crops has been controversial, and therefore the requirement for its detection technology is also increasing.

[0004] Currently, nucleic acid detection is required for transgenic Brassica napus detection, and the main technologies include: 1. PCR technology, which has the advantages of high sensitivity and strong specificity. However, it is complicated to operate, time-consuming, requires complex pretreatment steps and high-precision instruments and equipment. In addition, PCR technology requires a large amount of time and manual operation for screening multiple transgenic Brassica napus strains one by one. 2. Immunological detection methods (such as ELISA), which have the advantages of relatively simple operation and low cost, but the disadvantages of lower sensitivity and specificity than molecular biology methods, and are easily disturbed.

[0005] Microfluidic technology has made significant progress in recent years, which is characterized by the integration of sample processing, reaction and detection on a microchip, with the advantages of high automation, low sample consumption, and fast reaction speed. Microfluidic chips can handle multiple samples at the same time, greatly improving the detection efficiency and being suitable for large-scale screening. And because of its small size, it is easy to carry and suitable for on-site detection. However, it still cannot be widely promoted at present, mainly due to the constraints of manufacturing and practical application. The microfluidic chip has high precision for the structure of small channels and components, and the production cost is high; different microfluidic systems lack unified standards, making it difficult to compare data, which limits its application in clinical diagnosis.

[0006] Nucleic acid detection needs to be pretreated by lysis and purification. Mild and efficient magnetic bead extraction method is concerned. The magnetic bead method usually includes four steps of lysis, binding, washing and elution. The core of the magnetic bead is made of Fe3O4, which has superparamagnetism. The outer layer is coated with silica, which has good stability. The surface is modified by special groups. Under specific ion conditions, it can specifically adsorb the free nucleic acid molecules in the sample through electrostatic interaction, hydrogen bond interaction and other ways to form nucleic acid-magnetic bead complex, while proteins and other impurities remain in the sample liquid, which can realize the rapid extraction and separation of nucleic acid. However, the production process of magnetic beads is complex, which needs professional equipment personnel and technical personnel, and the price is high, which greatly increases the cost of detection, and the relatively low economic benefit limits the application of magnetic beads in large-scale liquid sample, especially in remote areas. Therefore, a more economical and practical method needs to be found.

[0007] Centrifugal microfluidic chip drives the flow of liquid by rotating the centrifugal microfluidic chip, which can realize the manipulation of liquid on the sub-millimeter scale using centrifugal force. Compared with traditional microfluidic chips, the whole device is more compact and simple to handle, so it is gradually applied to the field of nucleic acid sample detection. The centrifugal microfluidic chip on the market usually lyses and purifies the sample outside the chip before adding it into the microfluidic chip for nucleic acid detection. Few nucleic acid extraction is integrated into a single chip, because this will make the chip structure complex, increase the control difficulty and increase the cost.

[0008] CN116144458A provides a centrifugal microfluidic chip for detecting nucleic acid extracted by magnetic beads, but in the nucleic acid elution process, an additional magnet is needed to adsorb the magnetic beads, which makes the use process of the centrifugal microfluidic chip more complicated, has high dependence on equipment, and also increases the cost. CN117551540A provides a centrifugal microfluidic chip for detecting nucleic acid extracted by magnetic beads without magnet, but its structure is very complex, which needs to specially set magnetic bead temporary storage chamber, flow channel stop valve, hot melt valve and other structures, and one chip can only be used for detection of one sample. In addition, the above two kinds of centrifugal microfluidic chips can only be used for magnetic bead extraction of nucleic acid, and cannot be used for extraction, elution and detection of nucleic acid by other solid phase carriers.

[0009] In view of these technical problems, it is urgent to find a centrifugal microfluidic chip which can quickly and conveniently complete the elution and detection of nucleic acid, not only suitable for magnetic beads, but also suitable for other solid phase carriers with lower cost, and can significantly improve the efficiency of nucleic acid detection, so as to realize the efficient detection of transgenic rape. SUMMARY

[0010] To solve the above problems, the application provides a method for detecting rapeseed transgenic nucleic acid sequences based on a microfluidic chip and application thereof, optimal primer probe groups are screened for six transgenes of rapeseed, a detection system is constructed, including an extraction solution, an eluent, a detection reagent and a microfluidic chip, the extraction solution contains biochar and nucleic acid extraction reagents at the same time, the compatibility of biochar and DNA extraction reagents is improved by improving the formula of the extraction solution, the nucleic acid extraction efficiency of biochar is effectively improved, the formula of the eluent and the detection reagent is optimized, the structure and preparation process of the microfluidic chip are improved, the structure is simpler, the cost is lower, the whole process of rapid extraction, elution, amplification and nucleic acid detection of biochar from finished oil can be completed, the six transgenes can be simultaneously and efficiently detected, the required time is shorter, and the accuracy of the detection result can be improved.

[0011] In one aspect, the application provides a primer probe group for detecting rapeseed transgenic nucleic acid sequences, including any one or more of the following six gene primer probe groups:

[0012] (1) an upstream primer, a downstream primer and a probe for detecting a CaMV-35S promoter, the upstream primer is shown as Seq ID NO. 1, the downstream primer is shown as Seq ID NO. 2, and the probe is shown as Seq ID NO. 3;

[0013] (2) an upstream primer, a downstream primer and a probe for detecting PEP, the upstream primer is shown as Seq ID NO. 4, the downstream primer is shown as Seq ID NO. 5, and the probe is shown as Seq ID NO. 6;

[0014] (3) an upstream primer, a downstream primer and a probe for detecting a CaMV-35S terminator, the upstream primer is shown as Seq ID NO. 7, the downstream primer is shown as Seq ID NO. 8, and the probe is shown as Seq ID NO. 9;

[0015] (4) an upstream primer, a downstream primer and a probe for detecting a NOS terminator, the upstream primer is shown as Seq ID NO. 10, the downstream primer is shown as Seq ID NO. 11, and the probe is shown as Seq ID NO. 12;

[0016] (5) an upstream primer, a downstream primer and a probe for detecting Actin, the upstream primer is shown as Seq ID NO. 13, the downstream primer is shown as Seq ID NO. 14, and the probe is shown as Seq ID NO. 15;

[0017] (6) the upstream primer of MS1, the downstream primer and the probe, wherein the upstream primer is shown as Seq ID NO. 16, the downstream primer is shown as Seq ID NO. 17, and the probe is shown as Seq ID NO. 18.

[0018] The application establishes a microfluidic rapid detection technology based on isothermal nucleic acid amplification, realizes rapid extraction and detection of nucleic acid in finished oil, and can detect the marker genes of multiple strains to complete rapid detection.

[0019] The application first completes bioinformatics analysis of nucleic acid sequences of six transgenic rapeseed marker genes, which are CaMV-35S promoter (Seq ID NO. 37), PEP (Seq ID NO. 38), CaMV-35S terminator (Seq ID NO. 39), NOS terminator (Seq ID NO. 40), Actin (Seq ID NO. 41) and MS1 (Seq ID NO. 42). For the six genes, the optimal primer probe is screened, and when the primer probe is used for amplification and detection of the corresponding gene, the amplification curve is optimal, the peak appears earliest, the fluorescence intensity is highest, and the exponential phase and platform phase are obvious. Thus, a combination containing six groups of primer probes is obtained, and the primer probe combination can be used to detect six kinds of transgenes from the same sample with high sensitivity and high specificity, so as to judge whether the rapeseed is transgenic rapeseed and which kind of transgenic rapeseed.

[0020] On the other hand, the application provides a detection system for rapeseed transgenic nucleic acid sequence, which comprises an extraction solution, an elution solution, a detection reagent and a microfluidic chip; the extraction solution contains a solid carrier for adsorbing the nucleic acid to be detected from the sample; the detection reagent contains the primer probe combination as described above;

[0021] The microfluidic chip comprises a detection unit, and the detection unit is provided with a quantification cavity, an elution cavity and a detection zone; the elution cavity is used for eluting the nucleic acid to be detected from the solid carrier by the elution solution;

[0022] The quantification cavity is used for temporarily storing the added liquid and quantifying the added liquid, and the liquid includes the elution solution;

[0023] The quantification cavity and the elution cavity are connected through a fluid channel;

[0024] The detection zone is used for detecting the content of the nucleic acid to be detected, and the detection zone is connected with the fluid channel through a capillary channel.

[0025] The application mixes forward primers, reverse primers, probes of six marker genes, DNA polymerase, dNTP and other reagents, and pre-adds them into a detection cavity of a microfluidic chip; when a sample to be tested is added into the chip, nucleic acid amplification reaction is carried out in the chip, and whether the sample is a transgenic rape is determined by detecting a fluorescence signal.

[0026] In some modes, six sets of primers and probe structures corresponding to common rape transgenic systems are placed in six detection cavities respectively, and six parallel tests can be carried out on the same sample to identify which transgenic system it belongs to.

[0027] In some modes, the microfluidic chip is a centrifugal microfluidic chip. The centrifugal microfluidic chip (referred to as a chip) needs to be kept in a horizontal state during use, and the sample adding port is placed upward. In some modes, the chip can be inserted into a matching detection device to keep the chip in a horizontal state with the sample adding port upward, and the center position of the chip is fixed with a rotating shaft for centrifugation of the detection device, so that the rotating shaft can drive the chip to rotate centrifugally; in some modes, the detection device can provide heat source for the detection area of the chip to help complete the nucleic acid amplification reaction; in some modes, the detection device can also detect the fluorescent substances generated after the nucleic acid amplification reaction in the chip to read the detection results.

[0028] The microfluidic chip provided by the application can separate and quantitate the sample containing the solid carrier and the eluent initially by sequentially adding the sample containing the solid carrier and the eluent, and then start the elution process as the centrifugation continues. The eluent in the quantitation cavity continuously enters the elution cavity and collides with the solid carrier, the solid carrier disperses outward as far as possible under the action of centrifugal force and approaches the inner wall of the elution cavity farthest from the center, and the remaining liquid is continuously mixed or squeezed out of the elution cavity. It can be seen that the quantitation cavity not only has a quantitation function, but also makes the mixing and elution more sufficient, improves the elution efficiency, and thus improves the detection sensitivity.

[0029] The quantitation cavity and the elution cavity are connected by a fluid channel, which is a channel connecting the outlet of the quantitation cavity and the inlet of the elution cavity.

[0030] The microfluidic chip provided by the application is provided with multiple detection units, each detection unit is provided with a quantitation cavity, an elution cavity and a detection area, and can be used for simultaneous detection of multiple different target samples, such as detection of multiple different nucleic acid targets, and also can be used for detection of nucleic acid targets eluted from multiple different solid carriers.

[0031] In some modes, the number of detection units is four, which are uniformly arranged around the rotation center, and each detection unit can be used for detection of one sample, so that the detection throughput of the chip is higher.

[0032] Furthermore, the solid support includes one or more of biochar, magnetic beads, gel, resin, and cellulose; the microfluidic chip includes a rotation center for connection to a centrifugation drive device to drive the microfluidic chip to centrifuge; the number of detection units is one or more, arranged around the rotation center.

[0033] Furthermore, the solid support is biochar, which is prepared using rice straw and chicken manure as carbon sources.

[0034] Biochar is characterized by its low cost and readily available raw materials. When used as a solid-phase carrier for nucleic acid detection, it can significantly reduce costs. However, biochar has a lower density and is more porous than magnetic beads, and it is non-magnetic, making it impossible to separate by a magnetic field. This makes separating biochar from the eluted sample more difficult than with magnetic beads. Therefore, it is necessary to design the structure of various chambers and channels in the chip to facilitate the smooth elution of nucleic acid samples from the biochar, and to ensure that the eluted sample smoothly enters the detection area for testing. The biochar, due to centrifugal force, aggregates near the external source of the chip and is blocked by steps in the elution chamber, ensuring that it does not clog or affect the detection of the sample.

[0035] Studies have shown that biochar prepared using rice straw and chicken manure as carbon sources has better nucleic acid adsorption efficiency, which can improve the detection accuracy and sensitivity of genetically modified rapeseed.

[0036] Furthermore, the extract also contains a mixture of Tris-saturated phenol, chloroform-isoamyl alcohol, and ethidium bromide.

[0037] The extract contains both biochar and nucleic acid extraction reagents. The nucleic acid extraction reagents include a Tris-saturated phenol (pH 8.0), a chloroform:isoamyl alcohol (24:1) mixture, 0.5% Triton X-100 as a surfactant, and 0.5-1% ethidium bromide. Triton X-100 has an amphiphilic molecular structure; its hydrophilic groups can interact with water molecules, while its hydrophobic groups can bind to the hydrophobic regions of biomolecules such as lipids and proteins. During DNA extraction, it reduces the surface tension of the liquid, promotes rapid mixing of Tris-saturated phenol with the rapeseed oil sample, and enables more efficient denaturation and separation of proteins from DNA. Simultaneously, it facilitates sufficient contact between the chloroform:isoamyl alcohol mixture and the sample, further enhancing the removal of proteins and other impurities. Ethidium bromide helps DNA migrate between the oil and aqueous phases and helps nucleic acid molecules overcome the phase interface, making it crucial for nucleic acid extraction from rapeseed samples.

[0038] Furthermore, the extract also contains a mixture of Tris-saturated phenol, chloroform and isoamyl alcohol, ethidium bromide, phenol, guanidine isothiocyanate, and β-mercaptoethanol.

[0039] Direct mixing of biochar and nucleic acid extraction reagents carries the risk of incompatibility, which can affect nucleic acid extraction efficiency. This invention addresses this by adding phenol, guanidine isothiocyanate, and β-mercaptoethanol to the extraction solution. This alters surface tension, improves the compatibility between biochar and DNA extraction reagents, and facilitates the suspension and centrifugation of biochar, thereby enhancing its nucleic acid extraction efficiency.

[0040] Furthermore, the eluent includes Tris-HCl buffer, sodium ion concentration of 0.5M, magnesium ion concentration of 0.1M, and 0.2% Tween 20.

[0041] This invention screens the most suitable eluent formulation, which can improve the elution effect of nucleic acids in biochar. At the same time, since the eluent is a low-concentration aqueous solution, its addition to the chip can disrupt the chemical equilibrium within the elution chamber. Because the first sample addition is a biochar-containing sample, and the second addition is an aqueous eluent, the concentration is changed, making it easier for the sample to be eluted.

[0042] Furthermore, the capillary channel includes a first segment and a second segment; the first segment is a channel that bends from the outlet of the fluid channel toward the center of rotation, and the second segment is a channel that bends from the end of the first segment toward the detection area.

[0043] When the chip is centrifuged, the fluid sample flows outward from the center under centrifugal force. The first section of the capillary channel is designed so that if the sample wants to enter the first section, its flow direction is opposite to the centrifugal direction. Therefore, the sample cannot enter the capillary channel during centrifugation. The first section of the capillary channel is equivalent to adding a threshold for the sample to enter the capillary channel and strengthening the protection against biochar entry. First, it ensures that the sample will not enter the capillary channel during centrifugation, mixing, and elution, and the biochar cannot clog the capillary channel. Second, when centrifugation stops, the supernatant sample can penetrate into the capillary channel under the action of surface tension, while the biochar, due to being thrown to the bottom of the elution chamber by centrifugal force, cannot contact or clog the capillary channel.

[0044] Furthermore, a blocking block is provided below the fluid channel to at least partially block the area below the metering chamber or elution chamber; a step is also provided on the fluid channel, the step being located on the side of the fluid channel near the outlet leading to the capillary channel; the detection area includes a detection channel and a detection chamber connected to the detection channel; the detection channel is connected to the capillary channel; the number of detection chambers is at least 6.

[0045] Furthermore, a blocking block is provided below the fluid channel to at least partially block the area below the metering chamber or elution chamber; a step is also provided on the fluid channel, the step being located on the side of the fluid channel near the outlet leading to the capillary channel.

[0046] The fluid channel connects the metering chamber and the elution chamber. However, due to the setting of the blocking block, liquid cannot flow through the lower part of the fluid channel. It is equivalent to the metering chamber and the elution chamber only having fluid communication in the upper chamber, while the lower part is blocked. This setting also helps to prevent biochar from clogging the capillary channel, because under the action of centrifugal force, biochar will basically sink to the bottom of the elution chamber.

[0047] The step is located above the barrier block and near the outlet leading to the capillary channel, so that the liquid surface near the outlet forms a U-shaped liquid shape similar to the residual liquid surface, thereby raising the liquid surface here and helping the sample to penetrate into the capillary channel under the action of surface tension.

[0048] In some embodiments, the width of the fluid channel is 1.0-1.25 mm, and the height of the metering chamber and elution chamber is 4.5-5.5 mm, which can be adjusted according to the required sample volume. The height of the fluid channel is reduced to 1.0-1.5 mm because the lower part of the channel is blocked by a blocking block.

[0049] In some embodiments, the step has a height of 0.5-0.7 mm and a width of 0.4-0.6 mm.

[0050] In some embodiments, the metering cavity has a first inlet and a first outlet, and the size of the metering cavity gradually decreases near the first outlet.

[0051] In some embodiments, the metering chamber is an inverted pentagonal compartment, generally resembling the shape of a funnel.

[0052] The shape design of the quantitative chamber helps the sample containing biochar to quickly gather and enter the elution chamber under the action of centrifugal force after entering. It also helps the sample containing biochar to remain stably in the elution chamber after entering, and it is not easy to backflow. It can be seen that the structural design of the quantitative chamber can help prevent the backflow of biochar.

[0053] The metering chamber is used to quantitatively store the added liquid, and its volume can be adjusted according to the specific purpose and sample quantity.

[0054] In some embodiments, the metering cavity has a width of 6.25±0.5 mm, a length of 4.8±0.5 mm, and a volume of 200±30 μL.

[0055] Furthermore, the metering chamber is also provided with an exhaust channel and a waste liquid discharge channel; the exhaust channel extends from the metering chamber toward the rotation center, and the exhaust port of the exhaust channel is connected to the outside, used to control the flow of gas in the metering chamber and / or the elution chamber; the waste liquid discharge channel extends from the metering chamber away from the rotation center and is connected to the waste liquid pool.

[0056] After the liquid enters the chip from the sample loading area, it enters the corresponding chamber under centrifugal force. The gas in this chamber needs to be expelled through the exhaust channel. The quantitative chamber and the elution chamber share a single exhaust channel, simplifying the preparation process. The exhaust channel is oriented opposite to the centrifugal direction. Therefore, as the liquid enters the quantitative or elution chamber under centrifugal force, it will not be expelled through the exhaust channel. Liquid will only enter the exhaust channel when both chambers are full. The channel exiting the quantitative chamber has branches. The first branch, opposite to the centrifugal direction, leads to the exhaust port (exhaust channel). The second branch, in the same direction as the centrifugal direction, leads to the waste liquid reservoir (waste liquid discharge channel). Under centrifugal force, the liquid will inevitably choose the waste liquid discharge channel, which is in the same direction as the centrifugal direction, to enter the waste liquid reservoir. Therefore, when liquid begins to enter the waste liquid reservoir, it indicates that the quantitative chamber is full. Thus, the waste liquid reservoir also helps in the quantitative measurement of liquid within the quantitative chamber.

[0057] The exhaust port is a circular through-hole structure with a diameter of 2.5mm, used to discharge gas inside the chip, balance the internal and external air pressure, and prevent air bubbles from clogging the microchannels and affecting liquid flow.

[0058] In some methods, the surface of the vent is pre-sealed with a transparent film for sealing. When venting is required during use, the transparent film can be punctured to release the air; if sealing is required later, a transparent film can be added again for sealing.

[0059] Furthermore, the elution chamber is provided with a second inlet, and the size of the elution chamber gradually decreases near the second inlet.

[0060] In some configurations, the elution chamber is a pentagonal compartment with a narrowed inlet. This helps prevent the biochar from easily flowing out of the chamber after the sample enters during centrifugation. The elution chamber is used to elute the nucleic acid to be tested from the biochar and simultaneously store the eluted liquid. The size and volume of the elution chamber can be set according to specific product requirements and can be fine-tuned within a suitable range.

[0061] In some embodiments, the elution chamber has a width of 5.8±0.5 mm, a length of 4.8±0.5 mm, and a volume of 230±30 μL.

[0062] Furthermore, the detection area includes a detection channel and a detection cavity connected to the detection channel; the detection channel is connected to a capillary channel.

[0063] Furthermore, the detection channel is provided with a second exhaust channel, which extends from the detection channel toward the rotation center. The exhaust port of the second exhaust channel is connected to the outside and is used to control the flow of gas in the detection area. The number of detection chambers is one or more.

[0064] Multiple detection chambers can be used to simultaneously detect nucleic acids for various purposes. In some methods, the number of detection chambers is seven.

[0065] In some embodiments, the detection channel is an arc-shaped channel arranged along the circumference, and the detection cavity is a circular room with a diameter of 1.5-2.5 mm, which matches the spot size of the fluorescence detection module in the detection device.

[0066] In some methods, the fluorescence detection process of the chip is carried out during slow centrifugation, in which the chip slowly rotates, thereby aligning each detection chamber with the fluorescence detection channel in turn to complete the fluorescence detection.

[0067] In some methods, a line is established from the center of rotation to the center of the detection chamber, and the angle between the lines connecting two adjacent detection chambers is 7 degrees. This degree is an integer multiple of the rotation degree of a single stepper motor in the centrifuge (0.7 degrees). At this angle, fluorescence interference between adjacent detection chambers can be avoided, which makes it easier to calculate the position of each detection chamber and record the reading results, thus improving the positioning accuracy during centrifugation and detection.

[0068] In some methods, nucleic acid amplification reagents and / or nucleic acid detection reagents need to be pre-placed in the detection chamber.

[0069] In some embodiments, the nucleic acid amplification reagent and / or nucleic acid detection reagent is a solid, dried reagent.

[0070] In some methods, the amplification reaction includes, but is not limited to, EPA, RPA, LAMP, NEAR, NASBA, HAD, TMA, SAT, RCR, etc., and the solid drying reagent is in the form of, but is not limited to, spherical, powdered, tablet or block formulations in the form of lyophilized, oven-dried or air-dried.

[0071] In some methods, the nucleic acid detection includes, but is not limited to, various detection systems established by ERA, RPA, LAMP, NEAR, NASBA, HAD, TMA, SAT, PCR, hybridization probe technology, CRISPR, Ago, RNase H, etc., and the detection reagent is a solid detection reagent, including but not limited to spherical, powder, tablet or block preparations in the form of lyophilization, drying, air drying, etc.

[0072] Furthermore, it also includes a sample loading area, which is connected to the quantitative chamber via a sample loading channel; the sample loading area, the quantitative chamber, and the elution chamber are arranged sequentially along the rotational centrifugation direction of the centrifugal microfluidic chip.

[0073] In some embodiments, the sample loading area is an elliptical chamber with a major axis of 12±0.5 mm and a minor axis of 7.5±0.5 mm. It has a 2 mm diameter loading hole at the top for adding sample solution and elution solution, and a 2 mm diameter vent hole for venting air from the chamber during liquid loading to balance the air pressure. Compared with a circle, the elliptical structure can make full use of the area of ​​the chip near the center, maximizing the sample loading volume with the same disk diameter, and effectively improving the space utilization of the chip.

[0074] In some methods, the sample loading area of ​​the chip is covered with a transparent film for sealing. During sample loading, the transparent film is punctured with a syringe to load the sample. After the sample fills the main channel, the surface of the loading hole can be sealed with another transparent film.

[0075] Furthermore, the rotation center is a fixing hole, which allows the centrifugal microfluidic chip to be mounted on the rotating shaft of the centrifugal drive device, thereby enabling centrifugal rotation.

[0076] In some embodiments, the fixing hole is used for a good fit between the chip and the drive component of the centrifugal drive device. The fixing hole is approximately elliptical and can be combined with the drive component of the centrifugal drive device to fix the chip and provide centrifugal power.

[0077] In some embodiments, the fixing hole is a through circular hole with a diameter of 13 to 15 mm, which fits perfectly with the fixed rotating shaft of the drive system.

[0078] Furthermore, the system includes a plastic upper layer, a silicone inner membrane, and a plastic lower layer, with the detection unit located on the plastic upper layer.

[0079] The chip provided by this invention has a sandwich structure, comprising a plastic upper layer, a silicone inner film, and a plastic lower layer. The sandwich structure is a common fabrication process for microfluidic chips, consisting of three layers. The middle layer is typically a soft silicone material with microchannels, while the top and bottom layers are usually made of rigid materials such as plastic, glass, or polymers. This structure can reduce material costs and optimize the process flow, achieving a dual improvement in cost-effectiveness and technical performance.

[0080] The upper plastic layer is an injection-molded polydimethylsiloxane (PDMS) disc, 1.8-2 mm thick and 75 mm in diameter, with a downward-protruding microchannel structure. The capillary portion has a channel width of 0.3 mm, while the remaining microchannels are 0.8-1 mm wide. The outer sides of the channels are supported by a 5-10° slope and a 0.3-0.5 mm wide support structure to enhance the pressure-bearing capacity of the microchannels and facilitate demolding. The upper plastic layer includes fixing holes, vent holes, a sample loading chamber, a quantitative chamber, an elution chamber, a sample loading channel, capillaries, and a detection chamber.

[0081] The silicone inner membrane is a 0.1mm thick circular silicone sheet, made of soft silicone material. It can fill tiny irregular surfaces under pressure, providing better elasticity and sealing, and reducing liquid leakage. Under normal use and storage conditions, the silicone inner membrane has an extremely long service life and exhibits excellent aging resistance, heat resistance, and chemical resistance, making it suitable for various applications.

[0082] The lower plastic layer is a plastic disc with fixing holes, 0.1-0.2 mm thick. It is injection molded using a mixture of polymethyl methacrylate (PMMA), polycarbonate (PC), and dioctyl sebacate (DOS) (10:10:1) as the base material. This process results in a plastic disc that, despite its extreme thinness, maintains good rigidity, supporting and protecting the microchannel structure of the upper plastic layer while preventing scratches and damage to the soft silicone inner membrane. The disc exhibits strong impact resistance and light transmittance, maintaining excellent transmittance even under accelerated aging conditions, without affecting subsequent fluorescence detection in the reaction chamber.

[0083] In some methods, the microchannels of the upper plastic layer are hexahedral, with the upper plastic layer providing five sides and the silicone and lower plastic layers providing the bottom surface, thus completing the seal. It is evident that the microchannels of the upper plastic layer are open and require sealing from below. Existing methods directly assemble the lower and upper plastic layers, essentially a rigid-rigid structure directly glued or bonded together. This process is complex, prone to adhesive entering the microchannels, and affects sterilization. Furthermore, performing these traditional assemblies after sterilization easily leads to recontamination; once assembled, the sterilizing gas or liquid in the channels either has difficulty entering or exiting. To achieve rapid assembly, this invention creatively employs a rigid-soft-rigid structure for direct sealing via clamping, resulting in a better seal and preventing recontamination after sterilization.

[0084] Furthermore, it also includes a first snap fastener, a second snap fastener, a third snap fastener, and a fourth snap fastener; the first snap fastener and the second snap fastener are assembled into one piece for fixing and sealing the outer periphery of the centrifugal microfluidic chip; the third snap fastener and the fourth snap fastener are assembled into one piece for fixing and sealing the inner periphery of the centrifugal microfluidic chip, wherein the inner periphery is the arc-shaped hole where the rotation center of the centrifugal microfluidic chip is located.

[0085] The first, second, third, and fourth clips are two sets of semi-circular acrylic clips of different sizes. The side is designed with a groove structure with a height of 0.8mm. The total thickness of the chip is 1mm. Acrylic has good toughness and elasticity and is not easy to break or crack. The 0.2mm height difference is used to make the clips elastically compress the three-layer structure of plastic-silicone-plastic to achieve the sealing of the chip.

[0086] The first buckle is an acrylic semi-circular arc with a groove on the side, with an arc width of 2mm, which can fit against the outside of the chip. The upper and lower ends have female grooves for assembling with the second buckle.

[0087] The second buckle is an acrylic semi-circular arc with a groove on the side, the same size as the first buckle, and has male grooves at the top and bottom for assembly with the first buckle.

[0088] The third buckle is an acrylic semi-circular arc with a groove on the side, with an arc width of 2mm, which can fit with the fixing hole of the chip. It has female grooves at the top and bottom for assembly with the fourth buckle.

[0089] The fourth buckle is an acrylic semi-circular arc with a groove on the side, the same size as the third buckle, and has male grooves at the top and bottom for assembly with the third buckle.

[0090] Common assembly methods for microfluidic chips include bonding and adhesive bonding. Bonding methods suffer from drawbacks such as low alignment accuracy, high scrap rate, and high cost. Furthermore, they require prolonged settling after fabrication to maintain bond strength. Additionally, bonding technology demands suitable materials, significantly limiting the flexibility of practical chip applications. Adhesive bonding methods face challenges such as adhesive clogging of microchannels and reduced chip transmittance. The biocompatibility of the adhesive with the test samples must also be considered.

[0091] This patent employs a quick-assembly snap-fit ​​method for assembly, which is simple, convenient, and low-cost, significantly improving production efficiency. External assembly completely avoids contact with samples and biological reagents, eliminating the adverse effects of potential biochemical reactions. Furthermore, the snap-fit ​​installation does not alter the chip's shape or transparency, requiring no additional polishing, making it widely applicable to microfluidic chips based on various detection principles.

[0092] Furthermore, the detection reagent is a solid lyophilized reagent containing a lyophilization protectant, which includes trehalose and mannitol.

[0093] The freeze-drying system provides amplification raw materials, specific primers, and fluorescent probes for nucleic acid detection. The reaction system is pre-freezed and embedded in the detection cavity.

[0094] The nucleic acid detection lyophilization system comprises core reagents, lyophilization protectants, and a buffer system. The core reagents include the aforementioned primer pairs for different rapeseed transgenic lines, TaqMan fluorescent probes, Taq DNA polymerase, and dNTPs. Primer pairs are crucial for achieving specific amplification of nucleic acid fragments from specific rapeseed lines; their sequences are designed based on the unique gene loci of different rapeseed lines. The TaqMan fluorescent probes are complementary to the target gene fragment. During PCR amplification, when the primers extend to the probe binding site, the 5'-3' exonuclease activity of Taq DNA polymerase cleaves the reporter fluorescent group FAM at the 5' end of the probe, separating it from the quencher fluorescent group TAMRA at the 3' end, thereby generating a fluorescent signal for real-time monitoring of the PCR reaction progress. dNTPs provide the raw materials required for DNA synthesis in the PCR reaction, ensuring the smooth progress of the amplification reaction. Trehalose and mannitol are selected as lyophilization protectants. Trehalose, a non-reducing disaccharide with a good glass transition temperature, forms a stable glassy structure during freeze-drying, encapsulating and protecting the bioactive components in nucleic acid detection reagents. This prevents structural damage and loss of activity due to ice crystal formation and moisture loss during freeze-drying. Mannitol regulates the osmotic pressure of the freeze-drying system, maintaining reagent stability and improving reconstitution after freeze-drying. For Taq DNA polymerase, adding 3% (w / v) trehalose and 2% (w / v) mannitol effectively maintains its activity before and after freeze-drying. Tris-HCl buffer (pH 8.0) is used as the buffer component in the nucleic acid detection freeze-drying system. Tris-HCl buffer has good buffering capacity, maintaining a stable pH during PCR reactions and ensuring the activity of enzymes such as Taq DNA polymerase. Furthermore, its chemical stability and good compatibility with other components in the nucleic acid detection reagents prevent interference with the specific binding of primers and probes and the PCR amplification reaction.

[0095] First, prepare 10 μM stock solutions of the forward and reverse primers, and 5 μM stock solution of the TaqMan fluorescent probe. Dilute the Taq DNA polymerase according to its activity units, and mix the dNTPs at a concentration of 2.5 mM each. Then add 5 μM 3% (w / v) trehalose and 5 μM 2% (w / v) mannitol solution to the reagents. Place the prepared reagents into separate micro-reservoir containers, ensuring that each container contains a complete nucleic acid detection lyophilization system for subsequent freeze-drying and pre-embedding operations. Place the micro-reservoir containers containing the reagents in a freezer pre-cooled to -80°C for 2-3 hours to completely freeze the reagents. During this process, the water in the solution rapidly forms ice crystals, and the bioactive components in the reagents are immobilized within the lattice structure of the ice crystals, reducing interactions and degradation caused by molecular motion.

[0096] The frozen reagent was transferred to a freeze dryer and subjected to sublimation drying under a vacuum of 10 Pa and a temperature of -50°C for 12-16 hours. During the sublimation drying stage, ice crystals directly sublimate from the solid to the gaseous state, thereby removing a large amount of free water from the reagent. Due to the vacuum environment and low temperature conditions, the bioactive components in the reagent remain relatively stable, avoiding the influence of high temperature and moisture on their activity. After sublimation drying, desorption drying was performed by slowly raising the temperature to 20°C and maintaining it for 2-4 hours. The desorption drying process mainly removes residual bound water from the reagent, bringing it to a dry and stable state, facilitating long-term storage and subsequent pre-embedding operations.

[0097] Using microdroplet jetting technology, the lyophilized nucleic acid detection reagents are transferred to the corresponding storage containers. The lyophilized primer pairs, TaqMan fluorescent probes, Taq DNA polymerase, dNTPs, and the system containing lyophilization protectant and buffer are sequentially transferred into the detection chamber according to the required amounts for each PCR reaction system.

[0098] Furthermore, the method for fabricating the capillary channels of the microfluidic chip includes the following steps:

[0099] (1) Cover the plastic layer of the centrifugal microfluidic chip with a silicone mold containing capillary channels, so that the capillary channels on the silicone mold are positioned in the area connecting the fluid channel and the detection channel.

[0100] (2) Injecting an etching solution into the mold, the etching solution comprising dimethylformamide, acetone and tetrahydrofuran;

[0101] (3) Remove the silicone mold to form capillary channels on the upper layer of plastic.

[0102] This invention enables the successful fabrication of microchannels on plastics by dripping an etchant into a mold. This method has low requirements for processing precision and can complete the fabrication of the channels in a very short time.

[0103] In some methods, the corrosive solution contains: dimethylformamide (DMF): acetone: tetrahydrofuran = 5:4:1.

[0104] On the other hand, the present invention provides a method for preparing microchannels on plastic, the method comprising the following steps:

[0105] (1) Cover the silicone mold with microchannels onto plastic;

[0106] (2) Injecting an etching solution into the mold, the etching solution comprising dimethylformamide, acetone and tetrahydrofuran.

[0107] Fabricating tiny microchannel structures on materials such as plastics and glass presents significant technical challenges. Traditional methods rely on microfabrication techniques like photolithography and etching to create these structures on silicone, which are then bonded to the plastics or glass via oxygen plasma bonding or adhesive bonding. However, the SU-8 adhesive used in photolithography is sensitive to thermal expansion and difficult to separate from the substrate, requiring an anti-adhesion layer. Furthermore, fabricating the SU-8 mold involves multiple precision steps that must be strictly followed, demanding high processing standards, diverse environmental conditions, and complex techniques, resulting in a lengthy process. Moreover, the SU-8 mold continuously detaches during silicone fabrication, limiting its lifespan. Oxygen plasma bonding, on the other hand, requires high processing precision and must consider the impact of the process on biochemical reactions within the channels, thus its reliability and stability need improvement.

[0108] In another aspect, the present invention provides a method for fabricating capillary channels on a centrifugal microfluidic chip, the method comprising the following steps:

[0109] (1) Cover the plastic layer of the centrifugal microfluidic chip with a silicone mold containing capillary channels, so that the capillary channels on the mold are positioned in the area connecting the fluid channel and the detection channel;

[0110] (2) Injecting an etching solution into the mold, the etching solution comprising dimethylformamide, acetone and tetrahydrofuran;

[0111] (3) Remove the silicone mold to form capillary channels on the upper layer of plastic.

[0112] The fabrication of sandwich-structured microfluidic chips requires certain technical expertise. This invention employs the aforementioned method for preparing microchannels on plastic, specifically creating capillary channels on the upper layer of the plastic. The method involves covering an unprocessed area of ​​the upper plastic layer with a silicone mold containing capillaries. The capillaries on the mold are positioned to connect the sample application channel and the detection area. 12 μL of a mixed etching solution is injected into the mold and left for 15 seconds. The etching solution is then aspirated and recovered using a needle. The silicone mold is removed, revealing capillaries with a width of 0.3 mm and a depth of 0.5 mm formed on the plastic disc.

[0113] The silicone mold is a capillary silicone mold with a width of 0.3 mm, fabricated using photolithography. The advantage of this processing method is that it avoids the need to use methods such as photolithography to obtain capillaries smaller than 1 mm in size, thus controlling processing costs and ensuring the repeatability of processing results.

[0114] In some embodiments, the corrosive liquid consists of: dimethylformamide (DMF), acetone, and tetrahydrofuran (5:4:1).

[0115] Furthermore, the present invention provides a nucleic acid detection method, wherein the method uses a microfluidic chip as described above for detection, and the detection method includes the following steps:

[0116] (1) Secure the microfluidic chip to the rotating shaft of the detection device;

[0117] (2) Add the sample containing the solid carrier to the microfluidic chip from the sample application area, centrifuge, so that the sample containing the solid carrier enters the elution chamber of the chip.

[0118] (3) Add the eluent to the microfluidic chip from the sample loading area, centrifuge, and stop centrifugation when liquid appears in the waste liquid pool of the microfluidic chip, indicating that the eluent has entered the quantitative chamber;

[0119] (4) Centrifuge again, and the elution buffer enters the elution chamber and mixes with the test sample containing the solid carrier to complete the elution of nucleic acid;

[0120] (5) Stop centrifugation, and the liquid containing nucleic acid enters the detection chamber through the capillary tube for nucleic acid amplification;

[0121] (6) Read the detection results.

[0122] In some methods, in step (5), the nucleic acid amplification is isothermal amplification, which requires heating equipment to provide the reaction chamber with the appropriate temperature required for isothermal amplification (e.g., 30-65°C).

[0123] Furthermore, the elution buffer comprises Tris-HCl buffer and PBS.

[0124] In some methods, the elution buffer is 200 μL 10 mM Tris-HCl buffer (pH 7.5) + 30 μL 0.02 M PBS.

[0125] The microfluidic chip provided by this invention is based on automated elution technology, integrating the extraction of solid-phase carriers (such as biochar) into a single chip. This eliminates the need for additional liquid transfer steps, reducing the risk of aerosol contamination and human error, and constructing a rapid and convenient highly integrated detection platform. Furthermore, the chip has four independent regions, enabling simultaneous detection of 4*7 target nucleic acid molecules, reducing sample and reagent usage and saving detection costs.

[0126] Furthermore, this invention provides a method for detecting genetically modified rapeseed, wherein the method employs the detection system described above and includes the following steps:

[0127] (1) Add the extract to the sample and mix to obtain the sample extract solution (containing biochar);

[0128] (2) Add the sample extraction solution to the microfluidic chip and centrifuge to allow the sample containing the solid carrier to enter the elution chamber of the chip.

[0129] (3) Add the eluent from the sample loading area to the centrifugal microfluidic chip, centrifuge, and stop centrifugation when liquid appears in the waste liquid pool of the centrifugal microfluidic chip, indicating that the eluent has entered the quantitative chamber;

[0130] (4) Centrifuge again, and the elution buffer enters the elution chamber and mixes with the test sample containing the solid carrier to complete the elution of nucleic acid;

[0131] (5) Stop centrifugation, and the liquid containing nucleic acid enters the detection chamber through the capillary tube for nucleic acid amplification;

[0132] (6) Read the detection results.

[0133] In some embodiments, the sample used in this invention is rapeseed oil, prepared by direct sampling or by physical pressing followed by direct sampling without filtration. Rapeseed oil is chosen as the sample for detecting genetically modified rapeseed because it is a common target of market regulation, and imported rapeseed is generally easy to detect genetically modified organisms. However, nucleic acid extraction from rapeseed oil is difficult and the content is low; therefore, this invention is needed to improve detection efficiency. Furthermore, this invention is applicable to crudely pressed rapeseed oil samples and can separate the oil sample from adulterated rapeseed residue during centrifugation without additional filtration steps, thus simplifying pretreatment.

[0134] This invention establishes a method for rapidly extracting genes from refined oil products, performed within a microfluidic chip. This reduces pretreatment time, improves efficiency, and integrates multiple experimental steps onto a miniaturized platform, significantly shortening the overall detection process time. From sample preparation to result output, the entire process can be completed within minutes to tens of minutes. This invention, based on microfluidic chip detection, reduces reagent consumption and manual operation, lowers experimental costs, reduces the possibility of contamination, and ensures the purity and accuracy of the experiment.

[0135] The system for detecting genetically modified rapeseed based on a microfluidic chip provided by this invention has the following beneficial effects:

[0136] 1. Primer and probe sets capable of simultaneously detecting six types of genetically modified rapeseed were screened, and a high-throughput system for detecting genetically modified rapeseed was constructed to achieve efficient and accurate detection of different types of genetically modified rapeseed.

[0137] 2. Suitable carbon sources were screened to prepare biochar, which effectively improved the extraction efficiency of nucleic acids to be tested in rapeseed;

[0138] 3. The detection system for genetically modified rapeseed was optimized, and the optimal formulation and preparation process of the extraction solution, eluent, and freeze-dried detection reagent were screened, effectively improving the sensitivity and specificity of six types of genetically modified detection.

[0139] 4. The structure of the microfluidic chip has been improved. By setting separate quantitative and elution chambers, not only can quantitative elution be achieved, but also more thorough mixing and elution can be made, improving elution efficiency and thus enhancing detection sensitivity. Through the design of various chamber shapes and structures in the chip, solid carriers such as biochar can be successfully eluted, and the eluted sample can smoothly enter the detection area for detection, while the biochar is blocked in the elution chamber, so as not to block or affect the detection of the sample. By improving the structure of the fluid channels in the microfluidic chip, a barrier block is set to effectively block the biochar and prevent blockage of capillary channels. The step above the barrier block forms a U-shaped liquid surface near the outlet, similar to the residual liquid surface, which raises the liquid surface at this point and helps the sample penetrate into the capillary channel under the action of surface tension.

[0140] 5. By combining etchant and mask, 0.3mm-level flow channels can be etched on plastic disks, effectively reducing processing costs and difficulty, and enabling microchannel fabrication to be completed in a very short time; the chip can be quickly assembled by snap-fit, which is simple, easy to assemble, and low in cost, significantly improving production efficiency, completely avoiding contact with samples and biological reagents, eliminating the adverse effects of potential biochemical reactions, and the snap-fit ​​does not change the shape and transparency of the chip, requiring no additional polishing, and can be widely applied to microfluidic chips of various detection principles;

[0141] 6. Based on the microfluidic chip-based automated elution technology, biochar extraction is integrated into a single chip, eliminating the need for additional liquid transfer steps, reducing the risk of aerosol contamination and human error, and constructing a fast and convenient highly integrated detection platform; at the same time, the chip has four independent regions, which can simultaneously detect 4*7 target nucleic acid molecules, reducing the amount of samples and reagents used and saving detection costs. Attached Figure Description

[0142] Figure 1 This is a schematic diagram of the flow channel structure of the microfluidic chip in Example 2;

[0143] Figure 2 This is a schematic diagram of the quantitative chamber, elution chamber, and fluid channel in Example 2;

[0144] Figure 3 This is an exploded view of the microfluidic chip in Example 2;

[0145] Figure 4 This is a flowchart illustrating the process of fabricating capillary channels on a plastic upper layer using a combination of etchant and mask, as described in Example 3.

[0146] Figure 5 This is a schematic diagram of the liquid flow direction in the microfluidic chip in Example 4. Detailed Implementation

[0147] The preferred embodiments of the present invention will be described in further detail below with reference to the accompanying drawings. It should be noted that the following embodiments are intended to facilitate understanding of the present invention and are not intended to limit it in any way. The raw materials and equipment used in the specific embodiments of the present invention are all known products and were obtained by purchasing commercially available products.

[0148] In the description of this invention, it should be understood that the terms "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first," "second," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Thus, a feature defined with "first," "second," etc., may explicitly or implicitly include one or more of that feature. In the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0149] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "connected" and "linked" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art will understand the specific meaning of the above terms in this invention based on the specific circumstances.

[0150] Example 1: Preparation of Biochar

[0151] In this embodiment, the biochar is prepared using rice straw and chicken manure as carbon sources. The preparation process is as follows: rice straw and chicken manure are mixed in a weight ratio of 1:2 to 1:3 (preferably 1:3 in this embodiment), washed with tap water, and dried in a forced-air drying oven at 60°C. Then, the rice straw is cut into 2-3 cm lengths, and the chicken manure and rice straw are placed in an anaerobic tube furnace for high-temperature pyrolysis under a high-purity N2 atmosphere. The temperature is increased to 700°C at a heating rate of 5°C / min, and the carbonization time is 2 hours. After pyrolysis and cooling, the mixture is taken out, ground, and passed through a 100-mesh sieve.

[0152] Example 2: The microfluidic chip provided by the present invention

[0153] The structure of the microfluidic chip provided in this embodiment is as follows: Figures 1 to 3 As shown, where Figure 1 This is a schematic diagram of the flow channel structure of a microfluidic chip. Figure 2 A schematic diagram of the quantitative chamber, elution chamber, and fluid channel; Figure 3 This is an exploded view of a microfluidic chip.

[0154] like Figure 1 The microfluidic chip 1 (hereinafter referred to as chip 1) provided in this embodiment includes a detection unit 2, which has a quantitative chamber 3, an elution chamber 4, and a detection area 5. The elution chamber 4 is used to elute the analyte from the solid support. The quantitative chamber 3 is used to temporarily store the added liquid and quantify the added liquid. The quantitative chamber 3 and the elution chamber 4 are connected by a fluid channel 6. The detection area 5 is used to detect the content of the analyte and is connected to the fluid channel 6 through a capillary channel 7. Chip 1 also includes a rotation center 8, which is used to connect to a centrifugation drive device to drive chip 1 to centrifuge. Preferably, chip 1 can have multiple sets of detection units 2, each set of detection units 2 having a quantitative chamber 3, an elution chamber 4, and a detection area 5, which can be used for the simultaneous detection of multiple different target analytes, such as the detection of multiple different nucleic acid targets, and is also suitable for the detection of nucleic acid targets eluted from multiple different solid supports. In this embodiment, the chip 1 is provided with 4 sets of detection units 2, which are evenly arranged around the rotation center 8. Each detection unit 2 can be used for the detection of one type of sample, thereby increasing the detection throughput of the chip 1. The quantitative chamber 3 and the elution chamber 4 are connected by a fluid channel 6, which is the channel connecting the outlet (first outlet 9) of the quantitative chamber 3 and the inlet (second inlet 10) of the elution chamber 4.

[0155] Preferably, the solid-phase support includes one or more of biochar, magnetic beads, gel, resin, and cellulose; the analyte is nucleic acid. In this embodiment, the solid-phase support is the biochar provided in Example 1. Biochar has the advantages of low cost and readily available raw materials. When biochar is used as a solid-phase support for nucleic acid extraction and detection, it can significantly reduce costs compared to magnetic beads. However, biochar has a lower density and is more loose than magnetic beads, making it more difficult to separate the biochar from the eluted sample than magnetic beads. Therefore, it is necessary to design the structure of various chambers and channels in chip 1 to ensure that the biochar can be eluted smoothly, and that the eluted sample can smoothly enter the detection area 5 for detection, while the biochar is blocked in the elution chamber 4, so as not to block or affect the detection of the sample.

[0156] like Figure 1The capillary channel 7 includes a first section 11 and a second section 12. The first section 11 is a channel that bends from the outlet 13 of the fluid channel 6 towards the rotation center 8, and the second section 11 is a channel that bends from the end 14 of the first section 11 towards the detection area 5. When the chip 1 is centrifuged, the fluid sample flows outward from the center under centrifugal force. The design of the first section 11 in the capillary channel 7 ensures that if the sample wants to enter the first section 11, its flow direction is opposite to the centrifugal direction. Therefore, the sample cannot enter the capillary channel 7 during centrifugation. The first segment 11 of the capillary channel 7 acts as a threshold for sample entry into the capillary channel 11 and strengthens the protection against biochar entry. Firstly, it ensures that the sample will not enter the capillary channel during centrifugation and elution, thus preventing biochar from clogging the capillary channel 11. Secondly, during centrifugation, the supernatant sample can penetrate into the capillary channel 7 under surface tension, while the biochar, thrown to the bottom of the elution chamber 4 by centrifugal force, cannot contact or clog the capillary channel 7. The length of the capillary channel 7 can be adjusted according to the chip size specifications. In this embodiment, the total length of the capillary channel 7 is 24 mm, the width is 0.3 mm, and the depth is 0.5 mm.

[0157] like Figure 2 A barrier block 15 is provided below the fluid channel 6, at least partially blocking the lower part of the quantitative chamber 3 or the elution chamber 4. A step 16 is also provided on the fluid channel 6, located on the side of the fluid channel 6 near the outlet 13 leading to the capillary channel 7. The fluid channel 6 connects the quantitative chamber 3 and the elution chamber 4, but due to the barrier block 15, liquid flow is prevented below the fluid channel 6. Essentially, only the upper chambers of the quantitative chamber 3 and the elution chamber 4 are fluidly connected, while the lower chambers are blocked. This arrangement also helps to prevent biochar from entering or clogging the capillary channel, as biochar will generally sink below the elution chamber 4 under centrifugal force. The step 16 is located above the barrier block 15 and near the outlet 13 leading to the capillary channel 7, creating a U-shaped liquid surface near the outlet 13, similar to a residual liquid surface. This raises the liquid level at this location, helping the sample to penetrate into the capillary channel 7 under surface tension. The dimensions of the fluid channel 6 can be adjusted according to actual product needs. In this embodiment, the width of the fluid channel 6 is 1-1.25mm, and the height of the metering chamber 3 and the elution chamber 4 is 4.5-5.5mm. However, because the lower part of the fluid channel 6 is blocked by the blocking block 15, which has a height of 3-4.5mm, the height of the fluid channel 6 is reduced to 1.0-1.5mm. The step 16 has a height of 0.5-0.7mm and a width of 0.4-0.6mm.

[0158] The quantitative chamber 3 has a first inlet 17 and a first outlet 9. Near the first outlet 9, the size of the quantitative chamber 3 gradually decreases. The quantitative chamber 3 is an inverted pentagonal chamber, resembling a funnel shape. This shape design helps the biochar-containing sample to quickly gather and enter the elution chamber 4 under centrifugal force after entering, and also helps the biochar-containing sample remain stably in the elution chamber 4, preventing backflow. The quantitative chamber 3 is used to quantitatively store the added liquid, and its volume can be adjusted according to the specific application and sample volume. In this embodiment, the width of the quantitative chamber 3 is 6.25±0.5 mm, the length is 4.8±0.5 mm, and the volume is 200±30 μL.

[0159] Preferably, the metering chamber 3 is further provided with an exhaust channel 18 and a waste liquid discharge channel 19; the exhaust channel 18 extends from the metering chamber 3 toward the rotation center 8, and the exhaust port 20 of the exhaust channel 18 is connected to the outside, used to control the flow of gas in the metering chamber 3 and / or the elution chamber 4; the waste liquid discharge channel 19 extends from the metering chamber 3 away from the rotation center 8 and is connected to the waste liquid pool 21.

[0160] When liquid enters chip 1 from sample loading area 22, it enters the corresponding chamber under centrifugal force. The gas in this chamber needs to be discharged through exhaust channel 18. The quantitative chamber 3 and elution chamber 4 share an exhaust channel 18, simplifying the preparation process. The direction of exhaust channel 18 is opposite to the centrifugal direction. Therefore, when liquid enters quantitative chamber 3 or elution chamber 4 under centrifugal force, it will not be discharged from exhaust channel 18. Liquid will only enter exhaust channel 18 when both elution chamber 4 and quantitative chamber 3 are full. Exhaust channel 18 and waste liquid discharge channel 19 share an outlet 23 and a shared channel 24 on quantitative chamber 3. The shared channel 24 has branches. The first branch, opposite to the centrifugal direction, leads to exhaust port 20 (exhaust channel 18), and the second branch, in the same direction as the centrifugal direction, leads to waste liquid pool 21 (waste liquid channel 19). Therefore, liquid will selectively enter waste liquid pool 21 under centrifugal force. In actual use, chip 1 is placed inside the detection equipment. It is difficult to see whether the sample has entered the quantitative chamber 3 through the equipment. However, it is possible to see whether liquid is entering the waste liquid tank 21 through the equipment window. When liquid is seen entering the waste liquid tank 21, it indicates that the quantitative chamber 3 has been filled. It can be seen that the waste liquid tank 21 also helps to quantify the liquid in the quantitative chamber 3.

[0161] Preferably, the vent 20 is a circular through-hole structure with a diameter of 2.5 mm, used to expel gas from the chip 1, balance the internal and external air pressure, and prevent air bubbles from clogging the microchannels and affecting liquid flow. The surface of the vent 20 is pre-sealed with a transparent film for sealing. When venting is required during use, the transparent film can be punctured to release the gas; if sealing is required later, a transparent film can be added again for sealing.

[0162] The elution chamber 4 is provided with a second inlet 10. Near the second inlet 10, the size of the elution chamber 4 gradually decreases. The elution chamber 4 is a pentagonal compartment, narrowing at the second inlet 10. When the sample enters the elution chamber 4 under centrifugation, it helps to prevent the biochar from flowing out of the elution chamber 4. The elution chamber 4 is used to elute the nucleic acid to be tested from the biochar and simultaneously store the eluted liquid. The size and volume of the elution chamber 4 can be set according to specific product requirements and can be fine-tuned within a suitable range. In this embodiment, the width of the elution chamber 4 is 5.8±0.5mm, the length is 4.8±0.5mm, and the volume is 230±30μL.

[0163] Preferably, the detection zone 5 includes a detection channel 25 and a detection chamber 26 connected to the detection channel 25; the detection channel 25 is connected to the capillary channel 7. A second exhaust channel 27 is provided on the detection channel 25, extending from the detection channel 25 towards the rotation center 8. The second exhaust port 28 of the second exhaust channel 27 is connected to the outside environment and is used to control the flow of gas in the detection zone 5; the number of detection chambers 26 can be one or more. Having multiple detection chambers 26 allows for the simultaneous detection of multiple target nucleic acids, which can be configured according to product needs. In this embodiment, each detection zone 5 has seven detection chambers 26, enabling the detection of seven target nucleic acids on the same sample.

[0164] like Figure 1 The detection channel 25 is an arc-shaped channel arranged along the circumference, and the detection cavity 26 is a circular room with a diameter of 1.5-2.5 mm. This diameter can match the spot size of the fluorescence detection module in the detection device, slightly larger than the spot diameter but not exceeding the spot diameter by more than 0.8 mm. The depth is 0.2-0.5 mm. Variations in depth can control the volume of the reaction, adapting to various reaction systems and expanding the application scenarios and detection objects. The length of the detection channel 25 can be adjusted according to the product size. In this embodiment, the length of the detection channel 25 is 25 mm.

[0165] The fluorescence detection process of chip 1 involves slow rotation during centrifugation, causing each detection cavity 26 to sequentially align with the fluorescence detection channel to complete the fluorescence detection. To ensure a one-to-one correspondence between each detection result and each detection cavity 26, the angle of each detection cavity 26's position needs to be determined before detection. In this embodiment, a line is established from the rotation center to the center of each detection cavity 26, with an angle of 7 degrees between the lines connecting two adjacent detection cavities 26. This angle is an integer multiple of the rotation degree of a single stepper motor cycle in the centrifuge device (0.7 degrees). Furthermore, this angle avoids fluorescence interference between adjacent detection cavities 26, facilitating the calculation of the position of each detection cavity 26 and recording the readings, thus improving the positioning accuracy during centrifugation and detection.

[0166] The detection chamber 26 must be pre-filled with nucleic acid amplification reagents and / or nucleic acid detection reagents. Amplification reactions include, but are not limited to, EPA, RPA, LAMP, NEAR, NASBA, HAD, TMA, SAT, RCR, etc. Solid dried reagents may be in various forms, including but not limited to lyophilized, oven-dried, or air-dried spherical, powdered, tablet, or block formulations. Nucleic acid detection includes, but is not limited to, various detection systems established using ERA, RPA, LAMP, NEAR, NASBA, HAD, TMA, SAT, PCR, hybridization probe technology, CRISPR, Ago, RNase H, etc. Detection reagents are solid detection reagents, including but not limited to lyophilized, oven-dried, or air-dried spherical, powdered, tablet, or block formulations.

[0167] like Figure 1 The detection unit 2 of chip 1 also includes a sample loading area 22, which is connected to the quantitative chamber 3 via a sample loading channel 30. The sample loading area 22, the quantitative chamber 3, and the elution chamber 4 are arranged sequentially along the rotational centrifugation direction of chip 1. Preferably, the sample loading area 22 is an elliptical chamber with a major axis of 12±0.5 mm and a minor axis of 7.5±0.5 mm. It has a 2 mm diameter loading hole 29 at the top for adding sample solution and eluent, and a 2 mm diameter vent hole for venting air from the chamber during liquid addition to balance the air pressure. Compared to a circular shape, the elliptical structure can utilize the area near the center of chip 1 as much as possible, maximizing the sample loading volume for the same disk diameter and effectively improving the space utilization of chip 1. Preferably, the surface of the sample loading area 22 of chip 1 is covered with a transparent film for sealing. During sample loading, the transparent film is punctured with a syringe. After the sample fills the main channel, the surface of the loading hole 29 can be sealed again with a transparent film.

[0168] The rotation center 8 is a fixing hole 32, which allows the chip 1 to be secured on the rotating shaft of the centrifugal drive device, thereby enabling centrifugal rotation. Preferably, the fixing hole 32 is approximately elliptical, with a major axis of 13mm and a minor axis of 8mm, which can be combined with the drive component of the centrifugal drive device to fix the chip and provide centrifugal power.

[0169] like Figure 3 Chip 1 has a sandwich structure, comprising a plastic upper layer 33, a silicone inner film 34, and a plastic lower layer 35. Detection unit 2 is located on the plastic upper layer 33. The plastic upper layer 33 is an injection-molded polydimethylsiloxane (PDMS) disk with a thickness of 1.8-2 mm and a diameter of 75 mm. It has a downward-protruding microchannel structure, where the capillary channel 7 of the plastic upper layer 33 has a width of 0.3 mm, and the width of the remaining microchannels is 0.8-1 mm. The two outer sides of the channels have a slope of 5-10 degrees and a support structure with a width of 0.3-0.5 mm to improve the pressure-bearing capacity of the microchannels and facilitate demolding. The plastic upper layer 33 is provided with a first fixing hole 132, an vent hole 20, a sample feeding area 22, a quantitative chamber 3, an elution chamber 4, a fluid channel 6, a capillary channel 7, and a detection chamber 26. The inner silicone membrane 34 is a 0.1mm thick circular silicone sheet, made of soft silicone material. It can fill tiny irregular surfaces under pressure, providing better elasticity and sealing, and reducing liquid leakage. The inner silicone membrane 34 has a second fixing hole 232. Under normal use and storage conditions, the inner silicone membrane 34 has an extremely long service life, exhibiting excellent aging resistance, heat resistance, and chemical resistance, making it suitable for various applications. The lower plastic layer 35 is a 0.1-0.2mm thick plastic disc with fixing holes and a third fixing hole 332. It is injection molded using a mixture of polymethyl methacrylate (PMMA), polycarbonate (PC), and dioctyl sebacate (DOS) (10:10:1) as the base material. The resulting plastic disc, despite its extremely thinness, maintains good rigidity, supporting and protecting the microchannel structure of the upper plastic layer 33, while preventing scratches and damage to the soft silicone inner membrane 34. The disk has strong impact resistance and light transmittance. Even under accelerated aging conditions, it can maintain excellent light transmittance and does not affect the subsequent fluorescence detection in the reaction chamber.

[0170] like Figure 3 The chip 1 also includes quick-assembly buckles 36, which are divided into a first buckle 37, a second buckle 38, a third buckle 39 and a fourth buckle 40; the first buckle 37 and the second buckle 38 are assembled into one piece to fix and seal the outer periphery 41 of the chip 1; the third buckle 39 and the fourth buckle 40 are assembled into one piece to fix and seal the inner periphery 42 of the chip 1, and the inner periphery 42 is the arc-shaped hole where the fixing hole 32 of the chip 1 (including the first fixing hole 132, the second fixing hole 232 and the third fixing hole 332 combined together) is located.

[0171] The first clip 37, the second clip 38, the third clip 39, and the fourth clip 40 are two sets of semi-circular acrylic clips of different sizes. The sides feature a 0.8mm high groove 43 structure. The total thickness of chip 1 is 1mm. Acrylic has good toughness and elasticity, making it difficult to break or crack. A 0.2mm height difference allows the clips to elastically compress the three-layer structure of plastic-silicone-plastic, achieving a seal for chip 1. Figure 3 The first clip 37 is an acrylic semi-circular arc with a groove 43 on one side, 2mm wide, which can fit against the outer periphery 41 of the chip 1. It has female grooves 44 at both ends for assembly with the second clip 38. The second clip 38 is an acrylic semi-circular arc with a groove 43 on one side, the same size as the first clip 37, and has male grooves 45 at both ends for assembly with the first clip 37. The third clip 39 is an acrylic semi-circular arc with a groove 43 on one side, 2mm wide, which can fit against the fixing hole 32 of the chip 1. It has female grooves 44 at both ends for assembly with the fourth clip 40. The fourth clip 40 is an acrylic semi-circular arc with a groove 43 on one side, the same size as the third clip 39, and has male grooves 45 at both ends for assembly with the third clip 39.

[0172] Example 3: Fabrication of Microfluidic Chips

[0173] The fabrication method of the microfluidic chip 1 provided in this embodiment specifically includes the following steps:

[0174] 1. The plastic upper layer 33 is prepared by injection molding.

[0175] 2. Capillary channels 7 were fabricated on the upper plastic layer 33 using a combination of etching solution and masking. The fabrication process is described in [link to fabrication process]. Figure 4 :

[0176] (1) Cover the unprocessed area of ​​the upper plastic layer 33 of the chip 1 with a silicone mold 45 with a hollow capillary 46, so that the hollow capillary 46 on the silicone mold 45 is positioned in the area connecting the fluid channel 6 and the detection channel 25.

[0177] The silicone mold 45 is made using photolithography and has a 0.3mm wide perforated capillary tube 46. The shape of the perforated capillary tube 46 is consistent with the shape of the capillary channel 7 in the microfluidic chip 1. The total length is 24mm, the width is 0.3mm, and the depth is 0.5mm.

[0178] (2) Inject 12μL of etching solution 47 into the hollow capillary 46 of the silicone mold 45. After 15s, use a needle to draw up and recover the etching solution 47.

[0179] Corrosion solution 47: Prepared with pure water into a solution containing 5% dimethylformamide, 4% acetone and 1% tetrahydrofuran by mass concentration.

[0180] (3) Remove the silicone mold and form a capillary channel 7 with a width of 0.3 mm and a depth of 0.5 mm on the upper plastic layer 33.

[0181] 3. Assemble the chip in the order of "plastic upper layer 33-silicone inner film 34-plastic lower layer 35". After alignment, use the first clip 37 and the second clip 38 to press the outside of the chip, and use the third clip 39 and the fourth clip 40 to press the inside of the chip to complete the chip encapsulation.

[0182] Example 4: Detection methods for six types of genetically modified rapeseed

[0183] Sample detection was performed using the microfluidic chip 1 provided in Example 2. The specific detection method is as follows (the flow direction of the sample in chip 1 is as follows). Figure 5 As shown, the black arrows indicate the direction of liquid flow:

[0184] 1. Before chip packaging, the lyophilized system for nucleic acid amplification is embedded in the detection chamber 26. The chip is assembled in the order of "plastic upper layer 33 - silicone inner membrane 34 - plastic lower layer 35". After alignment, the outer side of the chip is pressed with the first clip 37 and the second clip 38, and the inner side of the chip is pressed with the third clip 39 and the fourth clip 40 to complete the chip packaging. After recording the relevant information of the microfluidic chip 1 with a scanner, the microfluidic chip 1 is smoothly loaded into the centrifuge through the fixing hole 32.

[0185] The preparation process of the freeze-drying system is as follows:

[0186] (1) First, prepare the core reagents using Tris-HCl buffer: including 0.5-1.25 μL (preferably 1 μL in this embodiment) of upstream primer, 0.5-1.25 μL (preferably 1 μL in this embodiment) of downstream primer, 0.25-0.5 μL (preferably 0.3 μL in this embodiment) of TaqMan fluorescent probe, 0.25-0.5 μL (preferably 0.3 μL in this embodiment) of Taq DNA polymerase, 1.0-2.0 μL (preferably 1.5 μL in this embodiment) of dNTPs, 1-2 μL (preferably 1.5 μL in this embodiment) of RPA enzyme, and add 12.5 μL of Tris-HCl buffer (pH 8.0).

[0187] Each detection chamber includes one of six transgenic primer-probe sets: upstream primer (Seq ID NO.1), downstream primer (Seq ID NO.2), and probe (Seq ID NO.3) for detecting the CaMV-35S promoter; upstream primer (Seq ID NO.4), downstream primer (Seq ID NO.5), and probe (Seq ID NO.6) for detecting PEP; upstream primer (Seq ID NO.7), downstream primer (Seq ID NO.8), and probe (Seq ID NO.9) for detecting the CaMV-35S terminator; upstream primer (Seq ID NO.10), downstream primer (Seq ID NO.11), and probe (Seq ID NO.12) for detecting the NOS terminator; upstream primer (Seq ID NO.13), downstream primer (Seq ID NO.14), and probe (Seq ID NO.15) for detecting Actin; and upstream primer (Seq ID NO.14), downstream primer (Seq ID NO.15), and probe (Seq ID NO.15) for detecting MS1. NO.16), downstream primer (Seq ID NO.17), and probe (Seq ID NO.18).

[0188] (2) 3% (w / v) trehalose and 2% (w / v) mannitol (lyophilization protectant) in the core reagent.

[0189] The prepared reagents were placed into separate micro-reservoir containers, ensuring that each container contained a complete nucleic acid detection lyophilization system for subsequent freeze-drying and pre-embedding operations. The micro-reservoir containers containing the reagents were then placed in a freezer pre-cooled to -80°C and frozen for 2-3 hours until the reagents were completely frozen. During this process, the water in the solution rapidly formed ice crystals, and the bioactive components of the reagents were immobilized within the lattice structure of the ice crystals, reducing interactions and degradation caused by molecular motion.

[0190] The frozen reagent was transferred to a freeze dryer and subjected to sublimation drying under a vacuum of 10 Pa and a temperature of -50°C for 12-16 hours. During the sublimation drying stage, ice crystals directly sublimate from the solid to the gaseous state, thereby removing a large amount of free water from the reagent. Due to the vacuum environment and low temperature conditions, the bioactive components in the reagent remain relatively stable, avoiding the influence of high temperature and moisture on their activity. After sublimation drying, desorption drying was performed by slowly raising the temperature to 20°C and maintaining it for 2-4 hours. The desorption drying process mainly removes residual bound water from the reagent, bringing it to a dry and stable state, facilitating long-term storage and subsequent pre-embedding operations.

[0191] Using microdroplet jetting technology, the lyophilized nucleic acid detection reagents are transferred to the corresponding storage containers. The lyophilized primer pairs, TaqMan fluorescent probes, Taq DNA polymerase, dNTPs, and the system containing lyophilization protectant and buffer are sequentially transferred into the detection chamber according to the required amounts for each nucleic acid amplification reaction system.

[0192] 2. Using a micropipette, add 200 μL of rapeseed oil sample (a physically pressed sample containing rapeseed residue, unfiltered) to the sample application area 22 of microfluidic chip 1 via syringe. The sample volume should occupy 1 / 3 to 1 / 2 of the quantitative chamber 3. This ensures the most uniform mixing between the sample and subsequently added reagents, and also ensures that only the DNA-containing supernatant enters the detection module during subsequent operations. Then add 50 μL of Tris-saturated phenol (pH 8.0) containing 0.5% Triton X-100 to the sample application chamber and mix with the rapeseed oil sample. Incubate at room temperature for 3 minutes to accelerate protein denaturation and promote DNA release. Triton X-100 facilitates rapid mixing. Next, add 50 μL of chloroform:isoamyl alcohol (24:1) mixture, 1.2 μL of ethidium bromide (0.5%), 6 μL of phenol, 1 μL of guanidine isothiocyanate, 1 μL of β-mercaptoethanol and 10 μg of biochar (prepared in Example 1), and mix thoroughly again; start the centrifugation program, and centrifuge at two speeds of 8000 r / min and 12000 r / min alternately for 5 min, and the sample to be tested enters the elution chamber 4 of the chip.

[0193] 3. Use a syringe to inject 230 μL of elution buffer (200 μL 10 mM Tris-HCl buffer (pH 7.5) + 30 μL 0.02 M PBS) into sample well 31, start the centrifugation program (1200 r / min, 30 s), and stop centrifugation when liquid appears in waste liquid pool 21, indicating that the elution buffer has filled quantitative chamber 3.

[0194] 4. Start the centrifugation program (1200r / min, 2min). The eluent enters the elution chamber 4 and mixes with the sample to be tested, eluting the lysis products bound on the solid support, including proteins, nucleic acids, and bacterial fragments. Among them, nucleic acid molecules are the lightest and float in the supernatant, thus completing the elution of nucleic acids.

[0195] 5. Stop centrifugation. Samples containing nucleic acid enter detection zone 5 through capillary channel 7, while other waste liquids such as biochar are blocked in elution chamber 4. Restart the centrifugation program (1200 r / min, 1 min). Samples are evenly distributed from detection channel 25 into each detection chamber 26 for isothermal amplification of nucleic acid. (Isothermal amplification requires the detection equipment to provide the appropriate isothermal amplification temperature for each detection chamber 26 (e.g., LAMP temperature 63-65℃ 30-60 min, RPA temperature 39-41℃ 20-30 min; in this embodiment, RPA temperature 39℃ 25 min is preferred). The equipment starts the detection centrifugation program "high speed 1200 r / min 45 s; low speed 200 r / min 15 s alternating". The detection equipment sequentially performs fluorescence detection (470 nm wavelength excitation light) on the amplification products of the samples in each detection chamber 26, obtaining a real-time fluorescence detection curve, completing the entire detection process. A clear S-shaped amplification curve within the reaction time is considered positive, and no clear amplification curve within the reaction time is considered negative.

[0196] Example 5 and 6: Screening of transgenic primers and probes

[0197] This application designed multiple sets of primers and probes for each of the six transgenic genes according to the method provided in Example 4. Two sets of primers and probes were selected for each gene, showing the optimal amplification curve, earliest peak, highest fluorescence intensity, and distinct exponential and plateau phases (see Table 1). The samples were then tested according to the method provided in Example 4. The test samples were rapeseed oil samples known to contain the six transgenic genes, and the corresponding transgenic nucleic acid content was diluted to 10... 0 10 1 10 2 10 3 The results of the copy / μl sample, after being detected by different primer and probe sets, are shown in Table 2.

[0198] Table 1. Primer-probe sets obtained after screening

[0199]

[0200] Table 2. Influence of primer and probe sets on detection results

[0201]

[0202] "+" represents positive and "-" represents negative.

[0203] As shown in Table 2, different primer-probe sets exhibit varying sensitivities for detecting the corresponding transgenes. For each of the six transgenes, the first primer-probe set demonstrated higher detection sensitivity, capable of detecting 10... 0 A copy / μl sample.

[0204] Example 6: Effects of different biochar types on the detection effect of genetically modified rapeseed

[0205] This embodiment prepared biochar according to the method provided in Example 1. The carbon sources used for biochar preparation were selected from the five groups shown in Table 3, resulting in seven groups of biochar. 10 μg of each of the seven groups of biochar was added to 200 μL of rapeseed oil sample, and the detection of six transgenic genes was performed according to the method provided in Example 4. The sample was a rapeseed oil sample known to contain transgenic genes. Since the detection results for each transgenic gene showed similar trends, the CaMV-35S promoter was used as an example in Table 3. The corresponding transgenic nucleic acid content was diluted to 10... 0 10 1 10 2 10 3 The results of different biochar samples were examined by copying / μl and compared with those of magnetic beads. The results are shown in Table 3.

[0206] Table 3. Effects of different biochar types on the detection efficiency of transgenic rapeseed

[0207]

[0208]

[0209] "+" represents positive and "-" represents negative.

[0210] As shown in Table 3, biochar prepared from different carbon sources exhibits varying nucleic acid extraction efficiencies, leading to significant differences in the detection sensitivity of transgenic rapeseed. When using appropriate carbon sources to prepare magnetic beads, the adsorption and extraction of nucleic acids is even better than that of magnetic beads. In particular, group 5, using rice straw and chicken manure as carbon sources, achieved a detection sensitivity of 10 for the CaMV-35S promoter. 0 copy / μl.

[0211] Example 7: Screening of Extract Formulation

[0212] This embodiment optimized the formulation of the extract and used the method provided in Example 4 to detect genetically modified rapeseed. The extracts used were different formulations shown in Table 4, with the proportions of each component consistent with Example 4. The samples were rapeseed oil samples known to contain genetically modified organisms (GMOs). Since the detection results for each GMO showed similar trends, Table 4 uses the CaMV-35S promoter as an example, and the corresponding GMO nucleic acid content was diluted to 10... 0 10 1 10 2 10 3 The effect of different extraction solution formulations on the detection results was investigated by measuring 1 copy / μl, and the results are shown in Table 4.

[0213] Table 4. Effects of different extract formulations on the detection efficiency of genetically modified rapeseed

[0214]

[0215] "+" represents positive and "-" represents negative.

[0216] As shown in Table 4, although all samples contained biochar, different extract formulations directly affected the detection results of the CaMV-35S promoter. Comparing Group 1 and Group 2, when the extract did not contain ethidium bromide (Group 1), all four concentrations of samples showed negative results. Adding ethidium bromide (Group 2) significantly improved the detection sensitivity, enabling the detection of 10... 3 A copy / μl sample.

[0217] As can be seen from groups 2 to 5, the simultaneous addition of phenol, guanidine isothiocyanate, and β-mercaptoethanol to the extract significantly improved the detection sensitivity, bringing the detection sensitivity of the CaMV-35S promoter to 10. 0 The reason for the high copy / μl is likely that the addition of phenol, guanidine isothiocyanate, and β-mercaptoethanol can change the surface tension, improve the compatibility of biochar with DNA extraction reagents, and facilitate the suspension and centrifugation of biochar, thereby improving the extraction effect of biochar on nucleic acids and significantly enhancing the detection sensitivity.

[0218] Example 8: Screening and Optimization of Elution Buffer Formulation

[0219] In this embodiment, biochar was prepared according to the method provided in Example 1, and the biochar was used to detect genetically modified rapeseed according to the method provided in Example 4. Elution was performed using the eluents described in Table 5, and the effect of different eluent formulations on the detection effect of genetically modified rapeseed was investigated. The detection results are shown in Table 5.

[0220] Table 5. Effects of different eluents on the nucleic acid extraction efficiency of biochar

[0221]

[0222] According to Table 5, when using the biochar prepared in Example 1 to adsorb and detect genetically modified rapeseed, the most preferred eluent is Tris-HCl buffer with a sodium ion concentration of 0.5M, a magnesium ion concentration of 0.1M, and the addition of 0.2% Tween 20, which can effectively improve the elution efficiency, thereby improving the detection sensitivity and accuracy of genetically modified rapeseed.

[0223] Example 9: Screening of Corrosive Solutions

[0224] This embodiment uses the method provided in Example 3 to prepare capillary channels on the upper layer of plastic. The etching solution used is different formulations shown in Table 6. The effects of different etching solutions on the preparation of capillary channels are compared. The method of evaluation is as follows: silicone molds with hollowed-out capillary channels with widths of 0.3, 0.8, and 1.3 μm are used respectively. Etching solution is added to each mold. It is examined whether different etching solutions can successfully prepare capillary channels of the corresponding width (without the problem of uneven width of capillary channels or excessive corrosion by the etching solution). This is taken as the accuracy of capillary channel preparation of the etching solution. Different results are shown in Table 6.

[0225] Table 6. Comparison of the effects of different corrosive solutions

[0226] Etching liquid Precision of capillary channel production 5% dimethylformamide + 4% acetone + 1% tetrahydrofuran 0.3 μm 10% acetone solution 0.8 μm Concentrated nitric acid mixed with concentrated hydrochloric acid in a 1:3 ratio 1.3 μm

[0227] As can be seen from Table 6, there are significant differences in the precision of preparing capillary channels on the upper layer of plastic using different etching solutions. The optimal etching solution formula is: 5% dimethylformamide + 4% acetone + 1% tetrahydrofuran, which provides the highest precision when used to prepare capillary channels.

[0228] While the present invention has been disclosed above, it is not limited thereto. Its application scope in the field of microfluidics can be expanded accordingly. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

[0229] sequence list

[0230]

[0231] Actin's probe:

[0232] [FAM]TGGAGGAGCAGAAGGAGGAGA[TAMRA]

[0233] Seq ID NO.16

[0234] MS1 upstream primer:

[0235] CGTGGAGGATCTTGACGTTA Seq ID NO.17

[0236] Downstream primers for MS1:

[0237] ACAGCTCCAGGACAAAGTCA Seq ID NO.18

[0238] MS1 probe:

[0239] FAM-5'CTTGCAGTGGCTGAAGG-MGBNFQ-3'

[0240] Seq ID NO.19

[0241] Upstream primers for the CaMV-35S promoter (second set):

[0242] TCTACAAATCTCATCTCTCTATAAATG Seq ID NO.20

[0243] Downstream primers for the CaMV-35S promoter (Group 2):

[0244] CCTACAAATGCCCATCATTTGCGATAAAGGAA Seq ID NO.21

[0245] CaMV-35S promoter probes (second group):

[0246] CCTCGGATTCATTGCCACGCTATCGTACAC[6-FAM-dT][THF]G[BHQ1-dT]GTGAAGATAGTAGG-C3Spacer Seq ID NO.22

[0247] PEP upstream primer (second set):

[0248] AGATACAGTCTCAGAAAAGACCAGGCAA Seq ID NO.23

[0249] PEP downstream primers (second set):

[0250] CCTACAAATGCCCATCATTTGCGATAAAGGAA Seq ID NO.24

[0251] PEP probes (second group):

[0252] TGGCTCAAGTGTCTACATTGGTCTGGCCC[6-FAM-dT][THF]G[BHQ1-dT]GAAGCTCGACATCCG-C3Spacer Seq ID NO.25

[0253] Upstream primers for the CaMV-35S terminator (Group 2):

[0254] TATTTGTAATAATACITCTATCAATAAAATT Seq ID NO.26

[0255] Downstream primers of the CaMV-35S terminator (Group 2):

[0256] TGGCCGGTCTTGCATGATTTATCATATAATT Seq ID NO.27

[0257] CaMV-35S terminator probes (second group):

[0258] AGTAGTTCGAGATAAAAGGAAATTAGGG[6-FAM-dT]TC[THF]TA[BHQ1-dT]AGGGTTTCGCTCA-C3Spacer Seq ID NO.28

[0259] Upstream primers of the NOS terminator (Group 2):

[0260] TTGCCGGTCTTGCGATGATTATCATATAATT Seq ID NO.29

[0261] Downstream primers of the NOS terminator (Group 2):

[0262] GCAATTATACATTTAATACGCGATAGAAA Seq ID NO.30

[0263] NOS terminator probes (second group):

[0264] TAATTICTGTTGAATTACGTTAAGCA[6-FAM-dT]G[THF]AA[BHQ1-dT]AATTAACATGTAATGCA-TG-C3Spacer

[0265] Seq ID NO.31

[0266] Upstream primers for Actin (Group 2):

[0267]

Claims

1. A primer and probe set for detecting transgenic nucleic acid sequences in rapeseed, characterized in that, Includes one or more primer-probe sets for the following six genes: (1) Detect the upstream primer, downstream primer and probe of the CaMV-35S promoter, wherein the upstream primer is shown in Seq ID NO.1, the downstream primer is shown in Seq ID NO.2, and the probe is shown in Seq ID NO.3; (2) Detect the upstream primer, downstream primer and probe of PEP, wherein the upstream primer is shown as Seq ID NO.4, the downstream primer is shown as Seq ID NO.5, and the probe is shown as Seq ID NO.6; (3) Detect the upstream primer, downstream primer and probe of the CaMV-35S terminator, wherein the upstream primer is shown in Seq ID NO.7, the downstream primer is shown in Seq ID NO.8, and the probe is shown in Seq ID NO.9; (4) Detect the upstream primer, downstream primer and probe of the NOS terminator, wherein the upstream primer is shown as Seq ID NO.10, the downstream primer is shown as Seq ID NO.11, and the probe is shown as Seq ID NO.12; (5) Detect the upstream primer, downstream primer and probe of Actin, wherein the upstream primer is shown in Seq ID NO.13, the downstream primer is shown in Seq ID NO.14, and the probe is shown in Seq ID NO.15; (6) Detect the upstream primer, downstream primer and probe of MS1, wherein the upstream primer is shown in Seq ID NO.16, the downstream primer is shown in Seq ID NO.17, and the probe is shown in Seq ID NO.

18.

2. A detection system for transgenic nucleic acid sequences of rapeseed, characterized in that, It includes an extraction solution, an elution solution, a detection reagent, and a microfluidic chip; the extraction solution contains a solid-phase support for adsorbing the nucleic acid to be tested from the sample; the detection reagent contains the primer and probe set as described in claim 1; The microfluidic chip includes a detection unit, which is provided with a quantitative chamber, an elution chamber and a detection area; The elution chamber is used to elute the nucleic acid to be tested from the solid support using elution buffer; The metering chamber is used to temporarily store the added liquid and to quantify the added liquid, the liquid including the eluent; The metering chamber and the elution chamber are connected by a fluid channel; The detection zone is used to detect the content of the nucleic acid to be tested, and the detection zone is connected to the fluid channel through a capillary channel.

3. The detection system as described in claim 2, characterized in that, The solid support includes one or more of biochar, magnetic beads, gel, resin, and cellulose; the microfluidic chip includes a rotation center for connection to a centrifugation drive device to drive the microfluidic chip to centrifuge; the number of detection units is one or more, arranged around the rotation center.

4. The detection system as described in claim 3, characterized in that, The solid support is biochar, which is prepared using rice straw and chicken manure as carbon sources.

5. The detection system as described in claim 2, characterized in that, The extract also contains Tris-saturated phenol, a mixture of chloroform and isoamyl alcohol, ethidium bromide, phenol, guanidine isothiocyanate, and β-mercaptoethanol.

6. The detection system as described in claim 2, characterized in that, The elution buffer consisted of Tris-HCl buffer, sodium ion concentration of 0.5 M, magnesium ion concentration of 0.1 M, and 0.2% Tween 20.

7. The detection system as described in claim 2, characterized in that, A barrier block is provided below the fluid channel to at least partially block the area below the metering chamber or elution chamber.

8. The detection system as described in claim 7, characterized in that, The fluid channel is also provided with a step, which is located on the side of the fluid channel near the outlet leading to the capillary channel; the detection area includes a detection channel and a detection chamber connected to the detection channel; the detection channel is connected to the capillary channel; the number of detection chambers is at least 6.

9. The detection system as described in claim 2, characterized in that, The method for fabricating the capillary channels of the microfluidic chip includes the following steps: (1) Cover the plastic layer of the centrifugal microfluidic chip with a silicone mold containing capillary channels, so that the capillary channels on the silicone mold are positioned in the area connecting the fluid channel and the detection channel. (2) Injecting an etching solution into the mold, the etching solution comprising dimethylformamide, acetone and tetrahydrofuran; (3) Remove the silicone mold to form capillary channels on the upper layer of plastic.

10. A method for detecting transgenic nucleic acid sequences of rapeseed, characterized in that, The detection is performed using the detection system described in any one of claims 2 to 9, comprising the following steps: (1) Add the extraction solution to the sample and mix to obtain the sample extraction solution; (2) Add the sample extraction solution to the microfluidic chip and centrifuge to allow the sample containing the solid carrier to enter the elution chamber of the chip. (3) Add the eluent from the sample loading area to the centrifugal microfluidic chip, centrifuge, and stop centrifugation when liquid appears in the waste liquid pool of the centrifugal microfluidic chip, indicating that the eluent has entered the quantitative chamber; (4) Centrifuge again, and the elution buffer enters the elution chamber and mixes with the test sample containing the solid carrier to complete the elution of nucleic acid; (5) Stop centrifugation, and the liquid containing nucleic acid enters the detection chamber through the capillary tube for nucleic acid amplification; (6) Read the detection results.

Citation Information

Patent Citations

  • Biological micro-fluidic chip and application thereof

    CN116144458A

  • Centrifugal microfluidic nucleic acid analysis chip and nucleic acid detection method

    CN117551540A