A molecular marker related to stoma width of wheat and application thereof

By developing KASP molecular markers and their primer sets related to wheat stomatal width, we have achieved efficient and accurate identification of wheat stomatal width, solving the problem of identification difficulties in existing technologies and improving breeding efficiency and the screening ability of drought-resistant wheat varieties.

CN121137239BActive Publication Date: 2026-05-19INST OF BIOTECHNOLOGY GANSU ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511479151.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-05-19
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively utilize molecular markers to accurately identify wheat stomatal width in different ecological zones, which affects the progress of drought resistance and stress tolerance breeding, and there are few reports on related molecular markers.

Method used

KASP molecular markers with nucleotide sequences as shown in SEQ ID NO.4 and their primer sets were developed. Wheat stomatal width was identified by PCR amplification and fluorescence signals. F1 and F2 primers were designed to connect fluorescent signal adapters of different colors for efficient and accurate identification of stomatal width genetic information.

Benefits of technology

It significantly improves the selection efficiency of wheat stomatal width identification, saves costs, and quickly screens out drought-resistant and stress-tolerant wheat varieties, supporting the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121137239B_ABST
    Figure CN121137239B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to wheat stomatal width and application thereof, and belongs to the field of molecular marker breeding.The application develops a KASP molecular marker closely related to the wheat stomatal width based on A / G base variation of a site at 55049899 on a 5D chromosome of the wheat, the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.4; further, a primer group for amplifying the KASP molecular marker is designed, including an upstream primer F1, F2 and a downstream primer R connected with different color fluorescent adapters.The experimental results show that the KASP molecular marker developed by the application can efficiently and accurately determine the genetic information of the stomatal width, and predict the stomatal width of the wheat under drought stress, so that the identification cost is saved, the selection efficiency is remarkably improved, the breeding process is accelerated, and technical support is provided for screening of excellent alleles and cultivation of drought-resistant and stress-tolerant wheat varieties.The application has outstanding industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding, and in particular to a molecular marker related to wheat stomatal width and its application. Background Technology

[0002] Stomata are the main channels for water and gas exchange between terrestrial plants and their external environment. Under drought conditions, the regulatory capacity of stomata directly affects the water retention capacity and photosynthetic efficiency of wheat, ultimately impacting yield and drought resistance. Fine-tuning stomatal diameter and / or stomatal density can accelerate photosynthetic rate, reduce transpiration, and improve water use efficiency. Therefore, breeding wheat varieties with superior stomatal traits is of great significance for improving wheat's drought resistance, stress tolerance, and yield stability.

[0003] The number and size of stomata are closely related to crop yield and drought resistance. Studies have shown that stomatal traits such as stomatal width and density of winter wheat in semi-arid rainfed agricultural areas vary among natural populations. Stomatal width, stomatal density, and stomatal length can serve as important indicators for identifying and screening the drought resistance and stress tolerance of winter wheat during the grain-filling stage.

[0004] Molecular marker breeding is an important breeding method for aggregating superior allelic variations and accelerating the breeding process. It primarily utilizes molecular markers closely linked to target trait genes to rapidly and accurately detect the presence of target genes in different environments, thereby achieving the goal of selecting for the target trait. Therefore, developing molecular markers closely associated with stomatal traits can provide crucial technical support for molecular breeding of climate-resistant wheat, drought resistance, and stable yield.

[0005] Currently, using molecular quantitative genetics methods, several quantitative trait loci (QTLs) controlling stomatal density and stomatal area have been identified on different chromosomes of wheat from populations with different genetic backgrounds. Only a few functional markers related to stomatal density have been reported, and these markers are influenced by environmental and genetic background factors, making them difficult to use in marker-assisted breeding for drought and stress resistance in wheat in other ecological zones. Furthermore, molecular markers related to stomatal width are rarely reported. Therefore, it is urgent to identify molecular markers closely linked to stomatal traits such as stomatal width, based on the climatic characteristics and ecological needs of the corresponding wheat-growing areas. This will contribute to the growth and sustainable production of wheat in these regions. Utilizing these markers can accelerate the screening and breeding of climate-resilient wheat varieties with excellent stomatal traits, thereby improving water use efficiency and contributing to the sustainable development of wheat production in semi-arid rainfed agricultural areas. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker related to stomatal width in wheat and its application, in order to solve the problems existing in the prior art. This invention develops a KASP molecular marker with a nucleotide sequence as shown in SEQ ID NO.4, and further designs a primer set for amplifying this KASP molecular marker. Using the KASP molecular marker developed in this invention, the genetic information of stomatal width can be determined efficiently and accurately, and the stomatal width of wheat under drought stress can be predicted. This not only saves identification costs, but also significantly improves selection efficiency, accelerates the breeding process, and provides technical support for breeding drought-resistant and stress-tolerant wheat varieties.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a KASP molecular marker related to wheat stomatal width, the nucleotide sequence of which is shown in SEQ ID NO.4, wherein R at position 101 of the sequence shown in SEQ ID NO.4 indicates polymorphism, which is either A or G;

[0009] The genotypes at position 101 of the sequence shown in SEQ ID NO.4 include AA, AG, and GG.

[0010] Furthermore, when the genotype at position 101 of the sequence shown in SEQ ID NO.4 is AA, the stomatal width of wheat is relatively narrow;

[0011] When the genotype at position 101 of the sequence shown in SEQ ID NO.4 is GG, the stomatal width of wheat is wider.

[0012] The present invention also provides a primer set for the above-mentioned KASP molecular marker, the primer set comprising nucleotide sequences as shown in SEQ ID NO.1 (F1), as shown in SEQ ID NO.2 (F2), and as shown in SEQ ID NO.3 (R);

[0013] F1 and F2 are connected by fluorescent signal connectors of different colors.

[0014] Furthermore, the fluorescent signal connector connected to F1 is FAM, and the fluorescent signal connector connected to F2 is HEX.

[0015] The present invention also provides the application of the above-mentioned KASP molecular marker or the above-mentioned primer set in the preparation of products for identifying the stomatal width of wheat.

[0016] Furthermore, the product is a reagent kit.

[0017] The present invention also provides a kit for identifying the stomatal width of wheat, comprising the primer set described above.

[0018] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in identifying the stomatal width of wheat.

[0019] The present invention also provides a method for identifying the stomatal width of wheat, comprising the following steps:

[0020] Genomic DNA was extracted from the wheat sample to be tested;

[0021] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0022] Based on the fluorescence signal, the stomatal width trait of the wheat to be tested can be identified;

[0023] If the fluorescence signal matches the color of the fluorescent connector of F1, then the wheat to be tested is identified as a type of wheat with narrow stomatal width.

[0024] If the fluorescence signal matches the color of the fluorescent connector of F2, then the wheat to be tested is identified as a type of wheat with a wide stomatal width.

[0025] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in wheat drought resistance breeding.

[0026] The present invention also provides a method for breeding drought-resistant wheat, comprising the following steps:

[0027] Genomic DNA was extracted from the wheat sample to be tested;

[0028] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0029] If the fluorescence signal matches the color of the fluorescent connector of F1, then the wheat sample to be tested is retained for breeding.

[0030] The present invention discloses the following technical effects:

[0031] This invention develops a KASP molecular marker closely associated with stomatal width in wheat based on the A / G base variation at locus 55049899 on wheat chromosome 5D. Its nucleotide sequence is shown in SEQ ID NO.4. A primer set for amplifying this KASP molecular marker was further designed, including upstream primers F1 and F2 connected to fluorescent linkers of different colors, and a downstream primer R. Experimental results show that the KASP molecular marker developed in this invention can efficiently and accurately determine the genetic information of stomatal width and predict the stomatal width of wheat under drought stress. This not only saves identification costs but also significantly improves selection efficiency, accelerates the breeding process, and provides technical support for breeding drought-resistant and stress-tolerant wheat varieties. This invention has outstanding industrial application value. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 The image shows the genotyping results of different wheat germplasm using KASP markers; where A represents the stomatal width genotyping results; B represents the stomatal width detection results of two wheat genotypes; SW represents stomatal width; Genotypes represents genotypes; ** indicates P<0.01. Detailed Implementation

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0039] This invention analyzes the genetic variation of the QSw.gaas-5D quantitative trait locus for stomatal width in natural wheat populations and its correlation with stomatal width. The results show that when the base at chromosome 55049899, ​​which is closely linked to stomatal width, is A, it represents a dominant stomatal width allelic variation, indicating narrower stomata in wheat, consistent with the target stomatal trait for drought resistance breeding. Conversely, when the base at this locus is G, the wheat has wider stomata. Therefore, this locus variation can determine the genetic information of stomatal width, providing an effective molecular marker for stomatal width in wheat drought resistance breeding. The application of this KASP molecular marker can rapidly and accurately predict whether wheat will have narrower stomata under drought stress, saving the cost of stomatal phenotypic identification and greatly improving selection efficiency, thus accelerating the breeding process and providing technical support for efficiently screening superior stomatal width allelic variations and cultivating drought-resistant and stress-tolerant wheat varieties.

[0040] Example 1

[0041] 1. Development of markers closely linked to pore width

[0042] Based on the A / G base variation at position 55049899 on chromosome 5D in the Chinese spring wheat reference genome sequence RefSeq v1.0, it was verified that this is a SNP site that significantly and stably associates stomatal width in different environments. The 100 bp sequences upstream and downstream of this site are shown in SEQ ID NO.4, where the R at position 101 of SEQ ID NO.4 indicates that it is either A or G.

[0043] SEQ ID NO.4:

[0044] CCGCCTTCGGAAACTGCAACGGGCCCTGGGTCCTCTTCGTGGGAGGTGATGTCGAGGTTCTGCAGCGTGCTGGTGTCCAGTTCCATCTTTGTTGAGACTT R GCGGCGGCGGCCGCAGCGGAGTATAACTCGGACGTGGCGGCGGTGGCGGCGGCGGCAAAAACCTCCTTCTGTTGGCTCGGGTCGCTCTAGTCACCTGTGT.

[0045] The 5D-55049899 (A / G) locus was developed into a KASP molecular marker, K000838, tightly linked to wheat stomatal width. Two allele-specific forward primers and one reverse universal primer were designed using the online software Polymarker (http: / / www.polymarker.info / ).

[0046] The standard FAM tag and HEX tag were added to the 5′ end of the two allele-specific primers, respectively. The primer sequences are shown in Table 1.

[0047] Table 1 Primer sequences for KASP markers

[0048] Primers Sequence (5'-3') serial number F1 <![CDATA[ GAAGGTGACCAAGTTCATGCT CAGTTCCATCTTTGTTGAGACTTA]]> SEQ ID NO.1 F2 <![CDATA[ GAAGGTCGGAGTCAACGGATT AGTTCCATCTTTGTTGAGACTTG]]> SEQ ID NO.2 R TCCGAGTTATACTCCGCTGC SEQ ID NO.3

[0049] Note: The underlined sequence in F1 is the FAM fluorescent tag; the underlined sequence in F2 is the HEX fluorescent tag.

[0050] 2. KASP marker amplification

[0051] 2.1 Extraction of wheat genomic DNA

[0052] Take wheat seeds for indoor germination. Select 5 healthy seedlings from each wheat variety (strain) and mix their leaves. Place them in a 2 mL centrifuge tube containing stainless steel beads and freeze them quickly with liquid nitrogen for later use. Centrifuge tubes were ground using a plant tissue homogenizer (30 Hz, 40 s). 600 μL of preheated CTAB (cetyltrimethylammonium bromide) was added, and the mixture was rapidly mixed. The mixture was incubated in a 65°C water bath for 15 min, inverting twice during incubation. An equal volume of chloroform:isoamyl alcohol (24:1, v / v) was added, the tubes were gently inverted, and the mixture was centrifuged at 12000 rpm for 5 min. 300 μL of the supernatant was collected, and 100 μL of 5M NaCl solution and an equal volume of pre-cooled isopropanol were added. The mixture was gently shaken and placed in a refrigerator for 30 min. Centrifugation was repeated at 12000 rpm for 5 min. The waste liquid was discarded, and the precipitate was resuspended in 600 μL of 70% ethanol. Centrifugation was repeated once more. Finally, 20 μL of ddH2O was added, and the mixture was stored in a refrigerator. DNA concentration and quality were determined using a NanoDrop 2000c micro-spectrophotometer, and DNA quality was assessed using agarose gel electrophoresis.

[0053] 2.2 Amplification System

[0054] The KASP-labeled K000838 primer premix was prepared in the following proportions: 30 µL of 100 µM universal primer R, 12 µL each of 100 µM competitive primer F1 and 100 µM competitive primer F2, and 46 µL of ddH2O.

[0055] Each reaction system for KASP marker detection contains: 0.8 µL of 2 × KASP master Mix, 0.022 µL of KASP primer premix, and 0.8 µL of DNA template (50 ng / µL), for a total of 1.622 µL.

[0056] PCR reactions were performed using a Bio-Rad S1000 384-well PCR instrument, with the following program: Stage 1: Denaturation at 95℃ for 15 min; Stage 2: Denaturation at 95℃ for 20 s, followed by annealing and extension at 65℃ for 1 min (from the second cycle onwards, the temperature was decreased by 1℃ each cycle, for a total of 9 cycles); Stage 3: Denaturation at 95℃ for 20 s, followed by annealing and extension at 55℃ for 1 min, for a total of 30 cycles. After the reaction, data were read using SNPviewer fluorescence genotyping software. The genotype was determined to be G when a HEX fluorescence signal was detected, and A when a FAM fluorescence signal was detected.

[0057] 3. Application of KASP marker for wheat stomatal width

[0058] KASP molecular marker primers were used to amplify and genotype 94 wheat accessions. The results showed that the K000838 molecular marker primers could clearly separate the two genotypes. The red dots near the Y-axis represent wheat germplasm with wider stomata carrying the G allelic variant, while the blue dots near the X-axis represent wheat germplasm with narrower stomata carrying the A allelic variant. Figure 1 In wheat germplasm with genotype AA, the stomatal width was significantly lower than that of GG (P<0.01), with an average decrease of 36%. Figure 1 (B). The results showed that this marker can effectively identify the stomatal width of wheat.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a primer set in the preparation of a product for identifying the stomatal width of wheat, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.1, F2 as shown in SEQ ID NO.2, and R as shown in SEQ ID NO.3; F1 and F2 are connected by fluorescent signal connectors of different colors.

2. The application as described in claim 1, characterized in that, The product in question is a reagent kit.

3. The application of a primer set or kit in identifying the stomatal width of wheat, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.1, F2 as shown in SEQ ID NO.2, and R as shown in SEQ ID NO.3; F1 and F2 are connected by fluorescent signal connectors of different colors; The kit contains the aforementioned primer set.

4. A method for identifying the stomatal width of wheat, characterized in that, Includes the following steps: Genomic DNA was extracted from the wheat sample to be tested; The genomic DNA was amplified by PCR using the primer set described in claim 1, and the fluorescence signal of the PCR amplification result was read. Based on the fluorescence signal, the stomatal width trait of the wheat to be tested can be identified; If the fluorescence signal matches the color of the fluorescent connector of F1, then the wheat to be tested is identified as a type of wheat with narrow stomatal width. If the fluorescence signal matches the color of the fluorescent connector of F2, then the wheat to be tested is identified as a type of wheat with a wide stomatal width.