RNAi agents for inhibiting complement factor B (CFB) expression, pharmaceutical compositions and methods of use thereof

Abstract

The present disclosure relates to RNAi agents capable of inhibiting complement factor B (CFB) gene expression. Pharmaceutical compositions comprising the CFB RNAi agents and methods of using the same are also disclosed. The CFB RNAi agents disclosed herein can be conjugated to targeting ligands, including ligands comprising N-acetylgalactosamine, to facilitate in vivo delivery to hepatocytes. RNAi agents may be used in methods of treating diseases, disorders or symptoms mediated in part by CFB gene expression, the diseases, conditions or symptoms include IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T cell mediated rejection in renal transplantation, anti-neutrophil cytoplasm antibody (ANCA) associated vasculitis, age-related macular degeneration (AMD), and the like. , including early and / or mid-term AMD, map atrophy (GA), glaucoma, Doyne cellular retinal dystrophy, paroxysmal sleep hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

Description

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 491,505, filed March 21, 2023, and U.S. Provisional Patent Application Serial No. 63 / 566,013, filed March 15, 2024, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Invention Field This disclosure relates to RNA interference (RNAi) agents for inhibiting complement factor B (CFB) gene expression, such as double-stranded RNAi agents, like chemically modified small interfering RNA (siRNA), pharmaceutical compositions including CFB RNAi agents, and methods of use for treating CFB-related diseases and conditions.

[0003] sequence list This application contains a sequence list (compliant with ST26) submitted in XML format and incorporated herein by reference in its entirety. The XML sequence list file is named 30719-WO_SeqListing.xml, created on March 18, 2024, and is 5066 kb in size.

[0004] background The complement cascade is an important part of the innate immune system, providing the first line of defense against infection and orchestrating the clearance of apoptotic cells and debris by labeling them for processing. (Defendi et al.) Clin Rev Allergy Immunol. 2020, 58(2):229-51). However, dysregulation of complement system activation can lead to the progression of certain kidney diseases, either by exerting a direct pathogenic effect or by amplifying or exacerbating the inflammatory and destructive effects of non-complement disease triggers. (Schroder-Braunstein et al., Mol Immunol. 2019, 114:299-311).

[0005] The complement system can be activated through three distinct pathways: the alternative pathway, the classical pathway, and the lectin pathway. Each of these three complement activation pathways has important physiological functions and plays a role in the pathogenesis of various diseases. Activation of the complement system ultimately leads to the formation of the membrane attack complex (MAC) (the cytotoxic unit of this system), and the complement protein fragments generated during activation can act as opsonins or pro-inflammatory chemoattractants. An overview of the complement system is described in Garred et al. Pharmacol. Rev. 2021, 73:792–827 (see, for example, one of them) Figure 1 ).

[0006] Complement factor B (CFB) is a core component of the alternative pathway of the complement system. It has previously been identified as a potential therapeutic target for diseases associated with complement dysregulation involving the alternative pathway, such as IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., Immunobiology 2016, 221:733-739; Casiraghi et al., Am. J. Transplantation 2017, 17:2312-2325; Wong and Kavanaugh, Seminars in Immunopathology 2018, 40:49-64; Holers and Banda, Frontiers in Immunology 2018, 9:1057 Poppelaars and Thurman, Molecular Immunology Crowley et al., 2020, 188:175-187. Human Molecular Genetics , 2023, 32(2):204-217; Blakey et al., Int'l J. Women's Cardiovascular Health 2023, 32:43-49; Hoppe and Gregory-Ksander Int'l J. Med. Sci. (2024, 25:2307). However, despite a strong interest in developing complement-targeting therapies for treating one or more of these conditions, a significant number of unmet medical needs remain.

[0007] For example, current treatments for IgAN and C3G are limited to supportive care (including lifestyle modifications and renal protective agents targeting the renin-angiotensin system) and broad-spectrum immunosuppressants (including corticosteroids and mycophenolate mofetil), which are significantly limited by a lack of specificity to the underlying disease process and / or a profile of adverse side effects with long-term use (Gleeson and O'Shaugnessy, Nephrol Dial Transplant(2023, 38:2464-2473). Although the role of complement dysregulation in the pathophysiology of IgAN or C3G is widely recognized, no complementary-targeting therapies for them have been approved. In PNH, agents targeting the alternative complement pathway have shown improved clinical outcomes compared to existing, broader-scope therapies, leading to their approval and highlighting the potential advantage of more precise therapies targeting the pathophysiology of the disease, particularly complement dysregulation (Hillmen et al., 2023, 38:2464-2473). NEJMED 2021, 384:1028-37; Peffault de Latour et al., NEJMED 2022, 390:994-1008).

[0008] While complement inhibitors targeting alternative pathways are being developed as potential therapies for some complement-mediated diseases, significant limitations and challenges remain in their development. For example, agents that broadly inhibit the complement cascade can significantly increase the risk of infection and other adverse events. For diseases clearly involving dysregulation of alternative pathways, a more preferable approach is to selectively target the pathway while maintaining the integrity of both the classical and lectin pathways. Delivery and adherence are also concerns among the CFB inhibitors currently under development. Some CFB inhibitors are large molecules, such as monoclonal antibodies, which typically require intravenous administration and have limited tissue penetration. Alternatively, certain orally delivered small-molecule CFB inhibitors are under development, which simplify delivery but require frequent dosing, up to twice daily (BID), increasing the patient's medication burden and increasing the risk of rebound effects upon missed doses.

[0009] Furthermore, given CFB's central role in complement activation and its clear association with disease susceptibility, specifically targeting CFB offers potential advantages over targeting other complement components. Targeting and inhibiting CFB can maintain the integrity of other pathways in the complement system and reduce patient susceptibility to infections resulting from inhibition of the classical and lectin pathways. RNAi-based CFB targeting also offers potential advantages in terms of ease of administration and infrequent dosing via subcutaneous routes. While numerous studies have proposed siRNAs or other oligonucleotide molecules for targeting CFB, none of the previously disclosed inhibitory molecules have demonstrated the necessary combination of sufficient gene silencing, a suitable safety profile, and stable and durable inhibitory activity (which eliminates the need for frequent dosing to address adherence issues encountered by some patients with any existing or known candidate therapies).

[0010] Overview New RNA interference (RNAi) agents (called RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents, are needed to selectively and effectively inhibit CFB gene expression. Furthermore, there is a need for novel compositions of CFB-specific RNAi agents to serve as therapeutic agents or medicines for treating diseases or conditions associated with dysregulation of the complement bypass pathway, including, as non-limiting examples, the following: IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al., 2017, Wong and Kavanaugh, 2018, Holers and Banda, 2018, Poppeelaars and Thurman, 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander, 2024).

[0011] The nucleotide sequences and chemical modifications of the CFB RNAi agents disclosed herein differ from those previously disclosed or known in the art. The CFB RNAi agents disclosed herein provide highly specific, potent, and efficient in vivo inhibition of CFB gene expression.

[0012] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differs from the 15 consecutive nucleotides of any of the sense strand sequences in Tables 2, 4A, 4B, or 5C by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on the 15 consecutive nucleotides.

[0013] In some embodiments, at least one nucleotide of the RNAi agent includes a modified nucleoside linker.

[0014] In some embodiments, the modified nucleotides of the CFB RNAi agents disclosed herein are selected from the following: 2′-O-methyl nucleotides, 2′-fluoronucleotides, 2′-deoxynucleotides, 2′,3′-open-ring nucleotide mimics, locked nucleotides, 2′-F-arabinonucleotides, 2′-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse 2′-O-methyl nucleotides, reverse 2′-deoxynucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides; morpholino-containing nucleotides (e.g., replacing the ribose ring with a methylene morpholine ring), vinyl phosphonates, cyclopropyl phosphonates, and 3′-O-methyl nucleotides.

[0015] In other embodiments, all or substantially all of the modified nucleotides of the RNAi agents disclosed herein are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.

[0016] In some implementations, the antisense strand consists of, is substantially composed of, or contains any of the modified antisense strand sequences in Table 3.

[0017] In some implementations, the sense strand consists of, is substantially composed of, or contains any of the modified sense strand sequences in Table 4A or Table 4B.

[0018] In some implementations, the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3, while the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4A or Table 4B.

[0019] The RNAi agents disclosed herein are linked to a targeting ligand comprising N-acetylgalactosamine. In a further embodiment, the targeting ligand is linked to the sense strand. In some embodiments, the targeting ligand is linked to the 5' end of the sense strand.

[0020] In some embodiments, the sense strand is between 15 and 30 nucleotides in length, while the antisense strand is between 18 and 30 nucleotides in length. In other embodiments, the sense strand and antisense strand are each between 19 and 27 nucleotides in length. In other embodiments, the sense strand and antisense strand are each between 21 and 24 nucleotides in length. In other embodiments, the sense strand and antisense strand are each 21 nucleotides in length.

[0021] In some implementations, the RNAi agent has two blunt ends.

[0022] In some embodiments, the sense chain includes one or two terminal caps. In other embodiments, the sense chain includes one or two reverse debasing residues.

[0023] In some implementations, the RNAi agent comprises a sense strand and an antisense strand that form a double-stranded sequence that creates the double-stranded structure shown in Table 5C.

[0024] In some embodiments, the sense strand further includes reverse debasement residues at the 3' end, the 5' end, or both ends of the nucleotide sequence.

[0025] In a further implementation, the targeting ligand includes: ,or .

[0026] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246).

[0027] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, by no more than one nucleotide from, one of the following nucleotide sequences (5′→3′): AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246); All or nearly all of the nucleotides are modified nucleotides.

[0028] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide base: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246); The nucleotide sequence is located at position 1-21 (5′ → 3′) on the antisense strand.

[0029] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246); The CFB RNAi agent further includes at least a sense strand that is partially complementary to the antisense strand; and all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides.

[0030] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246); The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises reverse debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for the desialylate glycoprotein receptor, preferably wherein the targeting ligand comprises N-acetylgalactosamine.

[0031] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246); The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inversely debased residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for the desialylate glycoprotein receptor, preferably wherein the targeting ligand comprises N-acetylgalactosamine; and wherein the corresponding antisense strand sequence is located at positions 1-21 of the antisense strand.

[0032] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand and a sense strand, wherein the antisense strand and sense strand consist of, substantially consist of, or contain a nucleotide sequence that differs from, one of the following nucleotide sequence pairs (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275) and GCUUGUGGUGUCUGAGUACUUU (SEQ ID NO:1355); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283) and GAUGAGGAUUUGGGUUUUCUA (SEQ ID NO:1363); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332) and GCUUGUGGUGUCUGAGUACUUA (SEQ IDNO:1406); UAAGUACUCAGACACCAUAGC (SEQ ID NO: 1333) and GCUUGUGGUGUCUGAGUACUUA (SEQ ID NO: 1406); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326) and GCUGUGGUGUUUGAGUACUUA (SEQ ID NO:1409); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310) and GGACCCAAUUACUGUCAUUGA (SEQ IDNO:1390); AAAGUACUCAGACACCACA (SEQ ID NO:359) and UGUGGUGUCUGAGUACUUU (SEQ ID NO:1410); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474) and UGAGGAUUUGGGUUUUCUA (SEQ ID NO:1408); UAAGUACUCAGACACUACA (SEQ ID NO:367) and UUGUGGUGUCUGAGUACUUA (SEQ ID NO:779); UAAGUACUCAGACACCAUA (SEQ ID NO:361) and UGUGGUGUCUGAGUACUUA (SEQ ID NO:779); or UAAGUACUCAGACACCACA (SEQ ID NO:360) and UGUGGUGUUUGAGUACUUA (SEQ ID NO:1439) UCAAUGACAGUAAUUGGGU (SEQ ID NO:246) and ACCCAAUUACUGUCAUUGA (SEQ ID NO:665); All or nearly all nucleotides on the antisense and sense strands are modified nucleotides.

[0033] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand and a sense strand, wherein the antisense strand and sense strand consist of, substantially consist of, or contain a nucleotide sequence that differs from, one of the following nucleotide sequence pairs (5′→3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275) and GCUUGUGGUGUCUGAGUACUUU (SEQ ID NO:1355); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283) and GAUGAGGAUUUGGGUUUUCUA (SEQ ID NO:1363); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332) and GCUUGUGGUGUCUGAGUACUUA (SEQ IDNO:1406); UAAGUACUCAGACACCAUAGC (SEQ ID NO: 1333) and GCUUGUGGUGUCUGAGUACUUA (SEQ ID NO: 1406); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326) and GCUGUGGUGUUUGAGUACUUA (SEQ ID NO:1409); UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310) and GGACCCAAUUACUGUCAUUGA (SEQ IDNO:1390); AAAGUACUCAGACACCACA (SEQ ID NO:359) and UGUGGUGUCUGAGUACUUU (SEQ ID NO:1410); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474) and UGAGGAUUUGGGUUUUCUA (SEQ ID NO:1408); UAAGUACUCAGACACUACA (SEQ ID NO:367) and UUGUGGUGUCUGAGUACUUA (SEQ ID NO:779); UAAGUACUCAGACACCAUA (SEQ ID NO:361) and UGUGGUGUCUGAGUACUUA (SEQ ID NO:779); or UAAGUACUCAGACACCACA (SEQ ID NO:360) and UGUGGUGUUUGAGUACUUA (SEQ ID NO:1439) .UCAAUGACAGUAAUUGGGU (SEQ ID NO:246) and ACCCAAUUACUGUCAUUGA (SEQ ID NO:665); All or substantially all nucleotides on the antisense strand and sense strand are modified nucleotides; and the sense strand further includes reverse debasement residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for the desialylate glycoprotein receptor, preferably wherein the targeting ligand comprises N-acetylgalactosamine.

[0034] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a modified nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by no more than one nucleotide: asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022); Wherein a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; and s represents a thiophosphate linker, wherein the sense strand is at least substantially complementary to the antisense strand. Those skilled in the art will clearly understand that, as shown in the modified nucleotide sequences disclosed herein, the inclusion of thiophosphate links replaces the phosphodiester links typically present in oligonucleotides.

[0035] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a modified nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by no more than one nucleotide: asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022); Where a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; and s represents a thiophosphate linker, wherein the sense strand is at least substantially complementary to the antisense strand; and all or substantially all nucleotides of the sense strand are modified nucleotides.

[0036] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand that consists of, is substantially composed of, or contains a modified nucleotide sequence that differs from, one of the following nucleotide sequences (5′→3′) by no more than one nucleotide: asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022); The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides of the sense strand are modified nucleotides; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises reverse debasement residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for the desialylate glycoprotein receptor, preferably wherein the targeting ligand comprises N-acetylgalactosamine.

[0037] In some embodiments, the CFB RNAi agents disclosed herein include an antisense strand and a sense strand, which consist of, are substantially composed of, or contain one of the following nucleotide sequence pairs (5′→3′): asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983) and gcugugguGfUfCfugaguacuuu (SEQ ID NO:1176); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913) and gaugaggaUfUfUfggguuuucua (SEQ ID NO:1184); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915) and gaugaggaUfuUfGfgguuuucua (SEQ ID NO:1185); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013) and gcugugguGfUfCfugaguacuua (SEQ ID NO:1235); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014) and gcugugguGfUfCfugaguacuua (SEQ ID NO:1235); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994) and gcugugguGfUfUfugaguacuua (SEQ ID NO:1248); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022) and ggacccAfaUfuAfcugucauuga (SEQ ID NO:1251); Wherein a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; and s represents a thiophosphate linker; and wherein the sense chain further includes a targeting ligand with affinity for the desialyl glycoprotein receptor, preferably wherein the targeting ligand includes N-acetylgalactosamine, wherein the targeting ligand is optionally linked to the 5′ end of the sense chain.

[0038] In some embodiments, the CFB RNAi agents disclosed herein include antisense and sense strands, which consist of, are substantially composed of, or contain a modified nucleotide sequence that differs from one of the following sequence pairs (5′→3′) by 0 or 1 nucleotide: asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuus(invAb) (SEQ ID NO:1077); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913) and (NAG37)s(invAb)sgaugaggaUfUfUfggguuuucuas(invAb) (SEQ ID NO:1085); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915) and (NAG37)s(invAb)sgaugaggaUfuUfGfgguuuucuas(invAb) (SEQ ID NO:1086); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO:1136); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO:1136); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994) and (NAG37)s(invAb)sgcugugguGfUfUfugaguacuuas(invAb) (SEQ ID NO:1149); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022) and (NAG37)s(invAb)sggacccAfaUfuAfcugucauugas(invAb) (SEQ ID NO:1152); Where a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; (NAG37)s represents the tridentate N-acetylgalactosamine hepatocyte-targeting ligand, the chemical structure of which is shown in Table 6; (invAb) represents the reverse debased deoxyribonucleotide (see Table 6 for further details), and s represents the thiophosphate linker.

[0039] This article also discloses compositions comprising the disclosed RNAi agent, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0040] In addition, this article provides a method for inhibiting CFB gene expression in hepatocytes of human subjects in vivo, the method comprising introducing an effective amount of the disclosed CFB RNAi agent or the disclosed composition into the subject.

[0041] This article further provides a method for treating CFB-related diseases, conditions, or symptoms, comprising administering a therapeutically effective amount of the disclosed composition to a subject in need.

[0042] In some implementations, the disease is PNH, IgAN, C3G, AMD (including early and / or intermediate AMD), aHUS, GA, IC-MPGN, LN, anti-GBM, RA, Doyne celluloid retinal dystrophy, and / or other complement-mediated kidney diseases.

[0043] In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg / kg to about 6.0 mg / kg of human subject weight. In some embodiments, the CFB RNAi agent disclosed herein is administered at a fixed dose of a single injection containing about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg of CFB RNAi agent.

[0044] This article also provides the use of the disclosed RNAi agents or the disclosed compositions for the treatment of diseases, conditions or symptoms at least partially mediated by CFB gene expression.

[0045] This document further provides the use of the disclosed RNAi agent or the disclosed composition in the preparation of a pharmaceutical composition for treating at least a portion of a disease, condition, or symptom mediated by CFB gene expression. Attached Figure Description

[0046] Figure 1 Plot the relative serum cCFB protein levels in cynomolgus monkeys relative to pre-drug administration levels. The syringe indicates the injection time. (See Example 12).

[0047] Figure 2 Plotting relative Wieslab values ​​in cynomolgus monkeys after normalization from pre-drug administration. ® A graph showing the AP (bypass pathway) measurement results. (See Example 12).

[0048] Figure 3 Plot the serum cCFB protein levels in cynomolgus monkeys relative to pre-administration normalized levels. The syringe indicates the injection time. (See Example 13).

[0049] Figure 4 Plot a graph of relative serum cBb levels in cynomolgus monkeys relative to pre-administration normalized levels. The syringe indicates the injection time. (See Example 13).

[0050] Figure 5 Plot the results of relative AP50 hemolysis assay (bypass pathway) in cynomolgus monkeys relative to pre-administration normalization. Syringe indicates injection time. (See Example 13).

[0051] Figure 6 Plotting relative Wieslab values ​​in cynomolgus monkeys after normalization from pre-drug administration. ® A graph of AP (bypass pathway) measurement results. The syringe indicates the injection time. (See Example 13).

[0052] Figure 7Plot the results of relative CH50 hemolysis assay (classical route) in cynomolgus monkeys relative to pre-drug administration normalization. The syringe indicates the injection time. (See Example 13).

[0053] Figure 8 Plotting relative Wieslab values ​​in cynomolgus monkeys after normalization from pre-drug administration. ® A graph of CP (classical route) assay results. The syringe indicates the injection time. (See Example 13).

[0054] Figure 9 Plot a graph of relative serum cCFB protein levels in cynomolgus monkeys relative to pre-administration normalized levels achieved using the CFB RNAi agent. The syringe indicates the time of injection of the CFB RNAi agent AD13933. (See Example 16).

[0055] Figure 10 Plot a graph of relative serum cBb levels in cynomolgus monkeys relative to pre-administration normalized levels achieved with the CFB RNAi agent AD13933. The syringe indicates the time of injection of the CFB RNAi agent AD13933. (See Example 16).

[0056] Figure 11 Plot the relative AP50 hemolysis assay (bypass pathway) results achieved with the CFB RNAi agent AD13933 relative to the pre-administration normalized values ​​in cynomolgus monkeys. The syringe indicates the time of injection of the CFB RNAi agent AD13933. (See Example 16).

[0057] Figure 12 Plotting relative Wieslab values ​​in cynomolgus monkeys relative to pre-drug administration normalized using the CFB RNAi agent AD13933. ® A graph showing the AP (bypass pathway) assay results. The syringe indicates the time of injection of the CFBRNAi agent AD13933. (See Example 16).

[0058] Figure 13 Plot the results of relative CH50 hemolysis assays (classical route) in cynomolgus monkeys relative to pre-drug normalization. The syringe indicates the time of injection of the CFB RNAi agent AD13933. (See Example 16).

[0059] Figure 14 Plot the relative Wieslab® CP (classical pathway) assay results in cynomolgus monkeys relative to pre-drug normalization. The syringe indicates the injection time of the CFB RNAi agent AD13933. (See Example 16).

[0060] Figures 15A-15DA schematic diagram of the chemical structure of the CFB RNAi agent AD12096 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 913 / 1085), shown as free acid.

[0061] Figures 16A-16D A schematic diagram of the chemical structure of the CFB RNAi agent AD12096 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 913 / 1085), shown as sodium salt.

[0062] Figures 17A-17D A schematic diagram of the chemical structure of the CFB RNAi agent AD13126 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 983 / 1077), shown as free acid.

[0063] Figures 18A-18D A schematic diagram of the chemical structure of the CFB RNAi agent AD13126 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 983 / 1077), shown in sodium salt form.

[0064] Figures 19A-19D A schematic diagram of the chemical structure of the CFB RNAi agent AD13933 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO:1013 / 1136), shown in free acid form.

[0065] Figures 20A-20D A schematic diagram of the chemical structure of the CFB RNAi agent AD13933 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO:1013 / 1136), shown in sodium salt form.

[0066] Figures 21A-21D A schematic diagram of the chemical structure of the CFB RNAi agent AD13935 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 994 / 1149), shown in free acid form.

[0067] Figures 22A-22D A schematic diagram of the chemical structure of the CFB RNAi agent AD13935 (in which the targeting ligands (NAG37) are attached to the 5' end of the sense strand) (SEQ ID NO: 994 / 1149), shown in sodium salt form.

[0068] Detailed Explanation The disclosed CFB RNAi agents, their compositions, and methods of use can be more readily understood by referring to the following specific embodiments (which form part of this disclosure). It should be understood that this disclosure is not limited to what is specifically described and / or shown herein, and the terminology used herein is for illustrative purposes only and is not intended to be limiting.

[0069] It should be understood that although some features of this disclosure contained herein are described in the context of individual embodiments for clarity, they may also be provided in combination in a single embodiment. Conversely, various features of the disclosed methods described in the context of individual embodiments for brevity may also be provided individually or in any sub-combination.

[0070] Definitions As used herein, “RNAi agent” refers to a chemical composition containing an oligonucleotide molecule of RNA or RNA-like molecules (e.g., chemically modified RNA) capable of degrading or inhibiting (e.g., under appropriate conditions, degrading or inhibiting) the translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. RNAi agents as used herein may act through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. While it is believed that the term RNAi agent as used herein primarily acts through RNA interference mechanisms, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein contain sense and antisense strands and include, but are not limited to, short (or small) interfering RNAs (siRNA), double-stranded RNAs (dsRNA), microRNAs (miRNA), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., CFB mRNA). RNAi agents may contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0071] As used herein, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” when referring to the expression of a given gene mean, when cells, cell populations, tissues, organs, or subjects are treated with the RNAi agents described herein, a reduction in the expression of that gene compared to a second cell, cell population, tissue, organ, or subject that has not been treated or has not been so treated, as measured by the level of RNA transcribed from that gene or the level of polypeptides, proteins, or protein subunits translated from mRNA in the cells, cell populations, tissues, organs, or subjects in which the gene was transcribed.

[0072] As used herein, the terms "sequence" and "nucleotide sequence" refer to a continuous sequence or order of nucleobases or nucleotides, described using standard nomenclature as a continuous sequence of letters. Nucleic acid molecules may contain unmodified and / or modified nucleotides. Nucleotide sequences may contain unmodified and / or modified nucleotides.

[0073] As used herein, “base,” “nucleotide base,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. edited Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0074] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Therefore, as used herein, "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linking group) such as a phosphate ester or thiophosphate internucleotide linking group, and encompasses both naturally occurring nucleotides (such as DNA or RNA) and non-naturally occurring nucleotides comprising modified sugar and / or base moieties (also referred to herein as nucleotide analogs). In this document, a single nucleotide may be referred to as a monomer or unit.

[0075] As used herein, and unless otherwise stated, the term "complementary" in describing a first nucleobase or nucleotide sequence (e.g., a sense strand or targeted mRNA of an RNAi agent) relative to a second nucleobase or nucleotide sequence (e.g., an antisense strand or single-stranded antisense oligonucleotide of an RNAi agent) refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide containing the second nucleotide sequence under certain standard conditions (forming base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a double-stranded or double-helical structure. Those skilled in the art will be able to select the set of conditions most suitable for the hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include native or modified nucleotides or nucleotide mimics to at least the extent required for hybridization described above. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af, as defined herein, are complementary to U (or T) and identical to A.

[0076] As used herein, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0077] As used herein, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% (but not all) of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0078] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% (but not all) of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0079] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” refer to the matching nucleobases or nucleotides between the sense and antisense strands of the RNAi agent, or between the antisense strand of the RNAi agent and the MUC5AC mRNA sequence.

[0080] As used herein, the terms "substantially identical" or "substantially identical" when applied to nucleic acid sequences mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more compared to a reference sequence, for example, at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid bases occurs to obtain the number of matching positions, dividing the number of matching positions by the total number of positions within the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein.

[0081] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to any member of any animal species, including but not limited to birds, humans, and other primates, as well as other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0082] As used herein, the terms “treat” and “treatment” refer to methods or procedures taken to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include prevention, control, preventative treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0083] As used in this article, the phrase "introduced into cells" when referring to RNAi agents means the functional delivery of RNAi agents into cells. The phrase "functional delivery" means the delivery of RNAi agents into cells in a manner that enables them to have the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0084] Unless otherwise stated, as used in this document, symbols The use of means that any one or more groups may be attached to it, which is consistent with the scope of the invention described herein.

[0085] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the properties or bonding order of their atoms, or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," while stereoisomers that are non-overlapping mirror images of each other are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called the "chiral center."

[0086] As used herein, unless a specific conformation is explicitly specified in the structure, each structure disclosed herein is intended to represent all such possible isomers, including both their optically pure and racemic forms, for each structure that has an asymmetry center and thus produces enantiomers, diastereomers, or other stereoisomers. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0087] The phrase “consisting of” as used in the claims herein excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps, and those materials or steps that do not substantially affect the essential and novel features of the claimed invention.

[0088] It will be readily understood and appreciated by those skilled in the art that the compounds and compositions disclosed herein may have certain atoms in a protonated or deprotonated state (e.g., N, O, or S atoms), depending on the environment in which the compound or composition is situated. Therefore, as used herein, the structures disclosed contemplate certain functional groups that can be protonated or deprotonated, such as OH, SH, or NH. As will be readily understood by those skilled in the art, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the respective compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0089] As used herein, the terms “link” or “combination” refer to the connection between two compounds or molecules when used to mean the connection between the two compounds or molecules via a covalent bond. Unless otherwise stated, as used herein, the terms “link” and “combination” may refer to the connection between a first compound and a second compound, with or without any intermediate atoms or groups.

[0090] As used herein, the term "including" is used to mean the phrase "including but not limited to" and is used interchangeably with it. The term "or" is used to mean the term "and / or" and is used interchangeably with it unless the context clearly indicates otherwise.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials may be used in the practice or testing of this invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, this specification (including definitions) shall prevail. Furthermore, materials, methods, and examples are illustrative only and not intended to be limiting.

[0092] Where a value is explicitly listed, it should be understood that values ​​of approximately the same quantity or amount as the listed value are also within the scope of this disclosure. Where a combination is disclosed, each sub-combination of elements within that combination is also explicitly disclosed and is within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any element of this disclosure is disclosed as having multiple alternatives, instances of this disclosure where each alternative is excluded individually or in any combination with other alternatives are also disclosed; more than one element of this disclosure may have such exclusions, and all combinations of elements having such exclusions are thus disclosed.

[0093] Other objects, features, aspects and advantages of the invention will become apparent from the following detailed description, drawings and appended claims. Detailed Implementation

[0094] Agent This document describes RNAi agents for inhibiting CFB gene expression. Each CFB RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 30 nucleotides in length. The sense strand and antisense strand can be the same length or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 21 to 27 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21 to 26 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length, and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21 nucleotides in length. In some embodiments, the length of the antisense strand of the RNAi agent is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand of the RNAi agent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. The sense and antisense strands anneal to form a double strand, and in some embodiments, the double-stranded RNAi agent has a double strand length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0095] Examples of nucleotide sequences used to form CFB RNAi agents are provided in Tables 2, 3, 4A, 4B, or 5C. Examples of RNAi agent duplexes including the sense and antisense strand sequences in Tables 2, 3, 4A, 4B, or 5C are shown in Tables 5A, 5B, or 5C.

[0096] In some embodiments, the length of the region that is completely, substantially, or partially complementary between the sense and antisense strands is 15-26 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and appears at or near the 5′ end of the antisense strand (e.g., the region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 incomplete, substantially, or partially complementary nucleotides).

[0097] The sense strand of the CFB RNAi agent described herein comprises at least 15 consecutive nucleotides that share at least 85% identity with the core stretch sequence (also referred to herein as the "core stretch" or "core sequence") of the same number of nucleotides in the CFB mRNA. In some embodiments, the sense strand core stretch sequence is 100% (completely) complementary to or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand, and therefore the sense strand core stretch sequence is typically identical to or shares at least about 85% identity with a nucleotide sequence of the same length present in the CFB mRNA target (sometimes referred to, for example, the target sequence). In some embodiments, the length of the sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core stretch is 17 nucleotides. In some embodiments, the length of the sense strand core stretch is 19 nucleotides. In some embodiments, the length of the sense strand core stretch is 21 nucleotides.

[0098] The antisense strand of the CFB RNAi agent described herein comprises at least 15 consecutive nucleotides that are at least 85% complementary to a core segment of the same number of nucleotides in the CFB mRNA and a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the CFB mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 21 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be of a different length.

[0099] CFB RNAi agents anneal the sense and antisense strands to form a double helix. The sense and antisense strands of a CFB RNAi agent can be partially, substantially, or completely complementary to each other. Within the complementary double helix region, the sense core sequence is at least 85% or 100% complementary to the antisense core sequence. In some implementations, the sense core region sequence comprises a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides, which is at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the antisense core region sequence (i.e., the sense and antisense core region sequences of the CFB RNAi agent have regions with at least 85% or 100% base pairing of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides).

[0100] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any antisense strand sequence in Tables 2, 3, or 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any sense strand sequence in Tables 2, 4A, or 5C by 0, 1, 2, or 3 nucleotides.

[0101] In some embodiments, the sense strand and / or antisense strand may optionally and independently include an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3′, 5′, or both 3′ and 5′ ends of the core segment sequence. The additional nucleotides of the antisense strand (if present) may be complementary to or not complementary to the corresponding sequence in the CFB mRNA. The additional nucleotides of the sense strand (if present) may be identical to or different from the corresponding sequence in the CFB mRNA. The additional nucleotides of the antisense strand (if present) may be complementary to or not complementary to the additional nucleotides of the corresponding sense strand (if present).

[0102] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and / or 3′ ends of the sense strand core sequence and / or antisense strand core sequence. The extended nucleotides on the sense strand may be complementary or non-complementary to the nucleotides (core sequence nucleotides or extended nucleotides) in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may be complementary or non-complementary to the nucleotides (core sequence nucleotides or extended nucleotides) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extended nucleotides of one strand pair with one or more 5′ extended nucleotide bases of the other strand. In other embodiments, one or more of the 3′ extended nucleotides of one strand do not pair with one or more 5′ extended nucleotide bases of the other strand. In some embodiments, the CFBRNAi agent has an antisense strand with 3′ extensions and a sense strand with 5′ extensions. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein and in the art, a “protruding end” refers to an extension of one or more unpaired nucleotides at the end of the sense or antisense strand that does not form part of the hybrid or double-stranded portion of the RNAi agent disclosed herein.

[0103] In some embodiments, the CFB RNAi agent comprises a 3′ extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the CFB RNAi agent comprises a 3′ extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense extended nucleotides comprise a nucleotide complementary to the corresponding CFB mRNA sequence. In some embodiments, one or more of the antisense extended nucleotides comprise a nucleotide not complementary to the corresponding CFB mRNA sequence.

[0104] In some embodiments, the CFB RNAi agent comprises a 3′ extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more of the sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the CFB mRNA sequence. In some embodiments, the 3′ sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed in 5′ to 3′ order).

[0105] The sense strand may have a 3′ extension and / or a 5′ extension. In some embodiments, the CFB RNAi agent comprises a sense strand with a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides contain nucleotides that correspond to or are identical to nucleotides in the CFB mRNA sequence.

[0106] Examples of sequences used to form CFB RNAi agents are provided in Tables 2, 3, 4A, 4B, or 5C. In some embodiments, the antisense strand of the CFB RNAi agent comprises any sequence from Tables 2, 3, or 5C. In some embodiments, the antisense strand of the CFB RNAi agent comprises or consists of any of the modified sequences in Table 3. In some embodiments, the antisense strand of the CFB RNAi agent comprises nucleotides (from 5′ to 3′) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any sequence in Tables 2, 3, or 5C. In some embodiments, the sense strand of the CFB RNAi agent comprises any sequence from Tables 2, 4A, 4B, or 5C. In some embodiments, the sense strand of the CFB RNAi agent comprises nucleotides (from 5′ to 3′) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 from any sequence in Tables 2, 4A, 4B, or 5C. In some embodiments, the sense strand of the CFB RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Tables 4A or 4B.

[0107] In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5′ end of the sense strand and the 3′ end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3′ end of the sense strand and the 5′ end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0108] In some embodiments, the 5′ end of the sense strand and the 3′ end of the antisense strand of the RNAi agent form a frayedend. In some embodiments, the 3′ end of the sense strand and the 5′ end of the antisense strand of the RNAi agent form a frayedend. In some embodiments, both ends of the RNAi agent form frayedends. In some embodiments, neither end of the RNAi agent is a frayedend. As used herein, a frayedend refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form overhangs) but not complementary (i.e., form non-complementary pairs). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form overhangs. Unpaired nucleotides may form 3′ or 5′ overhangs on either the sense or antisense strand. In some embodiments, the RNAi agent comprises: a blunt end and a loose end, a blunt end and a 5′ overhang, a blunt end and a 3′ overhang, a loose end and a 5′ overhang, a loose end and a 3′ overhang, two 5′ overhangs, two 3′ overhangs, a 5′ overhang and a 3′ overhang, two loose ends, or two blunt ends. Typically, when an overhang is present, it is located at the 3′ end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0109] The CFB RNAi agents disclosed herein may also comprise one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the CFB RNAi agent are modified nucleotides. The CFB RNAi agents disclosed herein may further comprise one or more modified internucleotide links, such as one or more phosphate thioester links. In some embodiments, the CFB RNAi agent comprises one or more modified nucleotides and one or more modified internucleotide links. In some embodiments, a 2′-modified nucleotide is combined with a modified internucleotide link.

[0110] In some embodiments, the CFB RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the CFB RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the CFB RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.

[0111] Modified nucleotides When used in various oligonucleotide constructs, modified nucleotides can preserve the activity of compounds in cells, increase the serum stability of these compounds, and minimize the possibility of activating interferon activity in the human body after administration of oligonucleotide constructs.

[0112] In some embodiments, the CFB RNAi agent contains one or more modified nucleotides. As used herein, “modified nucleotide” refers to a nucleotide other than a ribonucleotide (2′-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2′-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleosides, bridging nucleotides, peptide nucleic acids (PNAs), 2′,3′-open-ring nucleotide mimics (non-locked nucleobase analogs), locked nucleotides, 3′-O-methoxy (2′ nucleoside-linked) nucleotides, 2′-F-arabinonucleotides, 5′-Me, 2′-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2′-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (also referred to herein or in the art as 2′-methoxy nucleotides), 2′-fluoro nucleotides (also referred to herein or in the art as 2′-deoxy-2′-fluoro nucleotides), 2′-deoxy nucleotides, 2′-methoxyethyl (2′-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2′-MOE nucleotides), 2′-amino nucleotides, and 2′-alkyl nucleotides. All positions in a given compound need not be uniformly modified. Conversely, a single CFB RNAi agent, or even a single nucleotide therein, may incorporate more than one modification. The sense and antisense strands of a CFB RNAi agent can be synthesized and / or modified using methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0113] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, adenine, and guanine's 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, adenine and guanine's 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives, 2-thiouracil, 2-thiothyronine, etc. Adenine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0114] In some embodiments, the 5′ and / or 3′ ends of the antisense strand may contain a debase residue (Ab), also referred to as a “debase site” or “debase nucleotide.” A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleotide base at the 1′ position of the sugar moiety. In some embodiments, the debase residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3′ end of the antisense strand. In some embodiments, the 5′ end of the sense strand may contain one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab may be added to the 3′ end of the sense strand. In some embodiments, the debase (deoxyribose) residue may be replaced by a ribitol (debase ribose) residue.

[0115] In some embodiments, all or substantially all nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all nucleotides are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified) in both the sense and antisense strands. As used herein, a sense strand in which substantially all nucleotides are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all nucleotides are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of some modified nucleotides are shown in Table 6 herein.

[0116] Modified nucleoside interlinking In some implementations, one or more nucleotides of the CFB RNAi agent are linked via non-standard ligation or main chain (i.e., modified nucleotide-to-nucleotide ligation or modified main chain). Modified nucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by lowercase "s"), chiral phosphorothioates, thiophosphates, dithiophosphates, triphosphates, aminoalkyl phosphates, alkylphosphonates (e.g., methylphosphonates or 3′-alkylenephosphonates), chiral phosphonates, phosphonites, aminophosphates (e.g., 3′-aminoaminophosphates, aminoalkylaminophosphates, or thionophosphoramidates), thionoalkylphosphonates, thionoalkyl phosphates, morpholino linkages, borophosphates with normal 3′-5′ linkages, 2′-5′ linked borophosphate analogs, or borophosphates with reverse polarity (where adjacent nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′). In some embodiments, the modified nucleoside linkages or backbones lack a phosphorus atom. Modified internucleotide linkages lacking phosphorus atoms include, but are not limited to, linkages between short-chain alkyl or cycloalkyl sugars, linkages between mixed heteroatoms and alkyl or cycloalkyl sugars, or linkages between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate backbones and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0117] In some embodiments, the sense strand of the CFB RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, and the antisense strand of the CFB RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links. In some embodiments, the sense strand of the CFB RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, and the antisense strand of the CFB RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate-thioester links.

[0118] In some embodiments, the sense strand of the CFB RNAi agent contains at least two phosphate-thioester nucleoside links. In some embodiments, the phosphate-thioester nucleoside links are located between nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside link is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester link is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside links are located at the 5' end of the sense strand, and another phosphate-thioester link is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphate-thioester nucleoside links between nucleotides, but contains one, two, or three phosphate-thioester links between the terminal nucleotides at the 5' and 3' ends and optionally, a reverse debasement residue terminal cap. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester links.

[0119] In some embodiments, the antisense strand of the CFB RNAi agent contains four phosphate-thioester nucleoside links. In some embodiments, these four phosphate-thioester nucleoside links are between nucleotides located 1-3 from the 5' end of the antisense strand, and between nucleotides located at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphate-thioester nucleoside links are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside link is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the CFB RNAi agent contains at least three or four phosphate-thioester nucleoside links in the antisense strand.

[0120] Capped residues or parts In some embodiments, the sense strand may include one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a non-nucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the RNAi agent disclosed herein. In some cases, the capping residue may provide certain beneficial properties to the RNAi agent, such as protection against exonuclease degradation. In some embodiments, an inverse ablation residue (invAb) (also referred to in the art as an “inverse ablation site”) is added as a capping residue. (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverse ablation residues and carbon chains, such as terminal CFBH7 (propyl), C6H… 13 (Hexyl) or C 12 H25 (Dodecyl). In some embodiments, the capping residue is present at the 5′ end, 3′ end, or both of the 5′ and 3′ ends of the sense chain. In some embodiments, the 5′ end and / or 3′ end of the sense chain may contain more than one reverse deoxyribose moiety as a capping residue.

[0121] In some embodiments, one or more inverse debase residues (invAbs) are added to the 3′ end of the sense strand. In some embodiments, one or more inverse debase residues (invAbs) are added to the 5′ end of the sense strand. In some embodiments, one or more inverse debase residues or inverse debase sites are inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi agent. In some embodiments, including one or more inverse debase residues or inverse debase sites at or near one or more ends of the sense strand of the RNAi agent enables enhanced RNAi agent activity or other desired properties.

[0122] In some embodiments, one or more inverse debase residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverse debase residues may be inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi agent. Inverse debase residues may be linked by phosphate esters, thiophosphate esters (e.g., shown herein as (invAbs)), or other nucleoside linkages. In some embodiments, including one or more inverse debase residues at or near one or more ends of the sense strand of the RNAi agent may enable enhanced RNAi agent activity or other desired properties. In some embodiments, the inverse debase (deoxyribose) residue may be replaced by an inverse ribitol (debase ribose) residue. In some embodiments, the 3′ end of the core segment sequence of the antisense strand, or the 3′ end of the antisense strand sequence, may contain an inverse debase residue. The chemical structures of the inverse debase deoxyribose residues are shown in Table 6 below.

[0123] Agent The CFB RNAi agents disclosed herein are designed to target specific locations on the CFB gene (e.g., SEQ ID NO:1).

[0124] NM_001710.6 Homo sapiens complement factor B (CFB), mRNA transcript (SEQ ID NO:1): 1 gggaagggaa tgtgaccagg tctaggtctg gagtttcagc ttggacactg agccaagcag 61 acaagcaaag caagccagga cacaccatcc tgccccaggc ccagcttctc tcctgccttc 121 caacgccatg gggagcaatc tcagccccca actctgcctg atgcccttta tcttgggcct 181 cttgtctgga ggtgtgacca ccactccatg gtctttggcc cggccccagg gatcctgctc 241 tctggagggg gtagagatca aaggcggctc cttccgactt ctccaagagg gccaggcact 301 ggagtacgtg tgtccttctg gcttctaccc gtaccctgtg cagacacgta cctgcagatc 361 tacggggtcc tggagcaccc tgaagactca agaccaaaag actgtcagga aggcagagtg 421 cagagcaatc cactgtccaa gaccacacga cttcgagaac ggggaatact ggccccggtc 481 tccctactac aatgtgagtg atgagatctc tttccactgc tatgacggtt acactctccg 541 gggctctgcc aatcgcacct gccaagtgaa tggccgatgg agtgggcaga cagcgatctg 601 tgacaacgga gcggggtact gctccaaccc gggcatcccc attggcacaa ggaaggtggg 661 cagccagtac cgccttgaag acagcgtcac ctaccactgc agccgggggc ttaccctgcg 721 tggctcccag cggcgaacgt gtcaggaagg tggctcttgg agcgggacgg agccttcctg 781 ccaagactcc ttcatgtacg acacccctca agaggtggcc gaagctttcc tgtcttccct 841 gacagagacc atagaaggag tcgatgctga ggatgggcac ggcccagggg aacaacagaa 901 gcggaagatc gtcctggacc cttcaggctc catgaacatc tacctggtgc tagatggatc 961 agacagcatt ggggccagca acttcacagg agccaaaaag tgtctagtca acttaattga 1021 gaaggtggca agttatggtg tgaagccaag atatggtcta gtgacatatgccacataccc 1081 caaaatttgg gtcaaagtgt ctgaagcaga cagcagtaat gcagactgggtcacgaagca 1141 gctcaatgaa atcaattatg aagaccacaa gttgaagtca gggactaacaccaagaaggc 1201 cctccaggca gtgtacagca tgatgagctg gccagatgac gtccctcctgaaggctggaa 1261 ccgcacccgc catgtcatca tcctcatgac tgatggattg cacaacatgggcggggaccc 1321 aattactgtc attgatgaga tccgggactt gctatacatt ggcaaggatcgcaaaaaccc 1381 aagggaggat tatctggatg tctatgtgtt tggggtcggg cctttggtgaaccaagtgaa 1441 catcaatgct ttggcttcca agaaagacaa tgagcaacat gtgttcaaagtcaaggatat 1501 ggaaaacctg gaagatgttt tctaccaaat gatcgatgaa agccagtctctgagtctctg 1561 tggcatggtt tgggaacaca ggaagggtac cgattaccac aagcaaccatggcaggccaa 1621 gatctcagtc attcgccctt caaagggaca cgagagctgt atgggggctgtggtgtctga 1681 gtactttgtg ctgacagcag cacattgttt cactgtggat gacaaggaacactcaatcaa 1741 ggtcagcgta ggaggggaga agcgggacct ggagatagaa gtagtcctatttcaccccaa 1801 ctacaacatt aatgggaaaa aagaagcagg aattcctgaa ttttatgactatgacgttgc 1861 cctgatcaag ctcaagaata agctgaaata tggccagact atcaggcccatttgtctccc 1921 ctgcaccgag ggaacaactc gagctttgag gcttcctcca actaccacttgccagcaaca 1981 aaaggaagag ctgctccctg cacaggatat caaagctctg tttgtgtctgaggaggagaa 2041 aaagctgact cggaaggagg tctacatcaa gaatggggat aagaaaggcagctgtgagag 2101 agatgctcaa tatgccccag gctatgacaa agtcaaggac atctcagaggtggtcacccc 2161 tcggttcctt tgtactggag gagtgagtcc ctatgctgac cccaatacttgcagaggtga 2221 ttctggcggc cccttgatag ttcacaagag aagtcgtttc attcaagttggtgtaatcag 2281 ctggggagta gtggatgtct gcaaaaacca gaagcggcaa aagcaggtacctgctcacgc 2341 ccgagacttt cacatcaacc tctttcaagt gctgccctgg ctgaaggagaaactccaaga 2401 tgaggatttg ggttttctat aaggggtttc ctgctggaca ggggcgtgggattgaattaa 2461 aacagctgcg acaaca As defined herein, an antisense sequence is designed to target the CFB gene at a given location, such that the 5′ terminal nucleotide of the antisense is aligned 21 nucleotides downstream (towards the 3′ end) of that location on the gene when it pairs with a base of that gene. For example, as shown in Tables 1 and 2, an antisense sequence designed to target the CFB gene at position 1667 requires that the 5′ terminal nucleotide of the antisense is aligned with position 1687 of the CFB gene when it pairs with a base of that gene.

[0125] As provided herein, CFB RNAi agents do not require the nucleotides at position 1 (5′ → 3′) of the antisense strand to be complementary to the gene, provided that the antisense strand has at least 85% complementarity with the gene over a core segment sequence of at least 15 consecutive nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). For example, for the CFB RNAi agent disclosed herein designed to target position 307 of the CFB gene, the 5′ terminal nucleotide of the antisense strand of the CFB RNAi agent must be aligned with position 325 of the gene; however, the 5′ terminal nucleotide of the antisense strand may, but is not required to, be complementary to position 325 of the CFB gene, provided that the antisense strand has at least 85% complementarity with the gene over a core segment sequence of at least 15 consecutive nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). In particular, as illustrated in the embodiments disclosed herein and as is known in the art, the specific site at which the antisense strand of the CFB RNAi agent binds to the gene (e.g., regardless of whether the CFB RNAi agent is designed to target the CFB gene at position 325, position 1667, position 2399, or some other position) is crucial to the inhibitory level achieved by the CFB RNAi agent and the toxicity profile of the molecule. (See, for example, Kamola et al.) PLOS Computational Biology 2015;11(12), Figure 1).

[0126] In some embodiments, the CFB RNAi agents disclosed herein target the CFB gene at or near the location of the CFB gene sequence shown in Table 1. In some embodiments, the antisense strand of the CFB RNAi agents disclosed herein includes a core segment sequence that is completely, substantially, or at least partially complementary to the target CFB 19mer sequence disclosed in Table 1.

[0127] Table 1. CFB 19-mer mRNA target sequence (derived from Homo sapiens complement factor B (CFB), mRNA, GenBank NM_001710.6 (SEQ ID NO:1)) In some embodiments, the CFB RNAi agent includes an antisense strand, wherein position 19 (5′→3′) of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1.

[0128] In some embodiments, the CFB RNAi agent includes an antisense strand, wherein position 2 (5′ → 3′) of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the CFB RNAi agent includes an antisense strand, wherein positions 2 to 18 (5′ → 3′) of the antisense strand are capable of forming base pairs with the respective complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0129] For the RNAi agents disclosed herein, the nucleotide at position 1 (from the 5′ end to the 3′ end) of the antisense strand may or may not be complementary to the CFB gene. In some embodiments, the nucleotide at position 1 (from the 5′ end to the 3′ end) of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (from the 5′ end to the 3′ end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0130] In some embodiments, the CFB RNAi antisense strand comprises nucleotides (from 5′ to 3′) 2-18, 2-19, 2-20, or 2-21 of any antisense strand sequence in Tables 2, 3, or 5C. In some embodiments, the CFB RNAi sense strand comprises nucleotides (from 5′ to 3′) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Tables 2, 4A, 4B, or 5C.

[0131] In some embodiments, the CFB RNAi agent antisense strand comprises nucleotides (from 5′ to 3′) 2-18, 2-19, 2-20, or 2-21 of any antisense strand sequence from Tables 2, 3, or 5C. In some embodiments, the CFB RNAi sense strand comprises nucleotides (from 5′ to 3′) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence from Tables 2, 4A, 4B, or 5C.

[0132] In some embodiments, the CFB RNAi agent comprises: (i) an antisense strand containing nucleotides (from 5′ to 3′) of 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand containing nucleotides (from 5′ to 3′) of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Table 2 or Table 4A or Table 4B.

[0133] In some embodiments, the CFB RNAi agent comprises: (i) an antisense strand containing nucleotides (from 5′ to 3′) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand containing nucleotides (from 5′ to 3′) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Table 2 or Table 4A or Table 4B.

[0134] In some implementations, the CFB RNAi agent includes the core 19-mer nucleotide sequence shown in Table 2 below.

[0135] Table 2. Core sequence of antisense and sense strands of CFB RNAi agents (N = any nucleobase;) The sense and antisense strands of a CFB RNAi agent containing or composed of sequences from Table 2 can be modified or unmodified nucleotides. In some embodiments, a CFB RNAi agent having sense and antisense strand sequences containing or composed of sequences from Table 2 is wholly or substantially entirely composed of modified nucleotides.

[0136] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0137] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases not complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases different from the N nucleotides at the corresponding positions on the other strand.

[0138] The antisense strands of certain modified CFB RNAi agents, along with their underlying unmodified nucleotide sequences, are provided in Table 3. The sense strands of certain modified CFB RNAi agents, along with their underlying unmodified nucleotide sequences, are provided in Table 4A or Table 4B. In the formation of CFB RNAi agents, each nucleotide in each underlying sequence listed in Tables 3 and 4A and 4B above, as well as in Table 2, can be a modified nucleotide.

[0139] The CFB RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4A, or Table 4B can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have regions with at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0140] In some implementations, the antisense strand of the CFB RNAi agent contains a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0141] In some embodiments, the CFB RNAi agent comprises or is composed of a duplex having, or is composed of, a sense and antisense nucleobase sequence having any of the sequences in Tables 2, 3, 4A, or 4B. In some embodiments, the CFB RNAi agent comprises or is composed of a duplex sequence prepared or provided as a sodium salt, mixed salt, or free acid.

[0142] Examples of antisense strands containing modified nucleotides are provided in Tables 3 and 5C. Examples of sense strands containing modified nucleotides are provided in Tables 4A, 4B, and 5C.

[0143] As used in Tables 3, 4A, 4B, and 5C, the following symbols are used to represent modified nucleotides and linker groups: A = adenosine-3′-phosphate; C = cytidine-3′-phosphate; G = guanosine-3′-phosphate; U = uridine-3′-phosphate I = Inosine-3′-phosphate a = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-thiophosphate ass = 2′-O-methyladenosine-3′-dithiophosphate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-thiophosphate CSS = 2′-O-methylcytidine-3′-dithiophosphate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-thiophosphate GSS = 2′-O-methylguanosine-3′-dithiophosphate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-thiophosphate tss = 2′-O-methyl-5-methyluridine-3′-dithiophosphate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-thiophosphate uss = 2′-O-methyluridine-3′-dithiophosphate i = 2′-O-methylinosine-3′-phosphate is = 2′-O-methylinosine-3′-thiophosphate iss = 2′-O-methylinosine-3′-dithiophosphate Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-thiophosphate Cf = 2′-Fluorocytidine-3′-phosphate Cfs = 2′-Fluorocytidine-3′-Thiophosphate Gf = 2′-Fluoroguanosine-3′-phosphate Gfs = 2′-Fluoroguanosine-3′-Thiophosphate Tf = 2′-fluoro-5′-methyluridine-3′-phosphate Tfs = 2′-fluoro-5′-methyluridine-3′-thiophosphate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-thiophosphate dA = 2′-deoxyadenosine-3′-phosphate dAs = 2′-deoxyadenosine-3′-thiophosphate dAss = 2′-deoxyadenosine-3′-dithiophosphate dC = 2′-deoxycytidine-3′-phosphate dCs = 2′-deoxycytidine-3′-thiophosphate dCss = 2′-deoxycytidine-3′-dithiophosphate dG = 2′-deoxyguanosine-3′-phosphate dGs = 2′-deoxyguanosine-3′-thiophosphate dGss = 2′-deoxyguanosine-3′-dithiophosphate dT = 2′-deoxy-5-methyluridine-3′-phosphate (or 2′-O-deoxythymidine-3′-phosphate) dTs = 2′-deoxy-5-methyluridine-3′-thiophosphate (or 2′-O-deoxythymidine-3′-thiophosphate) dTss = 2′-deoxy-5-methyluridine-3′-dithiophosphate (or 2′-O-deoxythymidine-3′-dithiophosphate) A UNA = 2′,3′-open-cyclic adenosine-3′-phosphate (see Table 6) A UNA s = 2′,3′-open-chain adenosine-3′-thiophosphate (see Table 6) C UNA = 2′,3′-open-cytidine-3′-phosphate (see Table 6) C UNA s = 2′,3′-open-cytidine-3′-thiophosphate (see Table 6) G UNA = 2′,3′-Octopyguanosine-3′-phosphate (see Table 6) G UNA s = 2′,3′-open-ring guanosine-3′-thiophosphate (see Table 6) U UNA = 2′,3′-open-ring uridine-3′-phosphate (see Table 6) U UNA s = 2′,3′-open-ring guanosine-3′-thiophosphate (see Table 6) a_2N = 2′-O-methyl-2-aminoadenosine-3′-phosphate (see Table 6) a_2Ns = 2′-O-methyl-2-aminoadenosine-3′-thiophosphate (see Table 6) (invdA) = reverse (3'-3' linkage) 2′-deoxyadenosine (see Table 6) (invAb) = reverse debasing deoxyribonucleotide (see Table 6) (invAb)s = reverse debasing deoxyribonucleotide-5′-thiophosphate (see Table 6) cPrpa = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-phosphate (see Table 6) cPrpas = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-thiophosphate (see Table 6) cPrpu = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-phosphate (see Table 6) cPrpus = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-thiophosphate (see Table 6) NAG37 = See Table 6 NAG37s = See Table 6 As will be readily understood by those skilled in the art, unless otherwise specified in the sequence (e.g., via a thiophosphate linking "s"), when present in oligonucleotides, nucleotide monomers are linked to each other via 5′-3′-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, the inclusion of thiophosphate links replaces the phosphodiester links typically present in oligonucleotides. Furthermore, as will be readily understood by those skilled in the art, the terminal nucleotide at the 3′ end of a given oligonucleotide sequence in vitro will typically have a hydroxyl group (-OH) at the corresponding 3′ position of the given monomer, rather than a phosphate ester moiety. Additionally, for the embodiments disclosed herein, when considering the 5′→3′ of the corresponding chain, a reverse debasement residue is inserted such that the 3′ position of the deoxyribose is linked at the 3′ end of the preceding monomer on the corresponding chain (see, for example, Table 6). Furthermore, as will be readily understood and appreciated by those skilled in the art, while the chemical structures of thiophosphates described herein generally show anions on sulfur atoms, the invention disclosed herein covers all thiophosphate tautomers and resonance structures (e.g., cases where the sulfur atom has a double bond and the anion is on an oxygen atom). Unless otherwise expressly stated herein, such understanding by those skilled in the art is used in describing the CFB RNAi agents and compositions thereof disclosed herein.

[0144] Examples of targeting ligands, targeting groups, and linker groups for use with the CFB RNAi agents disclosed herein are provided in Table 6 below. More specifically, the targeting groups and linker groups (which together form a targeting ligand) include (NAG37) and (NAG37)s, the chemical structures of which are provided in Table 6 below. Each sense strand and / or antisense strand may have any of the targeting ligands, targeting groups, or linker groups listed herein, as well as other groups, conjugated to the 5′ and / or 3′ ends of the sequence.

[0145] Table 3. Antisense strand sequences of CFB RNAi agents Table 4A. Sense sequences of CFB RNAi agents Table 4B. Sense strand sequences of CFB RNAi agents (targeting ligand and reverse debasement cap not shown). The CFB RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4A, Table 4B, or Table 5C can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5C, provided that the two sequences have regions with at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0146] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any antisense strand sequence in Table 3 or Table 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any sense strand sequence in Table 4A, Table 4B, or Table 5C by 0, 1, 2, or 3 nucleotides.

[0147] In some embodiments, the CFB RNAi agent antisense strand comprises a nucleotide sequence of any sequence in Table 2, Table 3, or Table 5C. In some embodiments, the CFB RNAi agent antisense strand comprises a sequence of nucleotides (from 5′ to 3′) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 in Table 2, Table 3, or Table 5C. In some embodiments, the CFB RNAi agent antisense strand comprises or consists of a modified sequence of any of the modified sequences in Table 3 or Table 5C.

[0148] In some embodiments, the sense strand of the CFB RNAi agent comprises a nucleotide sequence of any sequence in Table 2, Table 4A, Table 4B, or Table 5C. In some embodiments, the sense strand of the CFB RNAi agent comprises nucleotide sequences (from 5′ to 3′) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 in Table 2, Table 4A, Table 4B, or Table 5C. In some embodiments, the sense strand of the CFB RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Table 4A, Table 4B, or Table 5C.

[0149] For the CFB RNAi agents disclosed herein, the nucleotide at position 1 (5′ → 3′) of the antisense strand may or may not be complementary to the CFB gene. In some embodiments, the nucleotide at position 1 (5′ → 3′) of the antisense strand is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 (5′ → 3′) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0150] A sense strand containing sequences listed in Tables 2, 4A, 4B, or 5C may hybridize with any antisense strand containing sequences listed in Tables 2, 3, or 5C, provided that the two sequences have regions of at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences. In some embodiments, the CFB RNAi agent has a sense strand consisting of a modified sequence of any modified sequence from Tables 4A, 4B, or 5C, and an antisense strand consisting of a modified sequence of any modified sequence from Tables 3 or 5C. Some representative sequence pairings are illustrated by the duplex ID numbers shown in Tables 5A, 5B, and 5C.

[0151] In some embodiments, the CFB RNAi agent comprises, consists of, or is substantially composed of a duplex represented by any of the duplex IDs provided herein. In some embodiments, the CFB RNAi agent comprises the sense and antisense nucleotide sequences of any duplex represented by any duplex ID number provided herein. In some embodiments, the CFB RNAi agent comprises the sense and antisense nucleotide sequences of any duplex represented by any duplex ID number provided herein, and a targeting group and / or a linker group, wherein the targeting group and / or linker group is covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the CFB RNAi agent comprises modified sense and antisense nucleotide sequences of any duplex ID number provided herein. In some embodiments, the CFB RNAi agent comprises modified sense and antisense nucleotide sequences of any duplex ID number provided herein, and a targeting group and / or a linker group, wherein the targeting group and / or linker group is covalently linked to the sense or antisense strand.

[0152] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand of a nucleotide sequence having any antisense / sense duplex as shown in Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or targeting ligand. In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand of a nucleotide sequence having any antisense / sense duplex as shown in Table 2 or Tables 5A, 5B, and 5C, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0153] The targeting group (with or without a linker) may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, or 5C. The linker (with or without a targeting group) may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, and 5C.

[0154] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex as shown in Table 2 or Tables 5A, 5B and 5C, and further comprises a targeting ligand selected from (NAG37) and (NAG37)s, each as defined in Table 6.

[0155] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having any of the antisense strand and / or sense strand nucleotide sequences in Table 3, Table 4A, or Table 4B.

[0156] In some embodiments, the CFB RNAi agent comprises a modified nucleotide sequence of any antisense and / or sense strand having any double strand of any antisense and / or sense strand nucleotide sequence in Tables 5A, 5B, and 5C, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0157] In some implementations, the CFB RNAi agent comprises, consists of, or is substantially composed of any of the duplexes in Tables 5A, 5B, and 5C.

[0158] Table 5A. CFB RNAi agent duplexes with corresponding sense and antisense strand ID numbers and sequence ID numbers of modified and unmodified nucleotide sequences.

[0159] Table 5B. CFB RNAi agent duplexes with corresponding sense and antisense strand IDs corresponding to the target location on the CFB gene (SEQ ID NO:1). Table 5C. CFB RNAi agent duplexes showing chemically modified antisense and sense strand sequences. In some embodiments, the CFB RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the CFB RNAi agent is prepared or provided as a pharmaceutically acceptable salt, such as a sodium or potassium salt. In some embodiments, the CFB RNAi agent is prepared or provided as a sodium salt. The RNAi agents described herein, upon delivery to cells expressing the CFB gene, inhibit or knock down the expression of one or more CFB genes in vivo and / or in vitro.

[0160] Targeting ligands or groups, linking groups, and delivery mediators In some embodiments, the CFB RNAi agent is conjugated to one or more nonnucleotide groups, including but not limited to targeting groups, linker groups, targeting ligands, delivery polymers, or delivery mediators. The nonnucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linker groups are provided in Table 6. The nonnucleotide groups can be covalently linked to the 3′ and / or 5′ ends of the sense and / or antisense strands. In some embodiments, the CFB RNAi agent contains a nonnucleotide group linked to the 3′ and / or 5′ end of the sense strand. In some embodiments, the nonnucleotide group is linked to the 5′ end of the sense strand of the CFB RNAi agent. The nonnucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linker group. In some embodiments, the nonnucleotide group is linked to the RNAi agent via an unstable, cleavable, or reversible bond or linker.

[0161] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0162] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi agents to which they are attached, thereby improving the cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher valence state for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0163] In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three debased and / or ribitol (debased ribose) residues (which may be used as linkers in some cases). In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.

[0164] CFB RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5′ and / or 3′ ends. Subsequently, these reactive groups can be used to attach the target moiety using methods commonly used in the art.

[0165] In some embodiments, the targeting group comprises a desialyl glycoprotein receptor ligand. As used herein, a desialyl glycoprotein receptor ligand is a ligand containing a portion having an affinity for the desialyl glycoprotein receptor. As noted herein, the desialyl glycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the desialyl glycoprotein receptor ligand comprises or is composed of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and a galactose derivative having an affinity for the desialyl glycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, and N-isobutyrylgalactosamine (see, for example: ST. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and galactose derivative clusters that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0166] Galactose derivatives have been used to target molecules to hepatocytes in vivo via their binding to desialyl glycoprotein receptors expressed on the surface of hepatocytes. Binding of desialyl glycoprotein receptor ligands to the desialyl glycoprotein receptors facilitates cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. Desialyl glycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also known as monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be attached to the 3′ or 5′ end of the sense or antisense strand of an RNAi agent using methods known in the art.

[0167] The preparation of targeted ligands (such as galactose derivative clusters) is described in, for example, international patent application publications of Arrowhead Pharmaceuticals, Inc., WO 2018 / 044350 and WO 2017 / 156012, the contents of which are incorporated herein by reference in their entirety.

[0168] As used herein, galactose derivative clusters comprise molecules having two to four terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via their C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also known as a tri-antennary galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetylgalactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetylgalactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also known as a tetra-antennary galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetylgalactosamine moieties.

[0169] The galactose derivative trimer used herein contains three galactose derivatives, each attached to a central branching point. The galactose derivative tetramer used herein contains four galactose derivatives, each attached to a central branching point. The galactose derivatives can be attached to the central branching point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are attached to the branching point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al., J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branching point can be any small molecule that allows attachment of three galactose derivatives and further allows attachment of the branching point to an RNAi agent. An example of a branching point group is dilysine or diglutamic acid. Attachment of the branching point to the RNAi agent can be achieved via a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the connector comprises a rigid connector, such as a cyclic group. In some embodiments, the galactose derivative comprises or is composed of N-acetylgalactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which may be, for example, an N-acetylgalactosamine tetramer.

[0170] Embodiments of this disclosure include pharmaceutical compositions for delivering a CFB RNAi agent to hepatocytes in vivo. Such pharmaceutical compositions may include, for example, a CFB RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises a galactose derivative trimer (which may be, for example, an N-acetylgalactosamine trimer) or a galactose derivative tetramer (which may be, for example, an N-acetylgalactosamine tetramer).

[0171] The targeting ligand or targeting group can be linked to the 3′ or 5′ end of the sense or antisense strand of the CFB RNAi agent disclosed herein.

[0172] Targeting ligands include, but are not limited to, (NAG37) and (NAG37)s as defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0173] In some embodiments, the linker group is conjugated to the RNAi agent. The linker group facilitates the covalent attachment of the agent to a target group, delivery polymer, or delivery medium. The linker group may be attached to the 3′ and / or 5′ end of the sense or antisense strand of the RNAi agent. In some embodiments, the linker group is attached to the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5′ or 3′ end of the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5′ end of the sense strand of the RNAi agent. Examples of linker groups may include, but are not limited to: reactive groups, such as primary amines and alkynes, alkyl groups, debased nucleotides, ribitols (debased ribose), and / or PEG groups.

[0174] In some embodiments, the targeting group is internally linked to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0175] A linker or connecting group is a connection between two atoms that links a chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. Unstable links contain unstable bonds. Links may optionally include spacers that increase the distance between the atoms of the two links. Spacers can further increase the flexibility and / or length of the link. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of this specification.

[0176] In some embodiments, when two or more RNAi agents are contained in a single composition, each RNAi agent may be linked to the same target group or two different target groups (i.e., target groups with different chemical structures). In some embodiments, the target group is linked to the CFB RNAi agent disclosed herein without the use of an additional adapter. In some embodiments, the target group itself is designed to have adapters or other readily available sites that facilitate conjugation. In some embodiments, when two or more CFB RNAi agents are contained in a single molecule, each RNAi agent may use the same adapter or different adapters (i.e., adapters with different chemical structures).

[0177] Any CFB RNAi agent nucleotide sequence listed in Tables 2, 3, 4A, 4B, or 5C, whether modified or unmodified, may contain a 3′ and / or 5′ targeting group or linker group. Any CFB RNAi agent sequence listed in Tables 3 or 4 or otherwise described herein containing a 3′ or 5′ targeting group or linker group may alternatively omit a 3′ or 5′ targeting group or linker group, or may contain different 3′ or 5′ targeting groups or linker groups, including but not limited to those depicted in Table 6. Any CFB RNAi agent duplex listed in Tables 5A, 5B, and 5C, whether modified or unmodified, may further contain a targeting group or linker group, including but not limited to those depicted in Table 6, and the targeting group or linker group may be attached to the 3′ or 5′ end of the sense or antisense strand of the CFB RNAi agent duplex. Examples of targeting groups and linker groups (which, when combined, form a targeting ligand) are provided in Table 6. Tables 4A, 4B, and 5C provide certain embodiments of the sense strand of CFB RNAi agents having a targeting group or linker group attached to the 5′ or 3′ end.

[0178] Table 6. Structures of various modified nucleotides, targeting ligands or targeting groups, capped residues, and linker groups. In each of the structures described in Table 6, the NAG comprises N-acetylgalactosamine. As will be understood by those skilled in the art based on the above structures and the description provided herein, for attachment purposes, in some embodiments, the NAG depicted in Table 6 above may comprise another galactose derivative with affinity for the desialylate glycoprotein receptor present on hepatocytes. Other linker groups known in the art may be used.

[0179] In some embodiments, a delivery medium can be used to deliver RNAi agents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi agents to cells or tissues. Delivery mediators can include, but are not limited to: polymers, such as amphiphilic polymers, membrane-active polymers, peptides, melittin, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines, or combinations thereof. In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to: targeting groups, lipids (including but not limited to cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or other delivery systems known and available in the art suitable for the delivery of nucleic acids or oligonucleotides.

[0180] Pharmaceutical Composition The CFB RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical composition comprises at least one CFB RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNAs in target cells, cell populations, tissues, or organisms.

[0181] The pharmaceutical composition may be used to treat subjects suffering from a disease, condition, or symptom that will benefit from a reduction in the level of target CFB mRNA or an inhibition of target gene expression. The pharmaceutical composition may also be used to treat subjects at risk of developing a disease, condition, symptom, or symptom that will benefit from a reduction in the level of target mRNA or an inhibition of target gene expression. In one embodiment, the method includes administering a CFB RNAi agent linked to a target ligand as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising a CFB RNAi agent to form a pharmaceutical formulation or drug suitable for in vivo delivery to a subject (including a human).

[0182] The pharmaceutical compositions and methods disclosed herein that contain CFB RNAi agents reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, including by administering a therapeutically effective amount of the CFB RNAi agent described herein to a subject, thereby inhibiting the expression or translation of CFB mRNA in the subject. In some implementations, the subject has been previously identified or diagnosed with IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases. In some implementations, the subject will benefit from reduced CFB gene expression in the subject's liver.

[0183] In some embodiments, the pharmaceutical composition comprising a CFB RNAi agent is used to treat or control clinical presentations associated with IgA nephropathy, C3 glomerulonephropathy, and / or paroxysmal nocturnal hemoglobinuria (PNH). Other diseases or conditions for which CFB RNAi agents may be useful include immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some implementations, administration of any disclosed CFBRNAi agent can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0184] The pharmaceutical composition comprising a CFB RNAi agent may be used to treat at least one symptom in a subject suffering from a disease or condition, who will benefit from a reduction or inhibition of CFB mRNA expression and / or a reduction in CFB protein levels and / or a reduction in complement alternative pathway activity. Measurements of CFB levels and complement alternative pathway activity may be performed according to established methods known in the art, including those described in the embodiments herein.

[0185] In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising a CFB RNAi agent is administered to a subject to treat symptoms. In other embodiments, a preventatively effective amount of one or more CFB RNAi agents is administered to a subject to prevent or suppress at least one symptom.

[0186] The route of administration is the path by which the CFB RNAi agent comes into contact with the body. Generally, methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The CFB RNAi agents disclosed herein can be administered via any suitable route, to a formulation appropriately tailored to the specific route. Therefore, the pharmaceutical compositions described herein can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0187] The pharmaceutical compositions comprising CFB RNAi agents described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) is applicable to the compositions described herein. For example, delivery can be via local administration (e.g., direct injection, implantation, or local application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, the compositions are administered via subcutaneous or intravenous infusion or injection.

[0188] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0189] The pharmaceutical compositions or drugs used herein comprise a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance intentionally included in a drug delivery system, other than the active pharmaceutical ingredient (API, therapeutic product, such as a CFB RNAi drug). Excipients do not exert or are not intended to exert a therapeutic effect at the intended dose. Excipients may function to: a) assist in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) assist in product identification; and / or d) enhance the overall safety, efficacy, or any other property of the API's delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0190] Excipients include, but are not limited to: absorption promoters, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colorants, delivery promoters, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, humectants, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, waterproofing agents, and wetting agents.

[0191] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (in the case of water solubility) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under manufacturing and storage conditions and should be protected against contamination by microorganisms such as bacteria and fungi. Carriers can be solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coatings (e.g., lecithin), in the case of dispersions by maintaining the desired particle size, and by using surfactants. In many cases, isotonic agents, such as sugars, polyols (e.g., mannitol, sorbitol), and sodium chloride, are preferably included in the composition. Prolonged absorption of injectable compositions can be caused by including substances that delay absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0192] Sterile injection solutions can be prepared by combining the desired amount of the active compound in a suitable solvent with one or a combination of the ingredients listed above (as needed), followed by sterile filtration. Typically, dispersions are prepared by incorporating the active compound into a sterile medium containing a base dispersion medium and any other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injection solutions, the preparation methods include vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any other desired ingredients from a pre-sterile filtered solution.

[0193] In some embodiments, the pharmaceutical formulations disclosed herein for subcutaneous administration containing a CFB RNAi agent can be prepared in an aqueous sodium phosphate buffer (e.g., a CFB RNAi agent formulated in an aqueous solution of 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate). In some embodiments, the pharmaceutical formulations herein for subcutaneous administration containing a CFB RNAi agent can be prepared in water for injection (sterile water). The CFB RNAi agents disclosed herein for subcutaneous administration can be prepared in isotonic saline (0.9%).

[0194] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug (which may be in microcrystalline form), such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems can also be used to deliver drugs for intra-articular and intraocular administration.

[0195] Formulations suitable for oral administration of the CFB RNAi agents disclosed herein can also be prepared. In some embodiments, the CFB RNAi agents disclosed herein are administered orally. In some embodiments, the CFB RNAi agents disclosed herein are formulated into capsules for oral administration.

[0196] The active compound can be prepared together with a carrier that protects the compound from rapid elimination from the body, such as in controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are readily apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0197] CFB RNAi agents can be formulated into compositions in unit dosage form to facilitate administration and dosage uniformity. Unit dosage form refers to physically discrete units suitable as a unit dose for use in a subject to be treated; each unit contains a predetermined amount of the active compound, which associates with a desired drug carrier to produce the expected therapeutic effect. The specifications of the unit dosage forms of this disclosure are determined and directly depended upon by the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations of the field in which such active compounds are formulated for the treatment of individuals.

[0198] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. These additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi agents as defined herein are also envisioned as potential candidates for use in “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount,” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventative effect.

[0199] In some embodiments, the methods disclosed herein, in addition to administering the RNAi agent disclosed herein, further include the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another CFB RNAi agent (e.g., a CFB RNAi agent targeting a different sequence within a CFB target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0200] In some embodiments, the CFB RNAi agent is optionally combined with one or more additional therapeutic agents. The CFB RNAi agent and the additional therapeutic agents may be administered as a single composition, or they may be administered separately. In some embodiments, one or more additional therapeutic agents are administered separately in a dosage form different from the RNAi agent (e.g., the CFB RNAi agent is administered by subcutaneous injection, while the additional therapeutic agents involved in the treatment dosing regimen are administered orally). In some embodiments, the CFB RNAi agent is administered subcutaneously to the subject in need, and one or more optional additional therapeutic agents are administered orally, collectively providing a treatment regimen for diseases and conditions associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases. In some embodiments, the CFB RNAi agent is administered to a subject in need via subcutaneous injection, and one or more optional additional therapeutic agents are administered via separate subcutaneous injections. In some embodiments, the CFB RNAi agent and one or more additional therapeutic agents are combined into a single dosage form (e.g., a "cocktail" of a single composition formulated for subcutaneous injection). The CFB RNAi agent (with or without one or more additional therapeutic agents) may be combined with one or more excipients to form a pharmaceutical composition.

[0201] Typically, the effective amount of a CFB RNAi agent is in the range of about 0.1 to about 100 mg / kg body weight per dose, for example, about 1.0 to about 50 mg / kg body weight per dose. In some embodiments, the effective amount of the active compound is in the range of about 0.25 to about 6 mg / kg body weight per dose. In some embodiments, the effective amount of the active ingredient is in the range of about 0.5 to about 5 mg / kg body weight per dose. In some embodiments, the effective amount of the CFB RNAi agent may be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of CFB RNAi agent. In some embodiments, the fixed dose is in the range of 25 to 400 mg of CFB RNAi agent. Dosing may be weekly, bi-weekly, monthly, quarterly, or at any other interval, depending on the dose of the CFB RNAi agent administered, the activity level of the specific CFB RNAi agent, and the level of inhibition required by the specific subject. The examples herein illustrate suitable levels of inhibition in certain animal species. The dosage administered will depend on variables such as the patient's or subject's overall health status, the relative biological potency of the delivered compound, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Furthermore, it should be understood that the initial dose administered may be higher than the aforementioned upper levels to rapidly achieve the desired blood or tissue levels, or the initial dose may be lower than optimal.

[0202] For the purpose of treating a disease or for the formation of a drug or composition for treating a disease, the pharmaceutical compositions comprising a CFBRNAi agent described herein may be combined with an excipient or with a second therapeutic agent or treatment, the second therapeutic agent or treatment including but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0203] The CFB RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged as kits, containers, pouches, or dispensers. The pharmaceutical compositions described herein can be packaged in pre-filled syringes, pen syringes, autoinjectors, infusion bags / devices, or vials.

[0204] In some embodiments, the CFB RNAi drug substance is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, it is in the form of a sodium salt.

[0205] In some embodiments, the CFB RNAi agent is formulated with one or more pharmaceutically acceptable excipients to form a pharmaceutical composition suitable for administration to human subjects. In some embodiments, the CFB RNAi agent described herein is formulated at 200 mg / mL in an aqueous sodium phosphate buffer (0.5 mM sodium dihydrogen phosphate, 0.5 mM disodium hydrogen phosphate) suitable for subcutaneous administration to humans.

[0206] Treatment methods and expression inhibition The CFB RNAi agent disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from diseases or conditions who will benefit from the administration of the RNAi agent. In some implementations, the RNAi agents disclosed herein may be used to treat subjects (e.g., humans) who would benefit from reduced and / or suppressed CFB mRNA expression and / or CFB protein levels, such as those diagnosed with IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's celluloid retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases or who are suffering from symptoms associated with them.

[0207] In some embodiments, a therapeutically effective amount of any one or more CFB RNAi agents is administered to the subject. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more CFB RNAi agents described herein is administered to the subject. The subject may be an adult, adolescent, child, or infant. The pharmaceutical compositions described herein may be administered to humans or animals.

[0208] The CFB RNAi agents described herein can be used to treat at least one symptom in a subject suffering from a CFB-related disease or condition, or a disease or condition at least partially mediated by CFB gene expression. In some embodiments, the CFB RNAi agents are used to treat or control the clinical presentation of a subject suffering from a disease or condition, who will benefit from or at least partially alleviate the symptoms due to a reduction in CFB mRNA or CFB protein levels and / or a decrease in alternative pathway complement activity. A therapeutically effective amount of one or more of the CFB RNAi agents described herein, or a composition containing a CFB RNAi agent, is administered to the subject. In some embodiments, the methods disclosed herein include administering a composition containing a CFB RNAi agent described herein to a subject to be treated. In some embodiments, a preventatively effective amount of any one or more of the CFB RNAi agents is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.

[0209] In some embodiments, this disclosure provides a method for treating a disease, symptom, condition, or pathological state at least partially mediated by CFB gene expression in a patient in need, wherein the method includes administering any of the CFB RNAi agents described herein to the patient.

[0210] In some embodiments, compared to subjects who had not received CFB RNAi, the gene expression level and / or mRNA level of the CFB gene in subjects receiving the CFB RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The CFB mRNA level in the subjects may be reduced in the subjects' cells, cell populations, and / or tissues. In some embodiments, compared to subjects who had not received CFB RNAi, CFB gene expression in hepatocytes is suppressed by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65%.

[0211] In some embodiments, compared to subjects who had not received the CFB RNAi agent or who had not received the CFB RNAi agent, subjects who received the CFB RNAi agent showed a reduction in CFB protein levels of at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The protein levels in the subjects may be reduced in their cells, cell populations, tissues, blood, and / or other bodily fluids.

[0212] Decreases in CFB mRNA and CFB protein levels can be assessed by any method known in the art. As used herein, a decrease or reduction in CFB mRNA and / or protein levels is collectively referred to herein as a decrease or reduction in CFB, or inhibition or reduction of CFB gene expression. The examples shown herein illustrate known methods for assessing CFB gene expression inhibition. Those skilled in the art will further understand suitable methods for assessing CFB gene expression inhibition in vivo and / or in vitro.

[0213] In some implementations, compared to subjects who had not received CFB RNAi or who had not received CFB RNAi, subjects who received the CFB RNAi showed a reduction in alternative pathway complement activity of at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Protein levels in the subjects may also be reduced in their cells, cell populations, tissues, blood, and / or other bodily fluids.

[0214] In some implementations, this document discloses methods for treating (including prophylactic or preventative) diseases, conditions, or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., (2016, Casiraghi et al., 2017, Wong and Kavanaugh, 2018, Holers and Banda, 2018, Poppeelaars and Thurman, 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander, 2024), wherein the method comprises administering a therapeutically effective amount of a CFB RNAi agent to a subject in need, said CFB RNAi agent comprising an antisense strand at least partially complementary to a portion of a CFB mRNA having the sequences in Table 1.In some implementations, this document discloses methods for treating (including prophylactic or preventative) diseases or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., (2016, Casiraghi et al., 2017, Wong and Kavanaugh, 2018, Holers and Banda, 2018, Poppeelaars and Thurman, 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander, 2024), wherein the method comprises administering a therapeutically effective amount of a CFB RNAi agent to a subject in need, said CFB RNAi agent comprising an antisense strand containing any sequence of Table 2, 3 or 5C, and a sense strand containing any sequence of Table 2, 4 or 5C, said sense strand being at least partially complementary to the antisense strand.In some implementations, this document discloses methods for treating (including prophylactic or preventative) diseases or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al., (2017, Wong and Kavanaugh, 2018, Holers and Banda, 2018, Poppeelaars and Thurman, 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander, 2024), wherein the method comprises administering a therapeutically effective amount of a CFB RNAi agent to a subject in need, said CFB RNAi agent comprising a sense strand comprising any sequence in Tables 2, 4A, 4B or 5C and an antisense strand comprising any sequence in Tables 2, 3 or 5C, said antisense strand being at least partially complementary to the sense strand.

[0215] In some embodiments, this document discloses a method for inhibiting CFB gene expression in cells, wherein the method includes administering a CFB RNAi agent to cells, the CFB RNAi agent comprising an antisense strand at least partially complementary to a portion of a CFB mRNA having sequences in Table 1. In some embodiments, this document discloses a method for inhibiting CFB gene expression in cells, wherein the method includes administering a CFB RNAi agent to cells, the CFB RNAi agent comprising an antisense strand comprising a sequence comprising any sequence in Tables 2, 3, or 5C and a sense strand comprising any sequence in Tables 2, 4A, 4B, or 5C, the sense strand being at least partially complementary to the antisense strand. In some embodiments, this document discloses a method for inhibiting CFB gene expression in cells, wherein the method includes administering a CFB RNAi agent comprising a sense strand comprising any sequence in Tables 2, 4A, 4B, or 5C and an antisense strand comprising any sequence in Tables 2, 3, or 5C, the antisense strand being at least partially complementary to the sense strand.

[0216] The use of CFB RNAi agents provides a means of therapeutic (including prophylactic) treatment for diseases / conditions associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al., (2017, Wong and Kavanaugh, 2018, Holers and Banda, 2018, Poppeelaars and Thurman, 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander, 2024). The CFBRNAi agents mediate RNA interference to suppress the expression of one or more genes necessary for the production of CFB proteins. CFB RNAi agents can also be used to treat or prevent a variety of diseases, conditions, or illnesses, including IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al., 2017, Wong and Kavanaugh, 2018, Holers and Banda). 2018, Poppelaars and Thurman 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe and Gregory-Ksander 2024).Furthermore, compositions for in vivo delivery of CFB RNAi agents to liver cells, particularly hepatocytes, are described.

[0217] Cells, tissues, organs and non-human objects Cells, tissues, organs, and non-human objects containing at least one of the CFB RNAi agents described herein are considered. Cells, tissues, organs, or non-human objects are prepared by delivering an RNAi agent to the cell, tissue, organ, or non-human object.

[0218] The above-described implementation schemes and projects are now illustrated by the following non-limiting examples.

[0219] Example Example 1. Synthesis of CFB RNAi agents. The CFB RNAi agent duplexes shown in Tables 5A, 5B, and 5C are synthesized according to the following general procedure: A. Synthesis. The sense and antisense strands of the RNAi agent were synthesized using a solid-phase phosphoramidite technique employed in oligonucleotide synthesis. Such standard synthesis is generally known in the art. Depending on scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. Synthesis was performed on a solid support made of controlled-aperture glass (CPG, 500 Å or 600 Å, available from Prime Synthesis, Aston, PA, USA). The monomer located at the 3′ end of the respective strand was attached to the solid support as the starting point for synthesis. All RNA and 2′-modified RNA phosphoramidite were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2′-O-methylphosphoramidite comprised the following: (5′-O-dimethoxytriphenylmethyl-N 6 -(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide), 5′-O-dimethoxytriphenylmethyl-N 4 -(acetyl)-2′-O-methylcytidine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, (5′-O-dimethoxytriphenylmethyl-N 2-(isobutyryl)-2′-O-methylguanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide and 5′-O-dimethoxytriphenylmethyl-2′-O-methyluridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2′-deoxy-2′-fluorophosphamide has the same protecting group as 2′-O-methylphosphamide. 5′-(4,4′-dimethoxytriphenylmethyl)-2′,3′-open-ring uridine and 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide were also available from Thermo Fisher Scientific or Hongene Biotech. 5′-Dimethoxytriphenylmethyl-2′-O-methylinosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramide was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). Reverse debasing (3′-O-dimethoxytriphenylmethyl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide) was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5′-O-dimethoxytriphenylmethyl-N 2 N 6 -(phenoxyacetic acid ester)-2′-O-methyldiaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was obtained from ChemGenes or Hongene Biotech.

[0220] The phosphorus amide containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other phosphorus amides were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and a molecular sieve (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activating agent solution. Ligation times were 12 min (RNA), 15 min (targeting ligand), 90 s (2′ OMe), and 60 s (2′ F). To introduce thiophosphate ligation, a solution of 100 mM 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. In the following examples, each of the CFBRNAi agent duplexes synthesized and tested used N-acetylgalactosamine as “NAG” in the target ligand chemical structures shown in Table 6. The (NAG37) and (NAG37)s target ligand phosphoramidide compounds can be generally synthesized according to International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc.

[0221] B. Cleavage and deprotection of support-bound oligomers. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume-volume solution of 40% wt% methylamine in water and a 28% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0222] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13µm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was identical to buffer A but with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and then run on size-resistance HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G25 fines. The run buffer was either filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0223] D. Annealing. The complementary strands were mixed to form an RNAi agent by mixing equimolar amounts of RNA solution (sense and antisense) in 1× phosphate-buffered saline (Corning, Cellgro). A portion of the RNAi agent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1× phosphate-buffered saline on a UV-Vis spectrophotometer. The absorbance at 260 nm was then multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL∙cm), or calculated from experimentally determined extinction coefficients.

[0224] Example 2. hCFB-SEAP mouse model. To evaluate the efficacy of certain RNAi agents, the hCFB-SEAP mouse model was used. Female C57BL / 6 albino mice aged 6 to 8 weeks were transiently transfected in vivo with the plasmid via fluid-dynamic tail vein injection, at least 15 days prior to administration of the CFB RNAi agent or control. The plasmid contained a human CFB sequence (GenBank NM_001710.6 (SEQ ID NO: 1)) with an insertion into the 3'UTR of the SEAP (secretory human placental alkaline phosphatase) reporter gene. CFB-SEAP mouse models were established by tail vein injection of 10 µg to 50 µg of the plasmid containing the CFB gene sequence in Ringer's solution, representing 10% of the animal's total body weight. As previously described, the solution was injected over 5–7 seconds using a 27-gauge needle (Zhang G et al., “Highlevels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy, 1999, Vol. 10, pp. 1735–1737). Inhibition of CFB sequence expression by the CFBRNAi agent resulted in simultaneous inhibition of SEAP expression, which was measured using the Phospha-Light™ SEAP reporter gene detection system (Invitrogen). Serum SEAP expression levels were measured prior to treatment, and mice were grouped according to mean SEAP levels.

[0225] Analysis SEAP levels can be measured at different times before and after administration of CFB RNAi agents.

[0226] i) Serum collectionMice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region and placed in a serum separation tube (Sarstedt AG&Co., Nümbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 minutes. The tube was then centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C.

[0227] ii) Serum SEAP levels Serum was collected and measured using the Phospha-Light™ SEAP Reporter Detection System (Invitrogen) according to the manufacturer's instructions. Serum SEAP levels for each animal were normalized relative to the saline-injected mouse control group to account for treatment-independent decreases in CFB sequence expression in the model. First, the expression ratio "normalized relative to pre-treatment" was determined by dividing the SEAP level of each animal at a given time point by the animal's pre-treatment expression level ("pre-treatment"). Expression at a specific time point can be normalized relative to the control group by dividing the ratio of a single animal's "normalized relative to pre-treatment" by the average ratio of all mice in the saline control group. Alternatively, serum SEAP levels for each animal can be assessed by normalizing only relative to pre-treatment levels.

[0228] Example 3. In vivo testing of CFB RNAi agents in hCFB-SEAP mice. The hCFB-SEAP mouse model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6 albino mice were given a single subcutaneous (SQ) injection of 200 μl / 20 g body weight containing 3.0 mg / kg (mpk) of CFB RNAi agent, or saline without CFB RNAi agent as a control, according to Table 7 below.

[0229] Table 7. CFB RNAi agent and administration in Example 3 Each CFB RNAi agent contains an N-acetylgalactosamine targeting ligand ((NAG37)s) conjugated to the 5′ end of the sense strand, as shown in Tables 5A, 5B, 5C and 6, and is added as a phosphoramidite compound during the oligonucleotide synthesis process described in Example 1 above.

[0230] The CFB RNAi agents in groups 2-15 each contain a nucleotide sequence designed to inhibit CFB gene expression by targeting specific sites on the CFB mRNA as listed in Table 5B above. (For the referenced CFB mRNA sequences, see, for example, SEQ ID NO:1 and Table 2). Specifically, group 2 (AD12521) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 992; group 3 (AD12524) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 495; group 4 (AD12525) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 778; group 5 (AD12526) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 781; group 6 (AD12527) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 784; group 7 (AD12528) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 845; group 8... Group 9 (AD12529) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 927; Group 10 (AD12530) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 934; Group 11 (AD12532) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 954; Group 12 (AD12533) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 990; Group 13 (AD12533) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 990; Group 14 (AD12533) contains a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 990; Group 15 ... Group 13 (AD12533) includes a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 1019; Group 14 (AD12535) includes a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 1030; Group 15 (AD12536) includes a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 1206; and Group 16 (AD12537) includes a nucleotide sequence designed to suppress the expression of the CFB gene transcript at position 1315.

[0231] The injection was administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Serum was collected on days 8, 15, and 22, and SEAP expression levels were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 8 below, where mean SEAP reflects the normalized mean of SEAP.

[0232] Table 8. Normalized mean SEAP relative to pre-treatment and saline control in CFB-SEAP mice from Example 3. As shown above, the tested groups of CFB RNAi agents showed little to no inhibition. On day 8, group 8 (AD12529, targeting CFB gene position 927) showed the greatest reduction in SEAP compared to the saline control group (group 1), with a reduction of approximately 41% (0.589). On day 22, in this hCFB-SEAP mouse model, groups 11 (AD12532, targeting CFB gene position 990) and 15 (AD12536, targeting CFB gene position 1315) showed reductions of approximately 51% (0.486) and 43% (0.526), ​​respectively.

[0233] Example 4. In vivo testing of CFB RNAi agents in hCFB-SEAP mice. The hCFB-SEAP mouse model described in Example 2 above was used. On day 1, four (n=4) female C57bl / 6 albino mice were given a single subcutaneous (SQ) injection of 200 μl / 20 g body weight containing 3.0 mg / kg (mpk) of CFB RNAi agent, or saline without CFB RNAi agent as a control, according to Table 9 below.

[0234] Table 9. CFB RNAi agent and administration in Example 3 Each CFB RNAi agent contains an N-acetylgalactosamine targeting ligand ((NAG37)s) conjugated to the 5′ end of the sense strand, as shown in Tables 5A, 5B, 5C and 6, and is added as a phosphoramidite compound during the oligonucleotide synthesis process described in Example 1 above.

[0235] Each CFB RNAi agent in groups 2-13 contains nucleotide sequences designed to inhibit CFB gene expression by targeting position 1315 of the CFB mRNA listed in Table 5B above, but with different chemical modifications applied. (For the referenced CFB mRNA sequences, see, for example, SEQ ID NO:1 and Table 2).

[0236] The injection was administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Serum was collected on days 8 and 15, and SEAP expression levels were determined according to the procedure described in Example 2 above. The experimental data are shown in Table 10 below, where mean SEAP reflects the normalized mean of SEAP.

[0237] Table 10. Mean SEAP normalized relative to pre-treatment and saline control in CFB-SEAP mice from Example 3.

[0238] As shown above, each CFB RNAi agent tested in the hCFB-SEAP mouse model was active, with silencing activity ranging from approximately 30% to approximately 58%.

[0239] Example 5. In vivo testing of CFB RNAi agents in wild-type mice. Some CFB RNAi agents share sufficient homology with mouse CFB gene transcripts, making them suitable for testing CFB gene expression repression activity in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were administered a single subcutaneous dose of 200 μl / 20 g body weight containing either a CFB RNAi agent or a mediator control (isotonic saline without RNAi agent) at 2.0 mg / kg (mpk) in isotonic saline, according to Table 11 below.

[0240] Table 11. Target location and administration group in Example 5 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 11 above, the CFB RNAi agents of groups 2–14 each contain nucleotide sequences designed to inhibit human CFB gene expression at a specific site, and these nucleotide sequences are also homologous to the mouse CFB gene transcript. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0241] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 8 of the study, and total RNA was isolated from both livers and eyes after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0242] Table 12. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 8) in Example 5 Data were normalized relative to the isotonic saline treatment group (Group 1). As shown in Table 12 above, each CFB RNAi agent (Groups 2–14) showed a reduction in mCFB mRNA in the liver. In particular, Group 10 (AD12088, targeting CFB gene position 1667) and Group 14 (AD12096, targeting CFB gene position 2399) showed particularly robust inhibition of mCFB mRNA on day 8, achieving approximately 70% or higher silencing activity in the liver (~70% (0.305) and ~79% (0.213) respectively) and the eye (~73% (0.268) and ~77% (0.227) respectively).

[0243] For some of the CFB RNAi agents tested, liver samples were reanalyzed to confirm the consistency of the knockdown data, as shown in Table 14 below: Table 14. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 8) in Example 5 (second run) The data in Table 14 are consistent with those in Table 12. The CFB RNAi agents in Group 10 (AD12088, targeting CFB gene position 1667) and Group 14 (AD012096, targeting CFB gene position 2399) showed particularly robust CFB gene expression inhibition activity, while the RNAi agent in Group 4 (AD12082, targeting CFB gene position 938) showed no inhibition compared to the saline control.

[0244] Example 6. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 1.0 mg / kg (mpk) of CFB RNAi agent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi agent), according to Table 15 below.

[0245] Table 15. Target sites and drug administration groups in Example 6 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 15 above, the CFB RNAi agents in groups 2–17 each comprise a nucleotide sequence designed to repress human CFB gene expression at position 2399 of the CFB gene, which is also homologous to the mouse CFB gene transcript but with different chemical modifications. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0246] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the site of loose skin in the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0247] Table 16. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 6 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 16 above, each CFB RNAi agent (Groups 2-17) (all targeting CFB gene position 2399) showed a significant reduction in liver mCFB mRNA, with all CFB RNAi agents showing ~50% or higher knockdown, and the most potent CFB RNAi agent showing ~75% mCFB mRNA knockdown on day 15.

[0248] Example 7. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 1.0 mg / kg (mpk) of CFB RNAi agent in isotonic saline, or a mediator control (isotonic saline without RNAi agent), according to Table 17 below.

[0249] Table 17. Target sites and drug administration groups in Example 7 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 17 above, the CFB RNAi agents in groups 2–17 each comprise a nucleotide sequence designed to repress human CFB gene expression at position 1667 of the CFB gene, which is also homologous to the mouse CFB gene transcript but with different chemical modifications. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0250] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the site of loose skin in the neck and shoulder region. Four (4) mice were tested in each group (n=4), except for groups 8 (AD12555) and 15 (AD12562), in which only three mice (n=3) were tested in these two groups. Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0251] Table 18. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 7 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 18 above, except for Group 2 (AD12088), each CFB RNAi agent (all targeting CFB gene position 1667) showed a significant reduction in liver mCFB mRNA (except Group 10). All CFB RNAi agents in Groups 3–17 showed ~50% or higher knockdown, with the most effective CFB RNAi agent showing approximately 80% mCFB mRNA knockdown on day 15 (see, for example, Group 4 (AD12551, showing ~72% knockdown (0.274)), Group 5 (AD12552, showing ~80% knockdown (0.206)), Group 12 (AD12559, showing ~73% knockdown (0.266)), etc.).

[0252] Example 8. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 0.5 mg / kg (mpk) of CFB RNAi agent in isotonic saline, or a mediator control (isotonic saline without RNAi agent), according to Table 19 below.

[0253] Table 19. Target location and administration group in Example 8 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 19 above, the CFB RNAi agents in groups 2–15 each comprise a nucleotide sequence designed to repress human CFB gene expression at position 2399 of the CFB gene, which is also homologous to the mouse CFB gene transcript but with different chemical modifications. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0254] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0255] Table 20. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 8 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 20 above, each CFB RNAi agent (all targeting position 2399 of the CFB gene) showed a reduction in mCFB mRNA in the liver.

[0256] Example 9. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 0.5 mg / kg (mpk) of CFB RNAi agent in isotonic saline, or a mediator control (isotonic saline without RNAi agent), according to Table 21 below.

[0257] Table 21. Target location and administration group in Example 9 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 21 above, the CFB RNAi agents in groups 2–17 each comprise a nucleotide sequence designed to repress human CFB gene expression at position 1667 of the CFB gene, which is also homologous to the mouse CFB gene transcript but with different chemical modifications. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0258] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0259] Table 22. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 9 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 22 above, each CFB RNAi agent (all targeting position 1667 of the CFB gene) showed a reduction in at least some amount of mCFB mRNA in the liver, with several achieving significant inhibition.

[0260] Example 10. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 0.5 mg / kg (mpk) of CFB RNAi agent prepared in isotonic saline, or a vector control (isotonic saline without RNAi agent), comprising the groups in Table 23 below: Table 23. Target sites and dosing groups in Example 10 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 23 above, each CFB RNAi agent comprises a nucleotide sequence designed to inhibit human CFB gene expression at position 1667 or position 2399 of the CFB gene, and these nucleotide sequences are also homologous to the mouse CFB gene transcript. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0261] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0262] Table 24. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 10 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 24 above, Group 10 (AD13931) had a U nucleotide substitution at position 13 (5'→3') on the antisense strand, resulting in a U:G swing with the CFB gene and showing only minimal knockdown of mCFB mRNA, which essentially inactivated the CFB RNAi agent (compare AD13931 (Group 10) with AD13436 (Group 8)). Meanwhile, the CFB RNAi agent in group 11 mismatched with the target mRNA at position 15 (5'→3') on the antisense strand, replacing C with U nucleotides, and thus forming a U:G swing with CFB mRNA (and sense strand). This was more tolerable than group 10, but it was still less effective in terms of activity than the version that was more completely complementary to the CFB gene target (compare AD13932 (group 11) (~43% knockdown (0.547)) and AD13436 (group 8) (~49% knockdown (0.516))).

[0263] Conversely, the CFB RNAi agent in group 12 also involved a mismatch with the target CFB mRNA, where a C nucleotide was replaced by a U nucleotide, but this time at position 16 (5'→3') on the antisense strand. Despite this change in the antisense strand sequence, instead of forming a Watson-Crick base pair with the reported CFB mRNA (SEQ ID NO:1) at this position (and with the sense strand of this particular CFB RNAi agent), a U:G wobble was formed. Surprisingly and unexpectedly, this resulted in an approximately 10% increase in CFB gene silencing activity, making it the most effective CFB RNAi agent in this study. (Compare AD13933 (group 12), which showed the highest knockdown level of 59% (0.410) with a single 0.5 mg / kg subcutaneous (SQ) dose in this study, with AD13436 (group 8), which showed only 49% knockdown (0.516); see also Table 1 (mRNA target sequence at position 1667: UGU) G GUGUCUGAGUACUUU (SEQ ID NO:45) (the underlined part indicates position 16 previously discussed, where AD13933 forms a G:U wobble pair with the CFB gene transcript instead of a C:G base pair)). Similarly, group 13 (AD13934, with a G:U wobble pair inserted at position 18 by modifying the antisense strand) is less effective than group 12, but has enhanced repressive activity compared to the perfectly complementary sequence of group 8 (AD13436). While the exact reasons for the unexpected improvements seen in groups 12 (AD13933) and 13 (AD13934) compared to RNAi agents (AD13436) with antisense strand sequences more perfectly complementary to the CFB gene target may be merely hypotheses and not bound by any theory, it is believed that altering the thermodynamics of CFB RNAi agents by modifying the nucleotide sequences at these specific positions leads to improved RISC loading and / or endosome escape properties of the antisense strand, allowing more RNAi agents to enter the desired cells without causing the expected decrease in repressive activity due to the lack of perfect complementarity to the CFB gene (and therefore the lack of binding potential) (e.g., as can be seen from the sequence alterations in group 10).

[0264] Example 11. In vivo testing of CFB RNAi agents in wild-type mice. On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg of CFB RNAi agent prepared in isotonic saline, or a vector control (isotonic saline without RNAi agent), comprising the groups in Table 25 below: Table 25. Target sites and drug administration groups in Example 11 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 25 above, each CFB RNAi agent comprises a nucleotide sequence designed to repress human CFB gene expression at position 1667 of the CFB gene, and these nucleotide sequences are also homologous to the mouse CFB gene transcript. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0265] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0266] Table 26. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 11 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 26 above, each CFB RNAi agent showed robust gene suppression, and all four tested CFB RNAi agents showed a clear dose-response relationship.

[0267] Example 12. In vivo testing of CFB RNAi agents in cynomolgus monkeys. CFB RNAi agents AD12964, AD13126, AD13933, and AD13934 were evaluated in cynomolgus monkeys. On day 1 and day 29, three male cynos in four groups (n=3 / group) were administered subcutaneous injections of 0.3 mL / kg (approximately 1.5 mL volume, depending on animal body weight) containing 3.0 mg / kg (mpk) of a CFB RNAi agent prepared in isotonic saline (one CFB RNAi agent / group).

[0268] CFB RNAi agents comprise a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information of CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0269] Serum samples were collected on day -7 (before administration), day 1 (before administration), day 8, and day 15. Figure 1 The table shows cynomolgus monkey serum CFB (cCFB) protein levels normalized relative to pre-dose levels on day 1, based on measurements taken on each serum collection date up to week 2 (e.g., at...). Figure 1 In the diagram, week 0 is day 1; week 4 is day 29.

[0270] The reduction of CFB is also associated with impaired complement alternative pathway (AP). Wieslab ® The AP assay is an ELISA-based assay that detects the complement membrane attack complex (MAC), a cytolytic effector that is the final step in the complement cascade. (For the Wieslab used) ® For further discussion of AP assays, see Example 13 below. This kit is specific to bypass pathways because the plate is coated with a specific activator for bypass pathways. Figure 2 Wieslab was displayed ® The relative activity, normalized relative to pre-D1 dosing levels, was measured by the AP assay, based on measurements taken on each serum collection date up to the second week (e.g., at...). Figure 1 In the diagram, week 0 is day 1; week 4 is day 29.

[0271] like Figure 1 As shown, each of the CFB RNAi agents evaluated resulted in a significant decrease in serum CFB protein levels, but to varying degrees. Similarly, as Figure 2 As shown, Wieslab evaluated the activity of the complement bypass pathway. ® AP assays supported the loss of function associated with decreased CFB protein levels. By day 15, the four tested CFB RNAi agents resulted in serum CFB protein reductions of 70% (AD12964), 92% (AD13933), 87% (AD13934), and 73% (AD13126), respectively. Figure 1 Correspondingly, these decreases in serum CFB levels were accompanied by reductions of 47% (AD12964), 81% (AD13933), 75% (AD13934), and 49% (AD13126) respectively by Wieslab. ®Significant loss of complement alternative pathway activity as measured by AP assay ( Figure 2 ).

[0272] Example 13. In vivo testing of CFB RNAi agents in cynomolgus monkeys over a duration of 85 days. For the study described in Example 12, to further characterize the pharmacokinetic effects, observation and evaluation of treatment with the CFB RNAi agent AD13933 (but not others) were maintained from the first injection (day 1) until day 85. Serum samples collected every week after the first injection (i.e., weeks 0, 2, 4, 6, 8, 10, and 12) were analyzed.

[0273] Serum CFB levels in cynomolgus monkeys were semi-quantitatively measured using Western blotting with Jess (ProteinSimple, MN, USA). Protein concentrations in serum samples were measured using the Thermo Scientific™ Pierce™ BCA Protein Assay Kit (catalog number #23227, Thermo Scientific™). Primary antibodies for detecting serum CFB were purchased from Sigma (catalog number #HPA001817), and primary antibodies for detecting transferrin were purchased from R&D Systems (catalog number #AF3987SP). Serum CFB protein levels were normalized to transferrin levels and then compared to the corresponding levels for each animal on day 1. All consumables required for Western blotting were purchased from ProteinSimple.

[0274] In addition, the hemolytic activity of the CFB RNAi agent AD13933 was evaluated. Hemolytic activity is sensitive to reductions, deletions, and / or inactivations of key components of the complement system. As shown, there are three pathways for complement activation: the alternative pathway, the classical pathway, and the lectin pathway. Since all three activation pathways of the complement system require the participation of CFB to induce tissue damage in vivo (see, for example, Thurman, J. and Holers, VM, J. Immunol. 1 Feb. 2006, 176(3) 1305-1310), activation of the alternative complement pathway (AP) was measured to assess the effect of CFB knockdown on the complement system. AP requires only Mg 2+ Ions, while the classical and lectin pathways require Ca2+. 2+ and Mg 2+ Both. This difference is utilized to determine AP only in the presence of proteins from both the classical and lectin pathways. Rabbit erythrocytes, known to spontaneously activate AP in most mammalian species, were used for this assay.

[0275] method Hemolysis assay (alternative pathway) The hemolysis assay for the bypass pathway was performed by measuring hemolysis of sensitized rabbit erythrocytes according to a modified protocol provided by Complement Technology, Inc. (https: / / www.complementtech.com). In short, for each reaction in a 96-well plate with a total volume of 100 μL, 8–30 μL of a 2-fold diluted serum sample was mixed with 50 μL of LGVB0, 5 μL of 0.1 M MgEGTA, and 25 μL of rabbit erythrocytes (5 × 10⁻⁶ cells per well). 8 Incubate the mixture together with GVBE (g / mL). Incubate the mixture at 37°C for 30 minutes, then add 100 μL of GVBE to terminate the reaction. After centrifugation, transfer 100 μL of the supernatant to a new plate. Hemolysis is determined by analyzing the optical density of the supernatant at 412 nM. Maximum hematopoietic lysate is obtained by incubation at 37°C for 60 minutes. All reagents were purchased from Complement Technology, Inc (Texas, USA).

[0276] One AP50 unit is defined as the amount of serum required to induce 50% RBC lysis. This is calculated by subtracting the background OD from all samples and then dividing it by the maximum lysis control. The curve is plotted as ln(dilution) versus ln(lysis). A line is created around three points that represent the 50% maximum lysis, which is used to calculate one AP50 unit. Based on the dilution, the AP50 U / ml for each sample can be calculated.

[0277] Hemolysis assay (classical pathway) The hemolysis assay for the classical route was performed according to a modified protocol provided by Complement Technology, Inc. (https: / / www.complementtech.com). In short, for each reaction with a total volume of 120 μL of GVB++, the serum sample was initially diluted 20-fold, then diluted 1:2.5, and then diluted three more times at a 1:1.5 ratio. 15 μL of the GVB++ diluted serum sample was mixed with 10 μL of sheep red blood cells (EA cells, 5 × 10⁶) coated with rabbit antibodies. 8 Incubate the mixture together with 100 μL of cold GVBE for 30 minutes at 37°C. Then, terminate the reaction by adding 100 μL of GVBE. After centrifugation at 1000 g for 5 minutes, transfer 100 μL of the supernatant to a new plate. Hemolysis is determined by analyzing the optical density of the supernatant at 412 nM. All reagents were purchased from Complement Technology, Inc (Texas, USA).

[0278] One CH50 unit is defined as the amount of serum required to induce 50% RBC lysis. This is calculated by subtracting the background OD from all samples and then dividing it by the maximum lysis control. The curve is plotted as ln(dilution) versus ln(lysis). A line is created around three points that represent the 50% maximum lysis, which is used to calculate one CH50 unit. The CH50 U / ml for each sample can be calculated based on the dilution.

[0279] Wieslab ® Assay (alternative and classical pathways) The activities of the alternative and classical complement pathways in cynomolgus monkeys were quantitatively measured using in vitro competitive ELISA kits (catalog numbers #COMPLAP330 and COMPLCP310, Svar LifeScience AB). Serum samples were analyzed according to the manufacturer's instructions.

[0280] result Treatment with AD13933 resulted in a rapid decrease in serum CFB levels after the first injection. By day 15, the CFB RNAi agent AD13933 showed a 95% reduction in serum CFB protein. A second injection administered on day 29 further enhanced this reduction. Low serum CFB protein levels were maintained at no more than 5% of baseline until day 85 (week 12) (see [link to treatment]). Figure 3 The following table provides data from individual cynos: Table 30. Serum cCFB protein levels (normalized relative to day 1) in individuals who received two doses of AD13933 on day 1 and day 29: (See also plotting the average) Figure 3 As the data presented in this paper show, AD13933 resulted in a reduction of more than approximately 95% as early as day 15 and exhibited strong inhibition until day 85 (two of the three cynos still had approximately 98% reduction in cCFB protein levels (0.0243-cynos 1; 0.0235-cynos 3)).

[0281] Serum levels of Bb protein (a component of C3 convertase) were also assessed. In the complement-activated alternative pathway, CFB binds to C3b and cleaves C3 to generate C3b. However, CFB itself is only cleaved when it is bound to C3b. The Bb fragment expresses serine protease activity, but it can only cleave C3 and C5 while still bound to C3b. Therefore, CFB and C3 form an amplified loop, where Bb is a suitable marker reflecting alternative pathway activation. Serum Bb levels were quantified by ELISA using MicroVue Bb Plus EIA (Quidel, San Diego, CA, USA). Serum Bb levels showed a similar decreasing pattern to CFB protein levels and remained below 30% of baseline from day 15 to day 85 (see [link to study]. Figure 4 ).

[0282] Correspondingly, the observed decrease in serum CFB and Bb levels was accompanied by a significant loss of complement alternative pathway activity, which was mediated through hemolytic AP50 and Wieslab, respectively. ® AP was measured by both assays. Two doses of AD13933 at 3 mpk resulted in a reduction of over 75% as measured by the AP hemolysis assay (day 43). Figure 5 ), and through Wieslab ® Approximately 90% reduction was measured by AP assay (on day 43). Figure 6 Furthermore, it was determined that CFB only participates in the bypass pathway of the complement cascade. As expected, this was confirmed by hemolysis CH assay (CH50, Figure 7 ) and Wieslab ® CP determination (classical approach) Figure 8 Measurements showed no significant changes in the activity of the classical pathway.

[0283] Example 14. In vivo testing of CFB RNAi agent in wild-type mice.

[0284] On day 1, male C57bl / 6 mice aged 6 to 8 weeks were given a single subcutaneous administration of 200 μl / 20 g body weight containing 0.5 mg / kg of CFB RNAi agent in isotonic saline, or a vector control (isotonic saline without RNAi agent), comprising the groups in Table 28 below: Table 28. Target sites and dosing groups in Example 14 Each CFB RNAi agent comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modification and structural information of the CFB RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6). As shown in Table 25 above, each CFB RNAi agent comprises a nucleotide sequence designed to inhibit human CFB gene expression at position 1667 (Group 2) or position 2399 (Groups 3-20) of the CFB gene, and these nucleotide sequences are also homologous to the mouse CFB gene transcript. (For the referenced CFB gene, see also SEQ ID NO:1 and Table 2).

[0285] Injections were administered between the skin and muscle (i.e., subcutaneous injection) at the loose skin of the neck and shoulder region. Four (4) mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized relative to mouse β-actin expression, and expressed as a fraction of the mediator control group (geometric mean, + / - 95% confidence interval).

[0286] Table 29. Mean relative mouse CFB mRNA in the liver of mice at sacrifice (day 15) in Example 13 Data were normalized relative to the saline treatment group (Group 1). As shown in Table 26 above, each CFB RNAi agent showed inhibition of CFB gene expression, with several achieving approximately 50% or greater reductions in mCFB mRNA.

[0287] Example 15. A Phase I / IIa clinical trial evaluating the safety, tolerability, pharmacokinetics, and pharmacodynamics of single-dose and multiple-dose CFB RNAi agents in healthy volunteers and adult subjects with complement-mediated kidney disease. A phase 1 / 2a single-dose and multiple-dose escalation study was initiated to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of the CFB RNAi agent AD13933 in sodium phosphate buffer in healthy adult volunteers and subjects with complement-mediated renal disease. The CFB RNAi agent AD13933 was formulated at 200 mg / mL (salt-free or based on free acid) in an aqueous buffer containing 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate in water for injection (“Formulated CFB RNAi Drug Substance”).

[0288] Five single-escalation-dose (SAD) cohorts are each expected to enroll six healthy non-virgin (NHV) volunteers (randomized 2:1 drug:placebo) to receive either a formulated CFBRNAi drug substance or placebo at doses of 25 mg, 50 mg, 100 mg, 200 mg, or 400 mg (i.e., four participants in each cohort receive the CFB RNAi drug substance and two receive placebo), with a safety check performed on day 15. Additionally, three multiple-escalation-dose (MAD) cohorts are each expected to enroll six NHV volunteers (randomized 2:1 drug:placebo) to receive two doses of a formulated CFB RNAi drug substance or placebo administered on days 1 and 29, at doses of 100 mg, 200 mg, or 400 mg. A cohort will also be initiated to recruit up to 18 patients with IgAN to receive a total of three doses of the formulated CFB RNAi drug substance on days 1, 29, and 113, with dosage levels determined based on data from the SAD and MAD cohorts.

[0289] Example 16. In vivo testing of CFB RNAi agents in cynomolgus monkeys. The CFB RNAi agent AD13933 was evaluated in cynos. On days 1 and 29, three male cynos (n=3) were administered subcutaneous injections of 0.3 mL / kg (approximately 1.5 mL volume, depending on animal body weight) containing 0.5 mg / kg (mpk), 1.5 mg / kg, or 4.5 mg / kg of the CFB RNAi agent AD13933 prepared in isotonic saline.

[0290] CFB RNAi agent AD13933 comprises a modified nucleotide conjugated at the 5′ end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetylgalactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information on CFB RNAi agents (including (NAG37)s ligands), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0291] Serum samples were collected on day -7 (before administration), day 1 (before administration), day 8, day 15, day 22, day 29 (before the second administration), day 36, day 43, day 50, day 57, day 64, day 71, day 78 and day 85.

[0292] Two weeks after the first dose, administration of the CFB RNAi agent AD13933 resulted in a significant decrease in serum CFB levels, and this decrease showed a dose-dependent response. The lowest point in serum CFB protein levels occurred on day 43, at which point a reduction of more than 90% (for the 0.5 mg / kg group) and 95% (for the 4.5 mg / kg group) was detected compared to the corresponding baseline levels. Figure 9 Treatment with the CFB RNAi agent AD13933 also significantly reduced the functional fragment Bb of CFB in bypass pathway activation, and showed a reduction of more than 95% at the nadir in all treatment groups. Figure 10 ).

[0293] Also through hemolysis assay and Wieslab ® Complement activity under the influence of CFB RNAi agent AD13933 was measured (see Examples 12 and 13 for assay information). CFB RNAi agent AD13933 resulted in a dose-dependent decrease in complement bypass pathway activity. At the lowest point, 4.5 mg / kg of CFB RNAi agent AD13933 resulted in over 70% (hemolytic AP50). Figure 11 ) and 90% (Wieslab) ® AP measurement, Figure 12 The activity of the bypass pathway is lost. On the other hand, through hemolysis of CH50 ( Figure 13 ) and Wieslab ® CP (classical approach) determination Figure 14 The measured activity of the classical pathway remained unchanged, further confirming that the CFB inhibition induced by the CFB RNAi agent AD13933 does not affect the classical pathway.

[0294] The results of this study indicate that the CFB RNAi agent AD13933 effectively silences CFB gene expression. Repeated administration resulted in additional pharmacodynamic effects. Treatment with the CFB RNAi agent AD13933 not only significantly reduced serum CFB protein in a dose-related manner, but also significantly impaired CFB-related function of the complement bypass pathway with decreasing CFB levels.

[0295] Example 17. Toxicology evaluation of CFB RNAi agents. The non-clinical safety profile of the CFB RNAi agent AD13933 was evaluated through a series of standard in vitro and in vivo studies. Results from non-GLP in vitro studies indicated minimal potential for induction of the innate immune system (cytokine and complement activation), mitochondrial toxicity / cytotoxicity, or spontaneous platelet aggregation. As demonstrated by the results of the safety pharmacology evaluation, the CFB RNAi agent AD1393 was also shown to have no adverse effects on the central nervous, respiratory, or cardiovascular systems.

[0296] Repeat-dose toxicology studies were conducted using subcutaneous administration at a dose every four weeks to assess the general toxicity potential of AD13933. A summary of the NOAELs from these studies is provided in the table.

[0297] Table 31: Summary of levels at which no adverse effects were observed in the study Abbreviations: NOAEL = No adverse effects observed at this dose; Q4W = every 4 weeks.

[0298] Microscopic observations of the liver and kidneys in rats, and injection sites and lymph nodes in monkeys, indicated that the uptake and clearance of the CFB RNAi agent AD13933 were similar to those described for other subcutaneously administered N-acetylgalactosamine siRNA drugs. Although microscopic observations were also recorded in the adrenal glands and pancreas of rats, these were not considered adverse. The incidence and severity of hepatocellular karyocytosis recorded in rats administered ≥100 mg / kg ADS-020 were used to determine the NOAEL at 30 mg / kg; however, these observations did not constitute clinical pathology correlates and were not associated with significant adverse effects on organ function or overall animal health.

[0299] Furthermore, off-target analysis of the nucleotide sequence of the CFB RNAi agent AD13933 was performed, demonstrating that AD13933 is a highly specific RNAi agent for human CFB mRNA, and that the likelihood of causing off-target gene silencing is very low, especially at clinically relevant doses.

[0300] In summary, the results of the in vitro and in vivo nonclinical safety studies support that the CFB RNAi agent AD13933 is appropriately safe for human clinical development. The toxicological effects observed in animal studies are not considered to pose a significant risk to human safety, as they occurred at dose levels far higher than those intended for use in clinical studies.

[0301] Other implementation plans It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting complement factor B (CFB) gene expression, comprising: An antisense strand comprising a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the antisense strand sequences in Tables 2, 3, or 5C; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent according to claim 1, wherein the antisense strand comprises nucleotides 2-18 of any sequence provided in Table 2, Table 3 or Table 5C.

3. The RNAi agent according to claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides, the nucleotide sequence differing by 0 or 1 nucleotide from any of the 17 consecutive nucleic acids in the sense strand sequences of Table 2, Table 4 or Table 5, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on at least 17 consecutive nucleotides.

4. The RNAi agent according to any one of claims 1-2, wherein at least one nucleotide of the RNAi agent comprises a modified nucleoside linker.

5. The RNAi agent according to any one of claims 1-3, wherein the RNAi agent comprises one or more modified nucleotides, said modified nucleotides being independently selected from: 2′-O-methyl nucleotides, 2′-fluoronucleotides, 2′-deoxynucleotides, 2′,3′-open-ring nucleotide mimics, locked nucleotides, 2′-F-arabinonucleotides, 2′-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse 2′-O-methyl nucleotides, reverse 2′-deoxynucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, morpholinonucleotides, nucleotides containing vinylphosphonates, nucleotides containing cyclopropylphosphonates, and 3′-O-methyl nucleotides.

6. The RNAi agent according to any one of claims 1-5, wherein all or substantially all of the nucleotides are modified nucleotides, and wherein the modified nucleotides are 2′-O-methylnucleotides, 2′-fluoronucleotides, or combinations thereof.

7. The RNAi agent according to any one of claims 1-6, wherein the antisense strand consists of or is substantially composed of the nucleotide sequence of any one of the modified antisense strand sequences in Table 3 or Table 5C.

8. The RNAi agent according to any one of claims 1-7, wherein the sense strand consists of, is substantially composed of, or contains the nucleotide sequence of any one of the modified sense strand sequences in Table 4A, Table 4B, or Table 5C.

9. The RNAi agent according to claim 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3 or Table 5C, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4A, Table 4B, or Table 5C.

10. The RNAi agent according to any one of claims 1-9, wherein the RNAi agent is linked to a target ligand.

11. The RNAi agent of claim 10, wherein the targeting ligand has an affinity for the desialyl glycoprotein receptor.

12. The RNAi agent according to claim 10 or claim 11, wherein the targeting ligand comprises N-acetylgalactosamine.

13. The RNAi agent according to any one of claims 10-12, wherein the targeting ligand is linked to the sense strand.

14. The RNAi agent of claim 13, wherein the targeting ligand is attached to the 5′ end of the sense strand.

15. The RNAi agent according to any one of claims 10-14, wherein the targeting ligand comprises: ,or 。 16. The RNAi agent according to any one of claims 1-15, wherein the length of the sense strand is between 15 and 30 nucleotides, and the length of the antisense strand is between 19 and 30 nucleotides.

17. The RNAi agent of claim 16, wherein the length of the sense strand and the antisense strand is each between 19 and 26 nucleotides.

18. The RNAi agent of claim 17, wherein the length of the sense strand and the antisense strand is each between 21 and 24 nucleotides.

19. The RNAi agent according to claim 18, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

20. The RNAi agent according to any one of claims 1-19, wherein the RNAi agent has two blunt ends.

21. The RNAi agent according to any one of claims 1-20, wherein the sense strand comprises one or two terminal caps.

22. The RNAi agent according to any one of claims 1-21, wherein the sense strand comprises one or two reverse debasement residues.

23. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand forming a double-stranded sequence of any one of the double-stranded sequences listed in Table 5A, Table 5B or Table 5C.

24. The RNAi agent according to any one of claims 1-23, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence that differs from, one of the following nucleotide sequences (5′ → 3′) by 0 or 1 nucleotide: AAAGUACUCAGACACCACAGC (SEQ ID NO:1275); UAGAAAACCCAAAUCCUCAUC (SEQ ID NO:1283); UAAGUACUCAGACACUACAGC (SEQ ID NO:1332); UAAGUACUCAGACACCAUAGC (SEQ ID NO:1333); UAAGUACUCAGACACCACAGC (SEQ ID NO:1326) UCAAUGACAGUAAUUGGGUCC (SEQ ID NO:1310); AAAGUACUCAGACACCACA (SEQ ID NO:359); UAGAAAACCCAAAUCCUCA (SEQ ID NO:474); UAAGUACUCAGACACUACA (SEQ ID NO:367); UAAGUACUCAGACACCAUA (SEQ ID NO:361); UAAGUACUCAGACACCACA (SEQ ID NO:360); or UCAAUGACAGUAAUUGGGU (SEQ ID NO:246).

25. The RNAi agent according to any one of claims 1-24, wherein the sense strand consists of, is substantially composed of, or comprises of one of the following nucleotide sequences (5′ → 3′): GCUGUGGUGUCUGAGUACUUU (SEQ ID NO:1355); GAUGAGGAUUUGGGUUUUCUA (SEQ ID NO:1363); GCUGUGGUGUCUGAGUACUUA (SEQ ID NO:1406); GCUGUGGUGUUUGAGUACUUA (SEQ ID NO:1409); GGACCCAAUUACUGUCAUGA (SEQ ID NO:1390); UGUGGUGUCUGAGUACUUU (SEQ ID NO:1410); UGAGGAUUUGGGUUUUCUA (SEQ ID NO:1408); UGUGGUGUCUGAGUACUUA (SEQ ID NO:779); UGUGGUGUUUGAGUACUUA (SEQ ID NO: 1439); or ACCCAAUUACUGUCAUGA (SEQ ID NO:665).

26. The RNAi agent according to any one of claims 23-25, wherein all or substantially all nucleotides are modified nucleotides.

27. The RNAi agent of claim 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5′ → 3′) by 0 or 1 nucleotide: asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; s represents a phosphate thioester linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

28. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or substantially consists of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5′ → 3′) by 0 or 1 nucleotide: gcugugguGfUfCfugaguacuuu (SEQ ID NO:1176); gaugaggaUfUfUfggguuuucua (SEQ ID NO:1184); gaugaggaUfuUfGfgguuuucua (SEQ ID NO:1185); gcugugguGfUfCfugaguacuua (SEQ ID NO:1235); gcugugguGfUfUfugaguacuua (SEQ ID NO:1248); or ggacccAfaUfuAfcugucauuga (SEQ ID NO:1251), Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; s represents a phosphate thioester linker; and all or substantially all nucleotides on the antisense strand are modified nucleotides.

29. The RNAi agent according to any one of claims 23-28, wherein the sense strand further comprises a reverse debasement residue at the 3′ end, the 5′ end, or both of the nucleotide sequence.

30. The RNAi agent according to any one of claims 1-29, wherein the RNAi agent is linked to a target ligand.

31. The RNAi agent according to any one of claims 1-30, wherein the targeting ligand comprises: ,or 。 32. The RNAi agent according to any one of claims 1-31, wherein the targeting ligand is linked to the sense strand.

33. The RNAi agent of claim 32, wherein the targeting ligand is attached to the 5′ end of the sense strand.

34. The RNAi agent according to any one of claims 1-33, wherein the RNAi agent is a pharmaceutically acceptable salt.

35. The RNAi agent according to claim 34, wherein the RNAi agent is a sodium salt.

36. The RNAi agent according to any one of claims 1-35, wherein the RNAi agent comprises an antisense strand and a sense strand, which consists of, is substantially composed of, or contains a modified nucleotide sequence differing by 0 or 1 nucleotide from one of the following sequence pairs (5′ → 3′): asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:983) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuus(invAb) (SEQ ID NO:1077); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO:913) and (NAG37)s(invAb)sgaugaggaUfUfUfggguuuucuas(invAb) (SEQ ID NO:1085); usAfsgsaAfaacccaAfaUfcCfucausc (SEQ ID NO:915) and (NAG37)s(invAb)sgaugaggaUfuUfGfgguuuucuas(invAb) (SEQ ID NO:1086); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO:1136); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO:1014) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO:1136); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO:994) and (NAG37)s(invAb)sgcugugguGfUfUfugaguacuuas(invAb) (SEQ ID NO:1149); or usCfsaaugAfcaguAfaUfuGfggucsc (SEQ ID NO:1022) and (NAG37)s(invAb)sggacccAfaUfuAfcugucauugas(invAb) (SEQ ID NO:1152); Where a represents 2′-O-methyladenosine, c represents 2′-O-methylcytidine, g represents 2′-O-methylguanosine, and u represents 2′-O-methyluridine; Af represents 2′-fluoroadenosine, Cf represents 2′-fluorocytidine, Gf represents 2′-fluoroguanosine, and Uf represents 2′-fluorouridine; s represents a phosphate thioester linker; (invAb) represents a reverse debased deoxyribonucleotide; and (NAG37)s has the following chemical structure: 。 37. A composition comprising an RNAi agent according to any one of claims 1-36, wherein the composition comprises a pharmaceutically acceptable excipient.

38. The composition of claim 37, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

39. The composition of claim 38, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

40. A method for inhibiting CFB gene expression in hepatocytes, the method comprising introducing an effective amount of an RNAi agent according to any one of claims 1-36 or a composition according to any one of claims 37-39 into the cells of a subject.

41. The method of claim 40, wherein the subject is a human subject.

42. The method according to any one of claims 40-41, wherein the CFB mRNA level in the hepatocytes or subject is reduced by at least about 50%.

43. The method according to any one of claims 40-42, wherein the CFB protein level in the hepatocytes or subject is reduced by at least about 50%.

44. The method according to any one of claims 40-43, wherein the complement bypass pathway activity of the human subject is inhibited by at least 50% as measured by Wieslab® AP assay.

45. The method according to any one of claims 40-44, wherein the complement bypass pathway activity of the human subject is inhibited by at least 90% as measured by Wieslab® AP assay.

46. ​​The method according to any one of claims 40-45, wherein the complement bypass pathway activity of the human subject is inhibited by at least 50% as measured by the AP50 hemolysis assay.

47. The method according to any one of claims 40-46, wherein the complement bypass pathway activity of the human subject is inhibited by at least 70% as measured by the AP50 hemolysis assay.

48. A method for treating CFB-related diseases, conditions, or symptoms, the method comprising administering to a human subject in need a therapeutically effective amount of the composition according to any one of claims 37-39.

49. The method of claim 48, wherein the disease is IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

50. The method according to any one of claims 40-49, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 6.0 mg / kg of human subject body weight.

51. The method according to any one of claims 40-50, wherein the RNAi agent is administered to the human subject at a fixed dose between about 25 mg and about 400 mg.

52. Use of the RNAi agent according to any one of claims 1-36 or the composition according to any one of claims 37-39 for the treatment of diseases, conditions or symptoms mediated by at least a partial reduction in CFB gene expression.

53. The use according to claim 52, wherein the disease is IgA nephropathy (IgAN), C3 glomerulonephropathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne's honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

54. Use of the RNAi agent according to any one of claims 1-36 or the composition according to any one of claims 37-39 for the preparation of a pharmaceutical composition for the treatment of at least a disease, condition, or symptom mediated by a reduction in CFB gene expression.

55. The use according to any one of claims 52-54, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 6.0 mg / kg of human subject body weight, or at a fixed dose of about 10 mg to about 400 mg.

Images