Efficient culture system for blueberry virus-free seedlings

By combining low-temperature pretreatment and gradient heat treatment with adventitious bud culture, a highly efficient blueberry virus-free system is formed, which solves the problems of complex operation, high cost and low virus-free rate in existing technologies, and realizes the cultivation of high-quality virus-free seedlings, meeting the needs of the Duke blueberry industrialization.

CN121153597APending Publication Date: 2025-12-19SHANDONG DAFENGYUAN AGRI CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511692788.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing blueberry virus removal technologies are complex to operate, costly, and have low virus removal rates, making it difficult to meet the demand for high-quality virus-free seedlings for the industrialization of Duke blueberries, especially since the removal rate of highly infectious viruses such as BlShV is low.

Method used

A high-efficiency blueberry detoxification system was formed by using a combination of low-temperature pretreatment and gradient heat treatment, including low-temperature pretreatment (3.5-4.5℃, 60%-70% humidity, dark treatment for 60-84h) and gradient heat treatment (29-39℃, 1800-3800 lux light), combined with adventitious bud culture, proliferation culture and rooting culture.

Benefits of technology

It significantly reduces virus concentration, increases shoot tip survival rate and virus elimination rate, ensures high purity and virus-free seedlings, meets industrialization needs, and improves the quality and stability of blueberry seedlings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121153597A_ABST
    Figure CN121153597A_ABST
Patent Text Reader

Abstract

The invention discloses a culture method of blueberry virus-free seedlings. The culture method comprises the following steps: acquiring disinfected blueberry branches containing buds; the method comprises the following steps: pre-treating buds of which the outer-layer leaves of the buds are stripped and growing points are exposed under the conditions that the temperature is 3.5-4.5 DEG C, the humidity is 60%-70%, and dark treatment is carried out for 60-84 hours; performing gradient heat treatment on the buds under the conditions that the temperature is 29-31 DEG C, the illumination intensity is 1800-2200 lux and the illumination time is 10-14 h / d in the first day to the third day; from the fourth day to the seventh day, the temperature ranges from 34 DEG C to 36 DEG C, the illumination intensity ranges from 2200 lux to 2700 lux, and the illumination time ranges from 10 h / d to 14 h / d; from the 8th day to the 14th day, the temperature ranges from 37 DEG C to 39 DEG C, the illumination intensity ranges from 3300 lux to 3800 lux, and the illumination time ranges from 10 h / d to 14 h / d; performing adventitious bud culture on the blueberry stem tip containing the leaf primordium; carrying out multiplication culture; performing rooting culture to obtain blueberry plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant tissue culture, and relates to a high-efficiency culture system of blueberry virus-free seedlings. BACKGROUND

[0002] Blueberry is a perennial deciduous or evergreen shrub of the Vaccinum genus of the Ericaceae family. The fruit is rich in anthocyanins, vitamins, and minerals, and has health benefits such as improving vision, antioxidant, anti-cancer, delaying brain aging, and preventing diabetes. It is listed as one of the five healthiest foods by the International Food and Agriculture Organization.

[0003] Duke blueberry (Vaccinium corymbosum 'Duke') has an important position in the global blueberry industry due to its large fruit size, high sweetness, storage and transportation resistance, and early maturity. However, as the planting period extends and the cross-regional seedling circulation intensifies, the virus disease problem of Duke has become increasingly prominent, which has become a key bottleneck restricting the quality improvement, yield stability, and sustainable development of the industry. Currently, tissue culture is usually used for the rapid propagation of Duke blueberry plants in China, but it can easily accumulate viruses. Existing virus elimination techniques mainly include heat treatment, stem tip culture, anther culture, microstem tip grafting, and chemical agent treatment. Among them, heat treatment combined with stem tip culture is the most widely used method, but it has obvious limitations. On the one hand, heat treatment requires a long time (usually several weeks) to maintain a high temperature environment, which requires high precision equipment, and Duke blueberry tissue culture seedlings are prone to yellowing and growth stagnation under long-term high temperature, resulting in a decrease in the survival rate of subsequent stem tips. On the other hand, conventional stem tip virus elimination requires the removal of very small stem tips, which is difficult to operate, and single stem tip virus elimination has a low removal rate for highly infectious viruses such as BlShV, which cannot meet the demand for high-purity virus-free seedlings in the industry.

[0004] Currently, there is no special stem tip high-efficiency virus elimination system for Duke blueberry varieties. The existing blueberry virus elimination techniques generally have the problems of complex operation, high cost, low virus elimination rate, and insufficient seedling regeneration efficiency, which cannot meet the urgent demand for high-quality virus-free seedlings in the Duke blueberry industry. Therefore, it is of great significance to develop a special technical system that adapts to the physiological characteristics of Duke blueberry, combines high-efficiency virus elimination and stable regeneration, to solve the problem of virus disease in Duke blueberry, ensure the stable transmission of excellent traits, and promote the high-quality development of the industry. SUMMARY

[0005] In order to solve the problems in the prior art, the present application provides a culture method of blueberry virus-free seedlings, which comprises the following steps: S1: obtaining a blueberry branch with a bud; S2: disinfecting the blueberry branch to obtain a disinfected blueberry branch; S3: peeling off the outer leaves of the buds on the disinfected blueberry branches to expose the inner growing points, thereby obtaining the buds with exposed growing points; S4: subjecting the buds with exposed growing points to low-temperature pretreatment, thereby obtaining the low-temperature pretreated buds; The low-temperature pretreatment is performed at a temperature of 3.5-4.5℃ and a humidity of 60%-70% in the dark for 60-84 h; S5: subjecting the low-temperature pretreated buds to gradient heat treatment, thereby obtaining the gradient heat treated buds; The gradient heat treatment is performed at: Days 1-3: a temperature of 29-31℃, a light intensity of 1800-2200 lux, and a light time of 10-14 h / d; Days 4-7: a temperature of 34-36℃, a light intensity of 2200-2700 lux, and a light time of 10-14 h / d; Days 8-14: a temperature of 37-39℃, a light intensity of 3300-3800 lux, and a light time of 10-14 h / d; S6: peeling off the stem apical meristem of the gradient heat treated buds, thereby obtaining the blueberry stem apices, each containing 1-5 leaf primordia; S7: subjecting the blueberry stem apices to adventitious bud culture, thereby obtaining the blueberry adventitious buds; S8: subjecting the blueberry adventitious buds to proliferation culture, thereby obtaining the blueberry single seedlings; S9: subjecting the blueberry single seedlings to rooting culture, thereby obtaining the blueberry plants.

[0006] In some embodiments, the culture method further comprises hardening and transplanting the blueberry plants.

[0007] In some embodiments, the blueberry is Duke.

[0008] In some embodiments, in S1, the number of buds is 1-8.

[0009] In some embodiments, in S2, the disinfection comprises the following steps: rinsing the blueberry branches with running water for 25-30 min, soaking in 70-80 v / v% ethanol aqueous solution for 30-40 s, soaking in 0.08-0.12 w / w% mercury chloride aqueous solution for 8-10 min, rinsing with sterile water for 5-6 times, and absorbing the surface moisture.

[0010] In some embodiments, after step S6, the blueberry stem apices are soaked in a low-temperature protective agent at 3-5℃ for 30-50 min; The cryoprotectant is based on MS basal medium, and further contains 80-120 g / L DMSO, 40-60 g / L sucrose and 0.8-1.2 g / L vitamin C.

[0011] In some embodiments, in S7, the step of culturing the blueberry stem tips in an adventitious bud culture medium is culturing the blueberry stem tips in an adventitious bud culture medium. The adventitious bud culture medium is based on WPM medium, and further contains 0.4-0.6 mg / L 6-BA, 0.08-0.12 mg / L NAA, 25-35 g / L sucrose, 6-8 g / L agar, 0.4-0.6 g / L activated carbon, and pH 5.4-5.6. The culture conditions are 24-26℃, 2000-3000 lux, 12-16 h / d, and 30-35 d.

[0012] In some embodiments, in S8, the step of proliferating the blueberry adventitious buds is inoculating the single buds of the blueberry adventitious buds into a proliferation culture medium 1, and culturing the plant tissues under the conditions of 24-26℃, 2000-3000 lux, 12-16 h / d, and 30-35 d, and then inoculating the plant tissues into a proliferation culture medium 2, and culturing the plant tissues under the conditions of 24-26℃, 2000-3000 lux, 12-16 h / d, and 30-35 d. The proliferation culture medium 1 is based on 400 mg / L ammonium nitrate, 370 mg / L magnesium sulfate heptahydrate, 170 mg / L potassium dihydrogen phosphate, 695 mg / L calcium nitrate tetrahydrate, 190 mg / L potassium nitrate, 6.2 mg / L boric acid, 0.25 mg / L copper sulfate pentahydrate, 0.25 mg / L sodium molybdate dihydrate, 8.6 mg / L zinc sulfate heptahydrate, 2 mg / L glycine, 100 mg / L inositol, 0.5 mg / L nicotinic acid, 0.5 mg / L VB6, 1 mg / L VB1, 25 g / L sucrose, 5.9 g / L agar, 0.4 mg / L ZT, 35 mg / L EDTA and 1 mg / L EDTA, and pH 5.2-5.4. The proliferation medium 2 formula is: 556 mg / L calcium nitrate tetrahydrate, 72.5 mg / L calcium chloride, 170 mg / L potassium dihydrogen phosphate, 990 mg / L potassium sulfate, 180.54 mg / L anhydrous magnesium sulfate, 0.125 mg / L copper sulfate pentahydrate, 0.025 mg / L cobalt chloride hexahydrate, 6.2 mg / L boric acid, 22.5 mg / L manganese sulfate monohydrate, 0.25 mg / L sodium molybdate dihydrate, 9 mg / L zinc sulfate heptahydrate, 0.5 mg / L nicotinic acid, 100 mg / L myo-inositol, 2 mg / L glycine, 0.5 mg / L VB6, 1 mg / L VB1, 53 mg / L EDDHA, 37 mg / L EDTA, 0.4 mg / L ZT, 0.04 mg / L IBA, 25 g / L sucrose and 5.9 g / L agar, pH 5.2-5.4.

[0013] In some embodiments, in S9, the step of rooting culture is: The blueberry single seedling is inoculated into the rooting culture medium to obtain a blueberry plant with shoots and roots; The rooting culture medium formula is: based on 1 / 2WPM medium, further containing 0.4-0.6 mg / L IBA, 0.04-0.06 mg / L NAA, 16-20 g / L sucrose, 6-8 g / L agar and 0.4-0.6 g / L activated carbon, pH adjusted to 5.2-5.4; The culture conditions are: temperature 22-24℃, light intensity 25000-3500 lux, light time 14-18 h / d, and culture for 20-25 d.

[0014] In some embodiments, the step of hardening-off and transplanting is: The blueberry plant is transferred to a hardening-off environment with temperature 20-25℃ and humidity 70%-80% for 3-5 d; After hardening-off, the seedling is transplanted into a sterilized substrate, and the water content is maintained at 60%-70%.

[0015] Low-temperature pretreatment inhibits virus replication, and the activity of virus particles is reduced in a low-temperature environment, and the number of viruses in plant cells is reduced.

[0016] Gradient heat treatment destroys the structure of viruses, and high temperature gradually destroys the capsid protein and nucleic acid of viruses, resulting in inactivation of viruses.

[0017] Low-high temperature synergistic detoxification, low temperature inhibits replication and high temperature destroys structure, and the concentration of viruses is significantly reduced. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 A photo of a blueberry seedling with adventitious shoots.

[0019] Figure 2 Photo of proliferated blueberry seedlings.

[0020] Figure 3 Photo of rooted blueberry seedlings.

[0021] Figure 4 Photo of transplanted blueberry seedlings. DETAILED DESCRIPTION

[0022] In order to make the objects, technical solutions and advantages of the present application clearer, the embodiments of the present application will be further described in detail below with reference to the drawings.

[0023] The present application provides a blueberry stem tip explant culture and detoxification method, which comprises the following steps.

[0024] Step one: selection and pretreatment of blueberry stem tip explants I. Selection of mother plants and material taking Select blueberry mother plants (variety: Duke) that are healthy and free of obvious pests and diseases, and cut the top vigorous new shoots at the new shoot germination stage in spring (April-May) in Rizhao, Shandong Province, Wulian County, and retain the branches with 3-5 full buds (length 8-12 cm, diameter 0.3-0.4 cm).

[0025] II. Surface disinfection and bud stripping Rinse the branches with running water for 25-30 min, place them on a clean bench, and then sequentially soak them in 75v / v% ethanol aqueous solution for 30-40 s, 0.1w / w% mercury chloride aqueous solution for 8-10 min (shake gently 2-3 times during the soaking), and sterile water for 5-6 times, and then absorb the surface moisture; then use a sterile scalpel to strip the outer leaves of the buds, expose the internal growth points, and obtain the buds with exposed growth points.

[0026] III. Low-temperature pretreatment (I) Low-temperature pretreatment To accurately reduce the virus activity in the blueberry bud body, strengthen the stability and effectiveness of the subsequent virus elimination process, the present application adopts fine operation for the directional low temperature pretreatment of the blueberry bud body: healthy bud bodies with exposed growth points are selected, uniformly placed in culture dishes covered with sterile moist filter paper, the number of bud bodies in each culture dish is controlled within a reasonable range to ensure smooth ventilation and uniform stress between the bud bodies, the culture dishes are then sealed and placed in a programmable constant temperature incubator, the temperature in the incubator is set to 3.5-4.5℃, the relative humidity is continuously monitored and adjusted by a humidity control system to maintain a stable relative humidity of 60%-70%, and the light system is turned off to ensure that the whole process is in complete darkness to avoid interference of light on the physiological state of the bud body and the virus activity; during the 72 h continuous dark treatment, the state of the bud body is observed through the observation window of the incubator every 24 h, and the temperature and humidity parameters in the incubator are recorded synchronously to ensure that the environmental conditions are stable; when the temperature difference between the incubator and the external environment is ≤5℃, the bud body is taken out, and placed in a sterile, cool, and humid environment with a humidity of 60%-70% for subsequent stem tip stripping operation, to avoid secondary damage to the bud body caused by sudden temperature change. The pretreatment operation accurately controls the selection standard of the bud body, the environmental parameters of the culture, and the details of the treatment process, induces bud dormancy release by using low temperature and darkness, on the one hand, inhibits key metabolic processes such as virus nucleic acid replication and protein synthesis through low temperature stress, and directionally weakens the virus activity, so that the virus concentration in the bud body is stably reduced by more than 95%; on the other hand, through standardized environmental regulation and operation process, the bud body accumulates resistance-related substances and optimizes the stability of cell structure, significantly improves the tolerance of the bud body to temperature fluctuations, nutrient stress and other adverse environments during the subsequent in vitro culture process, and provides standardized technical support for building an efficient and stable blueberry virus elimination regeneration system.

[0027] (II) Conventional treatment The virus elimination treatment of the Duke stem tip explant of blueberry can be operated according to the following process: healthy bud bodies with exposed growth points are selected and placed in a constant temperature incubator at 25-28℃ for dark treatment, the treatment time is set to 72 h, and the relative humidity of the culture environment needs to be maintained at 60%-70% during the treatment to ensure the stability of the physiological state of the bud body and lay a foundation for the subsequent virus elimination culture.

[0028] The stem tip meristem of the bud body pretreated by the low temperature and the conventional treatment is taken respectively, the total RNA / DNA of the sample is extracted by using the nucleic acid extraction method / RNA and DNA extraction kit (RNAprep Pure Plant Plus Kit (DP441) of Tiangen Biochemical), and qPCR detection is performed on blueberry red ring spot virus, tomato ring spot virus and blueberry focal spot virus, the primers and probes used are shown as follows.

[0029] (1) Blueberry red ringspot virus (BRRV) First set of primer and probe sequences: Upstream primer BIShV-f1, a mixed primer of the following two primers in equimolar ratio: (a) First primer (SEQ ID NO. 1): 5'-CATCCGATTTGGAGTACGATAAGTT-3' (b) Second primer (SEQ ID NO. 2): 5'-CGTCCGATTTGGAGTACGATAAGTT-3' Downstream primer BIShV-r1 (SEQ ID NO. 3): 5'-TCGGGTAGTCAGACTTAAATTCGA-3' Probe BIShV-P1 (non-fluorescent part sequence name is SEQ ID NO. 4): 5'-(FAM)TCCGAAGAATACGAATTAGTA(MGB)-3' Second set of primer and probe sequences: Upstream primer BIShV-f2 (SEQ ID NO. 5): 5'-TGCCTCTAGCGAGTTTTTGCA-3' Downstream primer BIShV-r2, a mixed primer of the following two primers in equimolar ratio: (a) First primer (SEQ ID NO. 6): 5'-CCACAAGGTCCGTCACTAATATGT-3' (b) Second primer (SEQ ID NO. 7): 5'-CCACAAGGTCCGTCACTAATTTGT-3' Probe BIShV-P2 (non-fluorescent part sequence name is SEQ ID NO. 8): 5'-(FAM)ATGTGGTTTGGTTCTCAC(MGB)-3' (2) Tomato ringspot virus (ToRSV) First set of primer and probe sequences: Upstream primer (SEQ ID NO. 9): 5'-GAGCAAGCGAAGAATACGAAT-3' Downstream primer (SEQ ID NO. 10): 5'-CCTGTTGTTGTTGATGTTGTTG-3' Probe (non-fluorescent moiety sequence name is SEQ ID NO. 11): 5'-(FAM)-CTCGTCGCTTCTTCAAGTTCCAAAT-(TAMRA)-3' Second set of primer and probe sequences: Upstream primer (SEQ ID NO. 12): 5'-GGAACTGCTGGTGTTGTTG-3' Downstream primer (SEQ ID NO. 13): 5'-CCACAGCAGCAAATAATACG-3' Probe (non-fluorescent moiety sequence name is SEQ ID NO. 14): 5'-(FAM)-TGCGCTTCTTCAAGTTCC-(TAMRA)-3' (3) Blueberry scorch virus (BBScV) Upstream primer sequence (SEQ ID NO. 15): 5'-CTCAAGCCGCAGCGTCACA-3' Downstream primer sequence (SEQ ID NO. 16): 5'-CACCAGTGTACTCCGTTTCGAGA-3' Probe sequence (non-fluorescent moiety sequence name is SEQ ID NO. 17): 5'-(FAM)-TGGCGTCTTCTTCTCGGTGGTGTA(TAMRA)-3' For the virus detection results using two groups of probes and primers, the average value of two template contents was used to calculate the virus content. The contents of the three viruses in the stem tip meristem of low temperature pretreatment and conventional treatment were as follows.

[0030] (1) Blueberry red ringspot virus (BRRV) The virus content of conventional treatment (control) was 1.82 x 10 5 ± 1.53 x 10 4 copy / μL, and the conventional treatment was not subjected to low temperature pretreatment, but only the stem tip was peeled and directly cultured.

[0031] The virus content of low temperature pretreatment (4℃, 72h) was 3.67 x 10 3 ± 4.21 x 10 2 copy / μL, and the low temperature significantly inhibited virus proliferation.

[0032] The detoxification efficiency (low temperature pretreatment and conventional treatment) was 97.9%.

[0033] (2) Tomato ringspot virus (ToRSV) The virus content of the conventional treatment (control) was 2.05 x 10 5 ± 2.17 x 10 4 copies per μL.

[0034] The virus content of the low-temperature pretreatment (4℃, 72h) was 5.12 x 10 3 ± 6.83 x 10 2 copies per μL, and the virus content reduction was slightly lower than that of BRRV.

[0035] The detoxification efficiency (low-temperature pretreatment vs. conventional treatment) was 97.5%.

[0036] (3) Blueberry scorch virus (BlScV) The virus content of the conventional treatment (control) was 1.56 x 10 5 ± 1.32 x 10 4 copies per μL.

[0037] The virus content of the low-temperature pretreatment (4℃, 72h) was 2.98 x 10 3 ± 3.57 x 10 2 copies per μL, and the low temperature had the best inhibitory effect on the virus.

[0038] The detoxification efficiency (low-temperature pretreatment vs. conventional treatment) was 98.1%.

[0039] It can be seen that the low-temperature pretreatment of the present application can significantly reduce the content of blueberry red ring spot virus, tomato ring spot virus and blueberry scorch virus in the stem tip meristem, which will be conducive to the preparation of blueberry virus-free seedlings in subsequent steps.

[0040] Step two: composite detoxification treatment of blueberry stem tips I. Gradient heat treatment for detoxification: (I) Gradient heat treatment The bud body after low-temperature pretreatment with good detoxification effect was transferred to a light incubator and treated for 14 days in a "gradient temperature increase" mode, and the parameters were as follows: (1) 1-3 days: temperature 30℃, light intensity 2000 lux, light time 12 h / d; (2) 4-7 days: temperature 35℃, light intensity 2500 lux, light time 12 h / d; (3) 8-14 days: temperature 38℃, light intensity 3000 lux, light time 12 h / d; (Gradient temperature to avoid high temperature direct damage to the bud growth point, so that the bud survival rate increased to more than 90%, while gradually inactivated virus); (II) Conventional heat treatment The low-temperature pretreated bud with good detoxification effect was transferred to the light incubator and treated for 14 days in the conventional mode, with the following parameters: (1) 1-3 d (low-temperature pretreatment period): temperature 6℃, light intensity 1500 lux, light time 8 h / d; (2) 4-7 d (transition adaptation period): temperature 13℃, light intensity 2500 lux, light time 10 h / d; (3) 8-14 d (recovery growth period): temperature 23℃, light intensity 3500 lux, light time 12 h / d; Results: The bud survival rate of gradient heat treatment was 95%, and the bud survival rate of conventional heat treatment was 86%. Gradient heat treatment can improve the bud survival rate.

[0041] II. Accurate stem tip stripping Under the clean bench, the stem tip meristem was stripped from the bud growth point after "low-temperature pretreatment" and "gradient heat treatment synergistic detoxification" using a sterile dissecting needle and a surgical knife. The size of the stem tip was strictly controlled to be 0.2-0.3 mm (containing 1-2 leaf primordia). During the stripping process, sterile filter paper was used to absorb the exudate of the stem tip to prevent the browning of the meristem.

[0042] III. Low-temperature protective agent treatment The stripped stem tip meristem was quickly placed in a pre-cooled (4℃) low-temperature protective agent for 40 min. The protective agent formula was: MS basic medium + 100 g / L DMSO + 50 g / L sucrose + 1 g / L vitamin C. During this period, the protective agent was gently shaken once every 10 min to ensure that it was fully penetrated and to improve the anti-browning ability of the stem tip in subsequent culture.

[0043] Step three: induction and proliferation culture of detoxified stem tips I. Primary induction culture The treated stem tips were inoculated into the primary induction medium, and the medium formula was: WPM medium (blueberry special) + 6-BA (0.5 mg / L) + NAA (0.1 mg / L) + sucrose (30 g / L) + agar (7 g / L) + activated carbon (0.5 g / L), pH adjusted to 5.4-5.6; the culture conditions were: temperature 25±1℃, light intensity 2500 lux, light time 14 h / d, cultured for 30-35 d, and the stem tips were induced to differentiate into 2-3 cm strong adventitious buds. The adventitious bud induction rate in this stage was 85%. Figure 1 One of the photos of blueberry seedlings containing adventitious buds.

[0044] II. Proliferation culture The primary induced adventitious buds were cut into single buds (1-2 leaves remained) and inoculated into the proliferation culture medium.

[0045] Culture medium formula 1: ammonium nitrate (400 mg / L) + magnesium sulfate heptahydrate (370 mg / L) + potassium dihydrogen phosphate (170 mg / L) + calcium nitrate tetrahydrate (695 mg / L) + potassium nitrate (190 mg / L) + boric acid (6.2 mg / L) + copper sulfate pentahydrate (0.25 mg / L) + sodium molybdate dihydrate (0.25 mg / L) + zinc sulfate heptahydrate (8.6 mg / L) + glycine (2 mg / L) + inositol (100 mg / L) + nicotinic acid (0.5 mg / L) + VB6 (0.5 mg / L) + VB1 (1 mg / L) + sucrose (25 g / L) + agar powder (5.9 g / L) + ZT (0.4 mg / L) + EDTA (35 mg / L) + EDDHA (i.e., N,N'-ethyl bis(2-[2-hydroxyphenyl] glycine, 1 mg / L), pH adjusted to 5.2-5.4; Culture medium formula 2: calcium nitrate tetrahydrate (556 mg / L) + calcium chloride (72.5 mg / L) + potassium dihydrogen phosphate (170 mg / L) + potassium sulfate (990 mg / L) + anhydrous magnesium sulfate (180.54 mg / L) + copper sulfate pentahydrate (0.125 mg / L) + cobalt chloride hexahydrate (0.025 mg / L) + boric acid (6.2 mg / L) + manganese sulfate monohydrate (22.5 mg / L) + sodium molybdate dihydrate (0.25 mg / L) + zinc sulfate heptahydrate (9 mg / L) + nicotinic acid (0.5 mg / L) + inositol (100 mg / L) + glycine (2 mg / L) + VB6 (0.5 mg / L) + VB1 (1 mg / L) + EDDHA (53 mg / L) + EDTA (37 mg / L) + ZT (0.4 mg / L) + IBA (0.04 mg / L) + sucrose (25 g / L) + agar powder (5.9 g / L), pH adjusted to 5.2-5.4.

[0046] The foregoing single buds were inoculated into culture medium formula 1, and the culture conditions were: temperature 25±1°C, light intensity 2500 lux, light time 14 h / d, and the plant tissues were inoculated into culture medium formula 2 after being cultured for 30-35 d under the above conditions, and the culture conditions were: temperature 25±1°C, light intensity 2500 lux, light time 14 h / d, and the proliferated single seedlings were obtained after being cultured for 30-35 d, and the proliferation coefficient was maintained at 3.5-4.0, and the genetic variation rate of the seedlings was ensured to be ≤1% by flow cytometry detection. Figure 2 One of the photos of the proliferated blueberry seedlings.

[0047] Step four: rooting culture and acclimatization of the detoxified vaccine I. Rooting culture Select the healthy single seedlings with height of 4-5 cm and expanded leaves from the proliferation culture, inoculate into the rooting culture medium, and the rooting culture medium is formulated as follows: 1 / 2 WPM medium+IBA (0.5 mg / L)+NAA (0.05 mg / L)+sucrose (18 g / L)+agar (7 g / L)+activated carbon (0.5 g / L), and the pH is adjusted to 5.2-5.4; the culture conditions are as follows: temperature 23±1℃, light intensity 3000 lux, light time 16 h / d, culture for 20-25 d, and the culture is stopped when the root length reaches 2-3 cm and the lateral roots are 3-5; the rooting rate is 91%. One of the photos of the rooted seedlings is shown in Figure 3 .

[0048] II. Acclimatization and transplanting Transfer the rooted seedlings to the greenhouse (temperature 20-25℃, humidity 70%-80%) together with the culture bottle, acclimatize for 3-5 d, spray sterile water (5-10 mL each time) into the bottle once a day during the acclimatization; after the acclimatization, take out the seedlings, wash the roots with sterile water, transplant into the sterilized substrate (peat soil: perlite: vermiculite = 3:1:1 by weight, sterilized at 121℃ for 30 min in advance), cover the seedlings with the shading net with a shading rate of 50% after the transplanting, keep the substrate moist (water content 60%-70%), and the transplanting survival rate is 86%; the same method as in step one is used to detect the contents of blueberry red ring spot virus, tomato ring spot virus and blueberry brown ring spot virus in the leaves of the plants, and no virus is detected. The whole plant morphology is shown in Figure 4 .

[0049] It can be known from the technical common sense that the present application can be realized through other embodiments without departing from the spirit or essential characteristics thereof. Therefore, the above disclosed embodiments are only illustrative in all aspects, and are not the only ones. All changes within the scope of the present application or within the scope equivalent to the present application are included in the present application.

Claims

1. A method for culturing blueberry virus-free seedlings, the method comprising the following steps: S1: obtaining a blueberry branch with a bud; S2: disinfecting the blueberry branch to obtain a disinfected blueberry branch; S3: peeling off the outer leaves of the bud of the disinfected blueberry branch to expose the inner growing point, thereby obtaining a bud with an exposed growing point; S4: pre-treating the bud with the exposed growing point at low temperature to obtain a low-temperature pre-treated bud; the low-temperature pre-treatment is performed at a temperature of 3.5-4.5 ℃ and a humidity of 60-70%, in the dark, for 60-84 h; S5: gradient heat-treating the low-temperature pre-treated bud to obtain a gradient heat-treated bud; the gradient heat-treatment is performed as follows: for 1-3 days: at a temperature of 29-31 ℃, an illumination intensity of 1800-2200 lux, and an illumination time of 10-14 h / d; for 4-7 days: at a temperature of 34-36 ℃, an illumination intensity of 2200-2700 lux, and an illumination time of 10-14 h / d; for 8-14 days: at a temperature of 37-39 ℃, an illumination intensity of 3300-3800 lux, and an illumination time of 10-14 h / d; S6: peeling off the stem tip meristem of the gradient heat-treated bud to obtain a blueberry stem tip, each of which contains 1-5 leaf primordia; S7: culturing the blueberry stem tip in an adventitious bud culture medium to obtain a blueberry adventitious bud; S8: proliferating the blueberry adventitious bud to obtain a blueberry single seedling; S9: rooting the blueberry single seedling to obtain a blueberry plant.

2. The culture method according to claim 1, wherein The method further comprises acclimatizing and transplanting the blueberry plant.

3. The culturing method according to claim 1, wherein The blueberry is Duke.

4. The culturing method according to claim 1, wherein In S1, the number of buds is 1-8.

5. The culturing method according to claim 1, wherein In S2, the disinfection comprises the following steps: rinsing the blueberry branch with running water for 25-30 min, immersing it in a 70-80 v / v% ethanol aqueous solution for 30-40 s, immersing it in a 0.08-0.12 w / w% mercury chloride aqueous solution for 8-10 min, and rinsing it with sterile water for 5-6 times, and then absorbing the surface moisture.

6. The culturing method according to claim 1, wherein After S6, the blueberry stem tip is immersed in a low-temperature protective agent at 3-5 ℃ for 30-50 min; the low-temperature protective agent is based on an MS basic medium and further contains 80-120 g / L DMSO, 40-60 g / L sucrose, and 0.8-1.2 g / L vitamin C.

7. The culturing method according to claim 1, wherein In S7, the step of culturing the blueberry stem tip in an adventitious bud culture medium is as follows: the adventitious bud culture medium is based on a WPM medium and further contains 0.4-0.6 mg / L 6-BA, 0.08-0.12 mg / L NAA, 25-35 g / L sucrose, 6-8 g / L agar, and 0.4-0.6 g / L activated carbon, and has a pH of 5.4-5.6; the culture conditions are as follows: a temperature of 24-26 ℃, an illumination intensity of 2000-3000 lux, an illumination time of 12-16 h / d, and a culture time of 30-35 d.

8. The culturing method according to claim 1, wherein In S8, the step of proliferating culture is that the single bud of the blueberry adventitious bud is inoculated into proliferating culture medium 1, and the culture condition is that the temperature is 24-26°C, the light intensity is 2000-3000 lux, the light time is 12-16 h / d, and the culture time is 30-35 d, then the plant tissue is inoculated into proliferating culture medium 2, and the culture condition is that the temperature is 24-26°C, the light intensity is 2000-3000 lux, the light time is 12-16 h / d, and the culture time is 30-35 d; The formula of the proliferating culture medium 1 is that 400 mg / L of ammonium nitrate, 370 mg / L of magnesium sulfate heptahydrate, 170 mg / L of potassium dihydrogen phosphate, 695 mg / L of calcium nitrate tetrahydrate, 190 mg / L of potassium nitrate, 6.2 mg / L of boric acid, 0.25 mg / L of copper sulfate pentahydrate, 0.25 mg / L of sodium molybdate dihydrate, 8.6 mg / L of zinc sulfate heptahydrate, 2 mg / L of glycine, 100 mg / L of inositol, 0.5 mg / L of nicotinic acid, 0.5 mg / L of VB6, 1 mg / L of VB1, 25 g / L of sucrose, 5.9 g / L of agar, 0.4 mg / L of ZT, 35 mg / L of EDTA and 1 mg / L of EDDHA, and the pH value is 5.2-5.4; The formula of the proliferating culture medium 2 is that 556 mg / L of calcium nitrate tetrahydrate, 72.5 mg / L of calcium chloride, 170 mg / L of potassium dihydrogen phosphate, 990 mg / L of potassium sulfate, 180.54 mg / L of anhydrous magnesium sulfate, 0.125 mg / L of copper sulfate pentahydrate, 0.025 mg / L of cobalt chloride hexahydrate, 6.2 mg / L of boric acid, 22.5 mg / L of manganese sulfate monohydrate, 0.25 mg / L of sodium molybdate dihydrate, 9 mg / L of zinc sulfate heptahydrate, 0.5 mg / L of nicotinic acid, 100 mg / L of inositol, 2 mg / L of glycine, 0.5 mg / L of VB6, 1 mg / L of VB1, 53 mg / L of EDDHA, 37 mg / L of EDTA, 0.4 mg / L of ZT, 0.04 mg / L of IBA, 25 g / L of sucrose, and 5.9 g / L of agar, and the pH value is 5.2-5.

4.

9. The culturing method according to claim 1, wherein In S9, the step of rooting culture is that the blueberry single seedling is inoculated into rooting culture medium, and the blueberry plant with buds and roots is obtained; The formula of the rooting culture medium is that 1 / 2 WPM medium is taken as the base, and 0.4-0.6 mg / L of IBA, 0.04-0.06 mg / L of NAA, 16-20 g / L of sucrose, 6-8 g / L of agar and 0.4-0.6 g / L of activated carbon are further contained, and the pH value is adjusted to 5.2-5.4; The culture condition is that the temperature is 22-24°C, the light intensity is 25000-3500 lux, the light time is 14-18 h / d, and the culture time is 20-25 d. The step of hardening and transplanting is that the blueberry plant is transferred to the condition of temperature 20-25°C and humidity 70%-80% for 3-5 d of hardening; 10. The culturing method according to claim 1, wherein ​ ​ After hardening off, the seedlings are transplanted into sterilized substrate, maintaining a water content of 60-70%. After hardening off, the seedlings are transplanted into sterilized substrate, maintaining a water content of 60-70%.