Application of Rottlerin in preparation of medicine for preventing and treating nervous necrosis virus

Abstract

The invention discloses an application of Rottlerin in preparation of a medicine for preventing and treating nervous necrosis virus. According to the application disclosed by the invention, the fact that the rotinidin has high binding energy to RGNNV capsid protein is found, the rotinidin without toxic concentration is selected to carry out an RGNNV virus infected cell experiment, and the result shows that the rotinidin inhibits the replication of the RGNNV virus in a dose-dependent manner. The safe dosage of Rottlerin is obtained according to the survival rate of zebrafish treated with different doses, the influence of Rottlerin on the survival rate of zebrafish infected with RGNNV is researched, and finally it is proved that Rottlerin has a remarkable treatment effect on zebrafish infected with RGNNV. Rottlerin provides a new natural small molecule drug choice for prevention and treatment of VNN diseases, and has important research and development value and development significance for prevention and treatment of nervous necrosis viruses.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of aquaculture, and particularly relates to application of Rottlerin in preparation of a medicine for preventing and treating nervous necrosis virus. BACKGROUND

[0002] Nervous necrosis virus (NNV) is the pathogen of viral nervous necrosis (VNN), which is also known as viral encephalopathy and retinopathy (VER). The disease was first reported in Australia and the Caribbean in the late 1980s. NNV has a high mortality rate and a wide range of infection, and has been isolated and identified from at least 70 species of aquatic animals in marine and freshwater environments around the world, causing serious economic losses to the aquaculture industry worldwide. NNV belongs to the beta-nodavirus genus of the nodaviridae family, and is a small non-enveloped virus with icosahedral symmetry, with a diameter of about 25-30 nm. The viral genome consists of two single-stranded positive-sense RNAs, of which the large RNA1 consists of about 3100 nucleotides and encodes RNA-dependent RNA-polymeras (RdRp), and the small RNA2 encodes the only structural protein capsid protein (CP). There are four recognized types of NNV: red-spotted grouper nervous necrosis virus (RGNNV), barfin flounder nervous necrosis virus (BFNNV), tiger puffer nervous necrosis virus (TPNNV) and striped jack nervous necrosis virus (SJNNV), of which RGNNV infection is the most serious. At present, there are limited vaccines for the treatment and control of NNV, and traditional chemical antiviral drugs have inherent defects such as narrow spectrum of action, significant biological toxicity and easy induction of drug resistance, which greatly restricts the therapeutic effect and poses a serious risk to public health and food safety. Under this background, natural sources of antiviral active substances have become an important direction for new drug research and development due to their diverse mechanisms of action and fewer side effects. Therefore, it is urgent to study new therapeutic drugs and antiviral targets for RGNNV infection.

[0003] Rottlerin, the structure of which is shown as follows:

[0004]

[0005] Its CAS No: 82-08-6 is a natural polyphenolic compound extracted from Mallotus philippensis of Euphorbiaceae, which is initially considered as a specific inhibitor of protein kinase C delta (PKC delta). Because it also has anti-inflammatory, antioxidant, antitumor, antibacterial and other biological properties, it has a great impact on drug development and medical field. SUMMARY

[0006] The application provides an application of Rottlerin or a pharmaceutically acceptable salt thereof in preparation of a medicine for preventing and treating a nervous necrosis virus.

[0007] Preferably, the nervous necrosis virus is a fish nervous necrosis virus, which can be a grouper nervous necrosis virus, and further can be a red-spotted grouper nervous necrosis virus.

[0008] Preferably, the medicine takes Rottlerin as an active ingredient, and further comprises an acceptable auxiliary ingredient.

[0009] Preferably, the medicine can be an oral medicine or an injection medicine, and the dosage form of the medicine comprises at least one of a tablet, a capsule, a powder, a granule, a pill, a solution and the like.

[0010] The application further provides a medicine for preventing and treating a nervous necrosis virus, which contains Rottlerin or a pharmaceutically acceptable salt thereof as an active ingredient.

[0011] The application finds that Rottlerin has high binding energy to RGNNV capsid protein, and the RGNNV virus infection cell experiment is carried out by selecting a non-toxic concentration of Rottlerin, and the result shows that Rottlerin dose-dependently inhibits the replication of RGNNV virus. Rottlerin provides a new natural small molecule drug selection for prevention and treatment of VNN disease, and has important research and development value and development significance for preventing and treating a nervous necrosis virus. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Rottlerin is a biological property of Rottlerin, (A) a chemical structural formula of Rottlerin (B) Rottlerin has high affinity to RGNNV-CP protein;

[0013] Figure 2 is CCK8 detection of the activity change of GK cells after Rottlerin treatment;

[0014] Figure 3Is the effect of Rottlerin on RGNNV viral gene transcription, (A) Rottlerin inhibits RGNNV viral gene transcription at different time points (B) Rottlerin concentration gradient-dependent inhibition of RGNNV CP and RdRp gene transcription levels;

[0015] Figure 4 Is Rottlerin inhibits RGNNV viral CP protein expression in GK cells;

[0016] Figure 5 Is the effect of Rottlerin treatment on the viral load of RGNNV in cell supernatant;

[0017] Figure 6 Is Rottlerin does not affect the entry of RGNNV into cells, (A) Laser confocal microscopy observation of fluorescent virus particles entering cells after Rottlerin treatment (B) Quantitative analysis of the change of fluorescence intensity in cells after Rottlerin treatment;

[0018] Figure 7 Rottlerin different treatment methods can inhibit RGNNV viral replication, (A) The effect of Rottlerin different treatment methods on RGNNV viral gene transcription (B) The effect of Rottlerin different treatment methods on viral CP protein expression;

[0019] Figure 8 Is the detection of the antiviral function of Rottlerin in zebrafish in vivo, (A) In vivo toxicity analysis of Rottlerin (B) Survival rate of infected zebrafish after Rottlerin treatment. DETAILED DESCRIPTION

[0020] The following examples are further illustrations of the present application and are not intended to limit the present application.

[0021] Example 1

[0022] I. Methods and Results:

[0023] 1. Chemical structure of Rottlerin and molecular docking analysis

[0024] Rottlerin was purchased from medchemexpress (HY-18980), and the chemical structure is as follows Figure 1As shown in Figure A, CP is the only capsid protein of RGNNV, participating in processes such as viral invasion and pathogen-host interactions, playing a crucial role in the RGNNV life cycle, and also serving as an important target for anti-RGNNV drug development. To assess whether Rottlerin has an affinity for the RGNNV CP protein, we performed molecular docking analysis. We obtained a binding model of the two proteins using Autodock Vina v.1.2.2 and derived the binding energy of their interaction. Figure 1 The results showed that Rottlerin (red) binds to CP protein (green) via hydrogen bonding and strong electrostatic interactions, with a low binding energy of -7.77 kcal / mol, indicating highly stable binding.

[0025] 2. CCK8 assay for cell viability

[0026] Grouper kidney (GK) cells were cultured in L15 medium (Gibco) containing 10% fetal bovine serum (ExCell Bio) and incubated at 28°C. One day prior to incubation, GK cells were seeded into 96-well plates. After 24 h of growth, different concentrations (0.01, 0.025, 0.05, 0.1, 0.25, 0.5, 0.75, 1 μM) of Rottlerin were added to each well for incubation. DMSO treatment served as a control. After another 48 h of culture, 10 μL of CCK8 reagent (Beyotime) was added to each well for incubation. The absorbance was measured at 540 nm using a microplate reader after 2 h. Figure 2 The results showed that Rottlerin was non-toxic to cells at concentrations of 0.01–0.5 μM, but began to exhibit toxic effects at 0.75 μM. Therefore, subsequent experiments will use concentrations of 0.5 μM and below.

[0027] 3. qRT-PCR quantitative detection of the effect of Rottlerin on RGNNV viral replication

[0028] GK cells were seeded in 24-well plates, and 24 h later, GK cells were incubated with 0.5 μΜ of Rottlerin, and 2 h later, RGNNV was added for infection (multiplicity of infection, MOI = 0.5). Cells were collected at 12 h and 24 h post-infection. To determine whether the inhibition of viral replication by Rottlerin was related to the concentration of Rottlerin, cells were incubated with different concentrations of Rottlerin (0.05, 0.2, 0.5 μΜ), and 2 h later, RGNNV was added for infection (MOI = 0.5). Cells were collected at 24 h post-infection. Total RNA was extracted using an RNA extraction kit (Foregene). Reverse transcription to synthesize cDNA was performed using a ReverTraAce qPCR RT Kit (TOYOBO) kit. qRT-PCR experiments were performed using a 2x SYBR Green Real-time PCR Mix (TOYOBO) kit on an LC480 fluorescent quantitative PCR instrument. The results are shown in Figure 3 A. Compared with the DMSO-treated control group, Rottlerin can significantly inhibit the transcription level of RGNNV CP and RdRp genes at 12 and 24 h post-RGNNV infection. In addition, the inhibition of RGNNV by Rottlerin is concentration gradient-dependent Figure 3 B).

[0029] 4. Western blot detection of the effect of Rottlerin on the expression of RGNNV CP protein

[0030] GK cells were seeded in 24-well plates, 24 h later, cells were incubated with 0.5 μΜ of Rottlerin, 2 h later, RGNNV (MOI = 0.5) virus was added for infection, 24 h post-infection, cells were collected, and lysed with protein lysis buffer (Thermo Scientific), centrifuged at 4 °C, 12,000 rpm for 3 min, the supernatant was taken and 5x protein loading buffer (Bi Yun Tian) was added, the protein samples were denatured by boiling in water for 5 min. The protein samples were loaded onto SDS-PAGE gels (Kai Ji Biological), the upper concentration gel was run at a constant voltage of 90 V for 25 min, and the lower separation gel was run at a constant voltage of 110 V for 50 min. Then the membrane was transferred at a constant current of 200 mA for 60 min. After the transfer, the PVDF membrane was rinsed with PBST (Bi Yun Tian) and then soaked in 5% skim milk powder for 2 h. Then the PVDF membrane was incubated with the primary antibody Rabbit-anti-CP, Rabbit-anti-tubulin (Wuhan Sanying) at 4 °C overnight. After PBST washing, the secondary antibody Anti-rabbit IgG HRP-linked antibody (Wuhan Sanying) was added for 1 hour incubation at room temperature, and then washed and Super ECL Plus (UElandy) was added for color development. The signal detection and image analysis were performed using a chemiluminescence imaging system in a gel imager. As shown in FIG. 8B, compared with DMSO treatment, Rottlerin can significantly inhibit the expression of RGNNV CP protein. Figure 4

[0031] 5. Absolute quantitative determination of the change in viral particle content in the supernatant of cells treated with Rottlerin

[0032] GK cells were seeded in 24-well plates, 24 h later, cells were incubated with 0.5 μΜ of Rottlerin, DMSO incubation as a control. 2 h later, RGNNV (MOI = 0.5) virus was added for infection, 24 h post-infection, cell supernatant was collected. After the supernatant samples were extracted for RNA and reverse transcribed into cDNA, qRT-PCR experiments were performed simultaneously with known concentrations of serially diluted CP plasmid (MW265974.1), RdRp plasmid (MW265973.1) standards. The formula: copies / μL = [plasmid concentration (ng / μL) x 10⁻ 9 ​] / [plasmid length (bp) x 660] x 6.022 x 10 23 Calculate the copy number of plasmid, according to the Ct value of each gradient of standard and the known copy number (take log 10 value) to generate standard curve: Log 10 (copy number) = -Slope x Ct + Intercept. Calculate the initial copy number of viral gene in each sample (cell supernatant cDNA) by standard curve. The final results are shown in Figure 5 As shown in Figure 8, compared with the control group DMSO treatment, Rottlerin incubation can significantly reduce the genomic copy number of viral CP gene and RdRp gene in GK cell supernatant.

[0033] 6, Rottlerin does not affect RGNNV virion into GK cells

[0034] In order to explore whether the inhibition of Rottlerin on RGNNV comes from affecting the entry of virus, we use Cy5 fluorescent modified nucleic acid aptamer B11 (Shengong Biosynthesis, sequence is 5'- TTCTTTTATTAGTTGATTTTTTTGATTTTGGCAGCTACTGCTTTGGGGGT-3') targeting RGNNV CP to specifically label RGNNV virion, and explore the effect of Rottlerin on RGNNV virion entering cells. After DMSO and Rottlerin (0.5 μM) incubate cells for 2 h, infect B11 fluorescent labeled RGNNV (MOI = 10), discard cell supernatant after 2 h, wash with PBS for 3 times, and then fix with 4% paraformaldehyde solution. Randomly take 80 cells in each group for observation by laser confocal microscope, and use ImageJ to quantitatively analyze the fluorescence intensity in cells. As shown in Figure 9, Rottlerin treatment does not significantly affect the entry of RGNNV virion into cells, indicating that the effect of Rottlerin may occur in the stage after RGNNV enters cells. Figure 6

[0035] 7, The effect of different Rottlerin treatment methods on RGNNV replication

[0036] ​Different drug treatment methods may act on different stages of virus replication. GK cells were treated by different drug treatment methods, pre-treatment group (Pre-Rottlerin): cells were pre-treated with 0.5 μM Rottlerin for 2 hours before virus infection. Co-treatment group (Co-Rottlerin): 0.5 μM Rottlerin was added to cells at the same time as RGNNV (MOI = 0.5). Post-treatment group (Post-Rottlerin): cells were infected with RGNNV for 2 hours, and then 0.5 μM Rottlerin was added. The replication level of RGNNV was detected by qRT-PCR and WB 24 hours after infection. The results are shown in Figure 7 Compared with the DMSO-treated control group, Rottlerin can inhibit the transcription level of RGNNV CP and RdRp genes and the expression level of CP protein under the three different treatment methods, showing good prevention and treatment effect.

[0037] 8. Effect of Rottlerin on the survival rate of zebrafish infected with RGNNV

[0038] In view of the strong anti-RGNNV virus effect of Rottlerin in vitro, in order to further explore its anti-virus ability in vivo, the protective effect of Rottlerin on RGNNV-infected zebrafish was evaluated. 3cm zebrafish were randomly divided into 5 groups, 20 fish per group, and raised in 5L water tanks. Rottlerin at 4 different doses (5mg / kg, 10mg / kg, 20mg / kg, 40mg / kg) was evenly mixed into the feed to feed the zebrafish, and the control group was fed with feed without Rottlerin. The toxicity of Rottlerin on zebrafish was detected. The zebrafish were observed for 7 days, and the mortality was recorded every day to determine the safe dose of Rottlerin in zebrafish. Figure 8 A is the survival of zebrafish after ingesting different amounts of Rottlerin within 7 days, as shown in the figure. When the dose of ingested Rottlerin is 5mg / kg, 10mg / kg, 20mg / kg and 40mg / kg, the survival rate of zebrafish is 95%, 90%, 65% and 15% respectively. The survival rate of zebrafish greater than or equal to 90% corresponds to the safe dose of Rottlerin, and the maximum value of 10mg / kg is selected as the safe dose for subsequent experiments. In the anti-virus experiment, 3cm zebrafish were randomly divided into 3 groups, 20 fish per group, and raised in 5L water tanks. The control group was fed with feed without Rottlerin, and the simple virus infection group was incubated with RGNNV by immersion method, and the infection amount was 10 3TCID50 / fish, daily feeding of feed without Rottlerin. The Rottlerin treatment group incubated RGNNV for 10 3 TCID50 / fish, and 10 mg / kg body weight of Rottlerin-containing feed was fed to each zebrafish daily. The survival rate of zebrafish was observed and recorded daily. As shown in the results of Figure 8 As shown in the results of B, the in vivo experimental results showed that the survival rate of zebrafish after RGNNV infection for 7 days was only 15%; while feeding 10 mg / kg Rottlerin could significantly improve its survival rate to 60%, which increased by 45 percentage points. This fully proves that Rottlerin can effectively inhibit RGNNV virus infection in zebrafish in vivo, highlighting the great potential of Rottlerin as an anti-RGNNV virus candidate drug.

Claims

1. Use of Rottlerin or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and treating a nervous necrosis virus.

2. Use according to claim 1, characterized in that, The nervous necrosis virus is a fish nervous necrosis virus.

3. Use according to claim 2, characterized in that, The nervous necrosis virus is a grouper nervous necrosis virus.

4. Use according to claim 3, characterized in that, The nervous necrosis virus is a red-spotted grouper nervous necrosis virus.

5. The use according to claim 1, characterized in that, The medicament comprises Rottlerin as an active ingredient, and further comprises an acceptable adjuvant or auxiliary ingredient.

6. Use according to claim 1, characterized in that, The medicament is an oral medicament or an injection medicament.

7. Use according to claim 6, characterized in that, The dosage form of the medicament comprises at least one of a tablet, a capsule, a powder, a granule, a pill, and a solution.

8. A medicament for preventing and treating neuropathogenic virus, characterized by comprising the compound of claim 1. Rottlerin or a pharmaceutically acceptable salt thereof is used as an active ingredient.

Images