Plant vesicle delivery circRNA-BMP2 system as well as preparation method and application thereof

Abstract

The invention discloses a circRNA-BMP2 delivery system for plant vesicles as well as a preparation method and application of the circRNA-BMP2 delivery system, and belongs to the technical field of biomedicine. According to the invention, the gastrodia elata vesicles are taken as a delivery carrier of circRNA-BMP2 and are fixed on the surface of the micro-arc oxidation implant, so that double-effect synergistic improvement of diabetes mellitus osseointegration is realized. Due to the beneficial components and the unique hollow biological membrane structure, the gastrodia elata vesicles are considered as potential candidate drugs for treating diseases, the plant-derived phospholipid structure of the gastrodia elata vesicles endows circRNA with a long-acting protection effect, and the risk of DNA insertion mutation is avoided. Meanwhile, the large-scale production cost of the gastrodia elata vesicles is reduced, and the gastrodia elata vesicles are free of animal The system breaks through the bottlenecks of short osteogenic factor release period, poor targeting property and unregulated inflammation microenvironment in the prior art, solves the problem that the inflammation microenvironment damages bone metabolism balance in a diabetic environment, and realizes long-acting slow release and stable expression of drugs.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a plant vesicle delivery system for circRNA-BMP2, its preparation method, and its applications. Background Technology

[0002] As the supporting structure of the human body, the skeleton plays a vital role in protecting various organs. Although bone tissue possesses a certain degree of self-repair capability, effectively repairing bone defects caused by inflammation, tumors, and age-related diseases remains a significant clinical challenge. To explore suitable in-situ bone regeneration strategies, various tissue-engineered cells, exosomes, and functional biomaterials have been developed.

[0003] Traditional delivery vectors such as liposomes / exosomes suffer from poor targeting, high immunogenicity, or low yield.

[0004] Extracellular vesicles are a type of vesicle encapsulated by a lipid membrane, containing bioactive macromolecules such as proteins, lipids, and nucleic acids. Secreted by cells into the apoplast, they are crucial for intercellular communication. Plant extracellular vesicles are rich in bioactive substances such as nucleic acids and proteins. Compared to animal-derived extracellular vesicles, plant extracellular vesicles, derived from edible plants, are not only non-toxic but also have high yields, good biocompatibility, and are non-immunogenic. Studies have shown that extracellular vesicles extracted from various edible plants possess multiple therapeutic effects, including anti-inflammatory, anticancer, antiviral, and antioxidant properties, and have the potential to be developed into pharmaceutical preparations for the effective treatment of a range of diseases.

[0005] Cellular RNA plays a crucial regulatory role in physiological and pathological environments. Therefore, exploring the specific RNA expression profiles of various disease states and investigating their pathogenic mechanisms holds promise for identifying specific RNAs as candidate biomarkers and potential therapeutic targets. Linear mRNAs have short half-lives, and DNA delivery carries the risk of insertional mutations. In addition to mRNA, many non-coding RNAs (ncRNAs) or circular RNAs (circRNAs) synergistically control gene expression, constituting diverse potential targets for drug development. However, RNA drugs are easily degraded in the bloodstream and must cross the cell membrane barrier to reach intracellular targets. Furthermore, RNA drugs typically require vector delivery, and while extensive chemical modifications can improve RNA stability, they also pose a risk of inducing immunogenic reactions, limiting their clinical application.

[0006] The high-sugar microenvironment in diabetes triggers chronic inflammation, which further inhibits bone regeneration. Current technologies do not specifically regulate inflammatory pathways.

[0007] Micro-arc oxidation implants only provide a physically porous structure and lack synergistic bioactivity regulation functions. Summary of the Invention

[0008] The purpose of this invention is to provide a plant vesicle delivery system for circRNA-BMP2, its preparation method, and its applications, to address the problems existing in the prior art. The plant vesicle delivery system for circRNA-BMP2 provided by this invention overcomes the bottlenecks of short osteogenic factor release cycles, poor targeting, and unregulated inflammatory microenvironment in the prior art.

[0009] To achieve the above objectives, the present invention provides the following solution:

[0010] In a first aspect, the present invention provides a plant vesicle delivery system for circRNA-BMP2, comprising a metal matrix, plant vesicles, and circRNA-BMP2 loaded within the plant vesicles; the plant vesicles and the circRNA-BMP2 loaded within the plant vesicles are mixed and drop-coated onto the surface of the metal matrix.

[0011] Preferably, the plant vesicles are Gastrodia elata vesicles.

[0012] Preferably, the method for synthesizing circRNA-BMP2 is as follows: constructing linear RNA-BMP2 containing IRES element and m6A modification, catalyzing the linear RNA cyclization reaction with T4 RNALigase 2, digesting and removing the linear RNA with RNase R, and obtaining circRNA-BMP2 by extraction and purification.

[0013] Preferably, the metal substrate is a porous titanium dioxide implant.

[0014] Secondly, the present invention also provides a method for preparing the plant vesicle delivery circRNA-BMP2 system, comprising the following steps:

[0015] Plant vesicles were obtained by pulverizing and centrifuging the plant.

[0016] Synthesize circRNA-BMP2;

[0017] Plant vesicles and circRNA-BMP2 were mixed at a volume ratio of (1:3) to (1:5), and the mixture was subjected to ice bath, sonication, gradient extrusion, and centrifugation to obtain the drug-loaded complex GVs@circBMP2. The obtained drug-loaded complex GVs@circBMP2 was dissolved in a solvent to obtain a suspension of drug-loaded complex GVs@circBMP2.

[0018] The plant vesicle delivery system for circRNA-BMP2 was obtained by drop-coating the drug-loaded complex GVs@circBMP2 suspension onto the surface of a metal substrate and incubating for 6-12 hours.

[0019] Preferably, the plant is Gastrodia elata; and the metal matrix is ​​a porous titanium dioxide implant.

[0020] Preferably, the step of synthesizing circRNA-BMP2 includes: constructing linear RNA-BMP2 containing IRES elements and m6A modification, catalyzing the linear RNA cyclization reaction with T4 RNA Ligase 2, digesting and removing the linear RNA with RNase R, and obtaining circRNA-BMP2 by extraction and purification.

[0021] Preferably, the gastrodia vesicles are mixed with circRNA-BMP2 at a volume ratio of 1:3, incubated on ice for 15-20 min, and then subjected to sonication, gradient extrusion and ultrafiltration centrifugation to obtain the drug-loaded complex GVs@circBMP2. The obtained drug-loaded complex GVs@circBMP2 is dissolved in a solvent to obtain a drug-loaded complex GVs@circBMP2 suspension.

[0022] The drug-loaded complex GVs@circBMP2 suspension was drop-coated onto the surface of a porous titanium dioxide implant and incubated at 37°C for 6 hours to obtain a plant vesicle delivery system for circRNA-BMP2.

[0023] Preferably, the concentration of the Gastrodia elata vesicles is 0.5-1×10 when the Gastrodia elata vesicles are mixed with the circRNA-BMP2. 12 The concentration of circRNA-BMP2 was 0.1-0.9 mg / mL.

[0024] Thirdly, the present invention also provides the application of the plant vesicle delivery circRNA-BMP2 system in the preparation of orthopedic materials.

[0025] The present invention discloses the following technical effects:

[0026] This invention achieves a dual-effect synergistic enhancement of osteointegration in diabetes by using Gastrodia elata vesicles as a delivery carrier for circRNA-BMP2 and immobilizing them on the surface of micro-arc oxidation implants. The natural anti-inflammatory components of Gastrodia elata vesicles (such as gastrodin) can inhibit inflammatory factors such as TNF-α, significantly improving the pathological microenvironment of diabetes; its plant-derived phospholipid structure endows circRNA with long-term protective effects and avoids the risk of DNA insertion mutations. Simultaneously, the large-scale production cost of Gastrodia elata vesicles is reduced, and there are no animal-derived immune risks. In a diabetic model, this system overcomes the bottlenecks of existing technologies, such as short release cycles of osteogenic factors, poor targeting, and unregulated inflammatory microenvironment. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Western blot was used to detect the expression level of BMP2 in BMSCs after transfection with circRNA-BMP2;

[0029] Figure 2 The results are shown in Transmission Electron Microscopy (A) and Particle Size Analysis (B); GVS represents the results of Gastrodia elata vesicles, and C-GVS represents the results of Gastrodia elata vesicles loaded with circRNA-BMP2.

[0030] Figure 3 Scanning electron microscope image of the implant surface;

[0031] Figure 4 To verify the osteogenic effect using alkaline phosphatase and alizarin red staining;

[0032] Figure 5 Image showing the ALPL immunofluorescence results;

[0033] Figure 6 This study analyzed the morphometric parameters of animal tissues; where A represents the bone volume / total volume ratio (BV / TV) parameter analysis, and B represents the trabecular bone thickness (Tb.Th) parameter analysis. Detailed Implementation

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0039] BMP2 full-length cDNA sequence (SEQ ID NO.1): atggtggccgggacccgctgtcttctagtgttgctgcttccccaggtCctcctgggcggcgcggccggcctcattccggagctgggccgcaagaagttcgccggggcatccggccgccccttgtcccggccttcggacgacgtcctcagcgagtttgagttgaggctgctcagcatgtttggcctgaagcagagacccacccccagcaaggacgtcgtggtgcccccctatatgctcgacctgtaccgccggcactcgggccagccaggagcgcccgccccagaccaccggctggagagggcagccagccgcgccaacaccgtgcgcagcttccatcacgaagaagccatcgaggaacttccagaaatgagtgggaaaacgtcccgacgcttcttcttcaatttaagttctgtccctactgatgagtttctcacatctgcggagctccagatttttcgggaacaaatgcaggaagctttgggaaatagtagtttccagcaccgaattaatatttatgaaattataaagcctgccacagccagctcaaaatttcctgtgaccagactattggacaccaggttagtgactcagaacacaagtcagtgggagagctttgatgtcaccccggctgtgatgcgatggacagcacagggacacaccaaccatgggtttgtggtggaagtggcccacttagaggagaagccaggtgtctccaagagacatgtgaggattagcaggtctttgcaccaagatgaacacagctggtctcaggtaagaccactgctagtgacttttggccacgacggaaaaggacatccactccacaaacgagaaaagcgtcaagccaaacacaaacagcggaagcgtcttaagtccagctgcaaaaggcaccctttgtatgtggacttcagtgatgtggggtggaatgactggatcgtggcccctccaggctatcatgccttttactgccatggggaatgtccttttcccctggctgatcacctga;

[0040] IRES sequence (SEQ ID NO. 2): actccaccaaccatgccatagtgcagactctggtaaactctgtgaattccaaaatcccta aggcatgctgtgtccccactgagcttagcgcaatctccatgttgtacctagatgaaaacgaaaaggttgtgctaaaaaactatcaggacatggttg tggagggttgcgggtgtcgctag.

[0041] Example 1: Circular RNA Design

[0042] We constructed circRNA-BMP2 containing IRES elements and m6A modification to resist RNase degradation and achieve rolling circle translation.

[0043] The nucleotide sequence of the full-length BMP2 cDNA is shown in SEQ ID NO.1, and the nucleotide sequence of IRES is shown in SEQ ID NO.2.

[0044] A linear RNA precursor containing IRES and BMP2 cDNA was designed and synthesized, and m6A modification was introduced to enhance stability, thereby obtaining linear RNA-BMP2 containing IRES elements and m6A modification.

[0045] A linearized DNA template with the sequence structure 5'-[IRES]-[BMP2 cDNA]-3' was synthesized by Nanjing GenScript Technology Co., Ltd. Subsequent experimental steps were as follows: An in vitro transcription reaction system was constructed. A standardized 100 μL reaction system was as follows: First, 10 μL of 10×T7 Transcription Buffer was added, followed by 16 μL of a NTP mixture (containing ATP, CTP, UTP, and GTP, with a final concentration of 4 mM for each nucleotide). The introduction of m6A modification was achieved by partially replacing ordinary ATP (subtracting the corresponding volume of ATP stock solution and replacing it with an equimolar concentration of N6-Methyl-ATP (m6A-ATP) stock solution, prepared as follows: 16 μL of 25 mM CTP, 16 μL of 25 mM UTP, 16 μL of 25 mM GTP, 12 μL of 25 mM ordinary ATP, and 4 μL of 25 mM... Add 1-2 μg of linearized DNA template (m6A-ATP) and bring the volume up to approximately 90 μL with RNase-free water. Gently mix, then add 2 μL (approximately 200 U) of high-concentration T7 RNA Polymerase and 1 μL (40 U) of RNase Inhibitor to protect the nascent RNA strands. Finally, bring the reaction volume to 100 μL.

[0046] After adding the sample, gently mix with a pipette and briefly centrifuge to collect the droplet at the bottom of the tube. Incubate the reaction in a 37°C water bath or incubator for 2 to 4 hours. After transcription, to completely remove the DNA template, add 2 μL of RNase-free DNase I (10 U) directly to the system and continue incubation at 37°C for 15-30 minutes.

[0047] The purification process begins with extraction using an equal volume (approximately 100 μL) of an acidic phenol:chloroform:isoamyl alcohol mixture (125:24:1, pH≈4.5). After vigorous vortexing, the mixture is centrifuged at 12,000 g for 10 minutes at room temperature to ensure complete phase separation. The upper aqueous phase (containing RNA) is carefully aspirated into a new tube, and 1 / 10 volume (approximately 10 μL) of 3M sodium acetate (pH 5.2) and 2.5 volumes (approximately 250 μL) of pre-chilled anhydrous ethanol are added. The mixture is then incubated at -80°C for at least 30 minutes or overnight to precipitate the RNA. Subsequently, the tube is centrifuged at 4°C at its highest speed for 30 minutes, the supernatant is discarded, and the precipitate is washed with 500 μL of pre-chilled 70% ethanol to remove salts. After another 5 minutes of centrifugation, the ethanol is discarded, and the tube is air-dried in a laminar flow hood for 5-10 minutes (do not over-dry) to obtain the linear RNA precipitate.

[0048] Linear RNA containing IRES elements and modified m6A, precipitated as BMP2 (1 μg) using T4 RNA Ligase 2 (20 U), was cyclized in a buffer system containing 15% PEG8000, 10% DMSO and 1 mM ATP, reacted at 16 °C for 4 h, and then at 25 °C for 1 h. Subsequently, RNase R (3 U / μg RNA) was added and digested at 37 °C for 30 min to remove linear RNA. The RNA was then purified by acid phenol-chloroform extraction and ethanol precipitation.

[0049]

[0050] Functional validation: Transfection into BMSCs cells. The specific steps are as follows: BMSCs in the logarithmic growth phase with 60-70% confluence were seeded in culture plates and incubated overnight. Lipofectamine 3000 transfection reagent was used to mix circRNA-BMP2 with circRNA-BMP2 in serum-free medium (4 μg circRNA-BMP2 and 6 μL Lipofectamine 3000 reagent added to 125 μL of medium). The mixture was incubated at room temperature for 15-20 minutes to form a complex. This complex was then added to cells in Opti-MEM medium, gently mixed, and incubated at 37°C. After 4-6 hours, the medium was replaced with complete medium to reduce toxicity. Transfection was performed 24-72 hours later. Western blot was used to detect BMP2 protein expression. Simultaneously, mRNA-BMP2 transfection was used as a control group for comparison (synthesized by Nanjing GenScript Technology Co., Ltd.).

[0051] Experimental results: The expression level of BMP2 in BMSCs after transfection is shown in the figure. Figure 1 ,Depend on Figure 1 It can be seen that the expression level of BMP2 protein in cells after transfection was significantly higher than that in the mRNA-BMP2 group (CON group), proving that the translation and expression efficiency of circRNA-BMP2 in cells is higher than that of linear RNA.

[0052] Example 2: Extraction of Gastrodia elata vesicles (GVs) and preparation of the drug-loaded complex GVs@circBMP2

[0053] Fresh Gastrodia elata tubers were selected, washed with sterile PBS buffer, and mechanically pulverized into a homogenate. The homogenate was then subjected to staged differential centrifugation at 4°C: first, low-speed centrifugation (4000g, 20min) was used to remove tissue fragments; the supernatant was then centrifuged at medium speed (10000g, 30min) to separate organelles and impurities; and finally, the precipitate was collected by ultracentrifugation (100000g, 1h) to obtain pure Gastrodia elata vesicles (GVs), which were then resuspended in physiological saline for later use.

[0054] The drug-loaded complex was prepared by ultrasonic extrusion: Gastrodia elata vesicles (GVs, 1×10⁻⁶) were extruded. 12The drug-loaded complex GVs@circBMP2 was mixed at a 1:3 volume ratio with circRNA-BMP2 solution (0.5 mg / mL) in HEPES buffer (pH 7.4) containing 10 mM MgCl2 and incubated on ice for 15 minutes. Then, it was intermittently sonicated on ice for a total of 60 seconds (10-second pulse / 10-second interval) using a probe sonicator (120 W power, 50% duty cycle). After sonication, the mixture was sequentially subjected to a gradient extrusion through 400 nm, 200 nm, and 100 nm polycarbonate membranes (pressure 1.0–1.5 MPa, 30 times). Finally, it was subjected to 100 kDa ultrafiltration centrifugation (14,000 × g, 30 minutes, 3 times) to remove free RNA, obtaining the drug-loaded complex GVs@circBMP2, all at 4°C. The particle size and morphological integrity of the complex were characterized by dynamic light scattering (DLS) and transmission electron microscopy (TEM), and the drug loading rate was determined by nucleic acid quantification.

[0055] Dynamic light scattering (DLS) and transmission electron microscopy (TEM) characterization results: See below Figure 2 ,Depend on Figure 2 It can be seen that the vesicles have uniform particle size, ranging from 100 to 200 nm, and the particle size increases after loading circBMP2.

[0056] Example 3: Functionalization of Implant Surface

[0057] Remove oil, grease, dust, natural oxide film, and processing-deteriorated layer from the surface of the titanium implant, wash and dry it, and then perform micro-arc oxidation (MAO) treatment on the pretreated implant.

[0058] Electrolyte preparation: a deionized aqueous solution containing 0.2 mol / L calcium acetate and 0.02 mol / L sodium β-glycerophosphate; electrical parameters: voltage 350V, frequency 1000Hz, treatment time 5 minutes. Porous titanium dioxide with a pore size of 20-50 μm was obtained through the above treatment.

[0059] Subsequently, the MAO-treated porous titanium dioxide implants were immersed in 1 mg / mL dopamine hydrochloride (dissolved in Tris-HCl buffer at pH 8.5) and shaken at room temperature for 12 hours to form a uniform polydopamine (PDA) adhesion coating.

[0060] The GVs@circBMP2 prepared in Example 2 was dissolved in PBS buffer to prepare a GVs@circBMP2 suspension (the vesicle concentration in the suspension was 1×10⁻⁶). 12 Particles / mL were drop-coated at a rate of 200 μL onto the surface of PDA-modified porous titanium dioxide implants and incubated at 37°C for 6 hours to obtain the Gastrodia elata vesicle delivery system for circRNA-BMP2 (functionalized implants). After incubation at this temperature, unbound vesicles were removed by rinsing with PBS. The vesicles were then analyzed by scanning electron microscopy (SEM). Figure 3 Observe the distribution of vesicles in the microporous structure.

[0061] Scanning electron microscopy results: Figure 3 The microporous structure (20-50μm) and uniformly loaded vesicles are visible on the surface of the titanium implant.

[0062] Example 4: In vitro osteogenic capacity assessment

[0063] Rat BMSCs from passages 3 to 5 were routinely cultured in α-MEM complete medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin). Cells were seeded in 12-well plates at a density of 5 × 10⁶ cells / well. 4 Cells per well were used, and after 80% adhesion was achieved, the culture medium was replaced (based on α-MEM complete medium, with implant extracts obtained according to different groupings used as the experimental medium). The experiment was divided into three groups: the experimental group (C-GVs) was the GVs@circBMP2 functionalized implant extract group; control group one (CON) was the unfunctionalized pure titanium implant extract group; and control group two (GVs) was the empty-loaded Gastrodia elata vesicle (GVs@null) implant extract group. The implant extract was prepared by placing corresponding standard-sized implants in cell culture medium (surface area to volume ratio of 1.5 cm²). 2 The solution was prepared by immersion in a solution of 120 rpm at 37°C for 24 hours, followed by filtration through a 0.22 μm filter membrane.

[0064] The implant extract is used in the same way as the α-MEM complete medium, and can be co-cultured with cells. Freshly prepared extract should be replaced every 2 days during the experiment.

[0065] On day 7, alkaline phosphatase (ALP) activity was detected and ALPL immunofluorescence analysis was performed. For ALP staining, cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes. The fixative was discarded, and the cells were washed three times with PBS. 500 μL of BCIP / NBT substrate working solution was added to each well, and the cells were incubated at 37°C in the dark for 30 minutes. After incubation, the staining solution was discarded, and the cells were washed twice with PBS to terminate the reaction, resulting in the formation of a purple precipitate. ALPL immunofluorescence analysis was performed in parallel. After fixation, cells were permeabilized with 0.1% Triton X-100 for 10 minutes and blocked with 5% bovine serum albumin (BSA) for 1 hour. Subsequently, the cells were incubated with rabbit anti-ALPL primary antibody overnight at 4°C. The next day, the cells were washed three times with PBS for 5 minutes each time, and Alexa Fluor 488-labeled goat anti-rabbit secondary antibody was added. The cells were incubated at room temperature in the dark for 1 hour. Finally, the cell backbone was stained with F-actin for 45 minutes, the nuclei were stained with DAPI for 5 minutes, and the cells were observed under a laser confocal microscope after PBS washing.

[0066] On day 14, Alizarin Red S (ARS) staining was performed to assess calcium nodule deposition. Cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes, then incubated with 40 mM Alizarin Red S solution (pH adjusted to 4.2) at 37°C for 20 minutes. The staining solution was discarded, and the cells were gently rinsed 4-5 times with deionized water until no red residue remained, and the mineralized nodules were stained orange-red. This standardized procedure allows for a systematic evaluation of the material's effects on early osteogenic enzyme activity, late-stage mineralization capacity, and the expression of key osteogenic proteins.

[0067] Immunofluorescence results of ALP, ARS, and ALPL are shown in the figure. Figure 4-5 The experimental group showed the deepest staining among the three groups, indicating that GVs@circBMP2 significantly promotes early osteoogenesis, late mineralization, and osteogenic protein expression.

[0068] Example 5: Animal Model Validation Experiment

[0069] A diabetic rat tibial graft model was established. Experimental animals and induction of the diabetic model: Eight-week-old male SD rats (weighing 180-220g) were selected and acclimatized for one week. After fasting for 12 hours, streptozotocin (STZ, dissolved in 0.1M sodium citrate buffer, pH=4.5) was injected intraperitoneally at a dose of 65mg / kg. Fasting blood glucose was measured by tail vein sampling 72 hours after injection. Rats with a sustained blood glucose level ≥16.7mmol / L were selected as successful diabetic models. A high-sugar diet was maintained for 4 weeks to ensure stable diabetic status.

[0070] Diabetic rats were randomly divided into four groups (n=8 in each group), which corresponded exactly to the in vitro experimental groups: Experimental group (C-GVS-implant group): implanted with GVs@circBMP2 functionalized implants (micro-arc oxidation + Gastrodia elata vesicles loaded with circBMP2); Control group 1 (CON group): implanted with unfunctionalized pure titanium implants; Control group 2 (GVS-implant group): implanted with empty Gastrodia elata vesicles (GVs@null) functionalized implants.

[0071] Tibial implant surgery procedure: Rats were anesthetized by intraperitoneal injection of sodium pentobarbital (40 mg / kg), and the hind limbs were shaved and disinfected. A longitudinal incision of approximately 1 cm was made on the medial side of the proximal metaphysis of the tibia, and the soft tissue was dissected layer by layer to the bone surface. Using a low-speed dental drill (≤800 rpm) and saline cooling, a bone defect hole with a diameter of 1.5 mm and a depth of 5 mm was prepared 2 mm below the tibial plateau. After implantation, the fascia, subcutaneous tissue, and skin were sutured layer by layer. Postoperatively, penicillin (50,000 units / day) was administered intraperitoneally for 3 consecutive days to prevent infection. Postoperatively, bone volume fraction (BV / TV) and trabecular bone thickness parameters were analyzed using Micro-CT three-dimensional reconstruction.

[0072] Experimental results: The results of the animal tissue morphometric parameter analysis are shown below. Figure 6 ,Depend on Figure 6 It can be seen that the experimental group had higher bone volume fraction and trabecular bone thickness parameters than the other two groups, indicating that C-GVS implants have a significant promoting effect on osteogenesis and bone quality in vivo.

[0073] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A plant vesicle delivery circRNA-BMP2 system, characterized in that, The mixture comprises a metal substrate, plant vesicles, and circRNA-BMP2 loaded within the plant vesicles; the plant vesicles and the circRNA-BMP2 loaded within the plant vesicles are mixed and drop-coated onto the surface of the metal substrate.

2. The plant vesicle-delivered circRNA-BMP2 system of claim 1, wherein, The plant vesicles mentioned are Gastrodia elata vesicles.

3. The plant vesicle delivery system for circRNA-BMP2 according to claim 1, characterized in that, The method for synthesizing circRNA-BMP2 is as follows: a linear RNA-BMP2 containing an IRES element and m6A modification is constructed, the linear RNA is cyclized using T4 RNALigase 2, the linear RNA is digested and removed by RNase R, and circRNA-BMP2 is obtained by extraction and purification.

4. The plant vesicle delivery system for circRNA-BMP2 according to claim 1, characterized in that, The metal substrate is a porous titanium dioxide implant.

5. A method for preparing a plant vesicle delivery system for circRNA-BMP2 as described in any one of claims 1-4, characterized in that, Includes the following steps: Plant vesicles were obtained by pulverizing and centrifuging the plant. Synthesize circRNA-BMP2; Plant vesicles and circRNA-BMP2 were mixed at a volume ratio of (1:3) to (1:5), and the mixture was subjected to ice bath, sonication, gradient extrusion, and centrifugation to obtain the drug-loaded complex GVs@circBMP2. The obtained drug-loaded complex GVs@circBMP2 was dissolved in a solvent to obtain a suspension of drug-loaded complex GVs@circBMP2. The plant vesicle delivery system for circRNA-BMP2 was obtained by drop-coating the drug-loaded complex GVs@circBMP2 suspension onto the surface of a metal substrate and incubating for 6-12 hours.

6. The preparation method according to claim 5, characterized in that, The plant is Gastrodia elata; the metal matrix is ​​a porous titanium dioxide implant.

7. The preparation method according to claim 6, characterized in that, The steps for synthesizing circRNA-BMP2 include: constructing linear RNA-BMP2 containing IRES elements and m6A modification, cyclizing linear RNA with T4 RNA Ligase 2, digesting and removing linear RNA with RNase R, and obtaining circRNA-BMP2 by extraction and purification.

8. The preparation method according to claim 6, characterized in that, The gastrodia vesicles and circRNA-BMP2 were mixed at a volume ratio of 1:3, incubated on ice for 15-20 min, and then subjected to sonication, gradient extrusion and ultrafiltration centrifugation to obtain the drug-loaded complex GVs@circBMP2. The obtained drug-loaded complex GVs@circBMP2 was dissolved in a solvent to obtain a drug-loaded complex GVs@circBMP2 suspension. The drug-loaded complex GVs@circBMP2 suspension was drop-coated onto the surface of a porous titanium dioxide implant and incubated at 37°C for 6 hours to obtain a plant vesicle delivery system for circRNA-BMP2.

9. The preparation method according to claim 6, characterized in that, The concentration of the Gastrodia tuber vesicles is 0.5-1 x 10 12 particles / mL, and the concentration of the circRNA-BMP2 is 0.1-0.9 mg / mL.

10. The use of the plant vesicle delivery system for circRNA-BMP2 as described in any one of claims 1-4 in the preparation of orthopedic materials.

Images