Pth-St1 antibacterial derived peptide and application thereof
Design_1867 was designed by modifying the Pth-St1 antimicrobial peptide, which solved the problem of insufficient antibacterial activity against Pectinobacterium, and achieved efficient inhibition and safe control of Pectinobacterium. It is suitable for the prevention and control of bacterial soft rot in Solanaceae and Cruciferae vegetables.
Patent Information
- Application Number
- CN202511407996.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-12-19
AI Technical Summary
The existing Pth-St1 antimicrobial peptides have insufficient antibacterial activity against pectinobacterium, and there is a lack of effective methods for controlling bacterial soft rot in solanaceous and cruciferous vegetables.
By modifying the Pth-St1 antimicrobial peptide, a new antimicrobial derivative peptide, Design_1867, was designed, which has a stronger bactericidal effect. The minimum bactericidal concentrations against Escherichia coli and Pectinobacterium reached 250 μg/mL and 62.5 μg/mL, respectively. Based on the Pth-Ca1 peptide, the amino acid sequence was optimized to enhance its antibacterial activity.
The Design_1867 peptide significantly enhances the inhibitory effect on pectinobacter and has no obvious toxicity to cells and plants within a certain concentration range, providing a safe and effective control method.
Smart Images

Figure CN121159639A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to a Pth-St1 antibacterial derivative peptide and its application, and relates to the field of application of peptide antibiotics. BACKGROUND
[0002] Pectobacterium carotovorum is the main pathogenic bacterium causing bacterial soft rot of Solanaceae and Cruciferae vegetables, which has caused serious losses to the production of Solanaceae and Cruciferae vegetables. Although strict field management and breeding of disease-resistant varieties can appropriately reduce the losses caused by soft rot, there is still a lack of effective prevention and control measures.
[0003] As the first line of defense of the host immune defense system, antibacterial peptides have broad-spectrum antibacterial activity and are not prone to drug resistance, and are considered to be ideal candidates for antibiotic substitutes. Among them, Pth-St1 (Pseudothionin Solanum tuberosum 1) is derived from Solanum tuberosum and is a cationic antibacterial peptide composed of 19 amino acids, which is cut by a 5 kDa defensin-like polypeptide, and has a net charge of +2. It has not been classified yet. Pth-St1 polypeptide has antibacterial activity against Escherichia coli, but the minimum inhibitory concentration is greater than 2 mg / mL.
[0004] Therefore, it is necessary to improve the Pth-St1 antibacterial peptide to further improve its antibacterial activity against Pectobacterium carotovorum, and to find a new and effective method for preventing and controlling bacterial soft rot. SUMMARY
[0005] In view of the above-mentioned needs, the application discloses a Pth-St1 antibacterial derivative peptide and its application, and belongs to the field of application of peptide antibiotics. The amino acid residue sequence of the antibacterial derivative peptide (Design_1867) is: RKLVRQLHRFKGKLVRKLH. The derivative peptide provided by the application has stronger bactericidal effect, and the minimum bactericidal concentration of the derivative peptide against Escherichia coli and soft rot pectobacterium carotovorum is 250 μg / mL and 62.5 μg / mL, respectively. The safety of the Design_1867 polypeptide is also proved, so it is expected to become a new prevention and control product and means for soft rot pectobacterium carotovorum.
[0006] The application analyzes the homologous sequences of Pth-St1 in different species and their related physicochemical properties, finds that Pth-Ca1 polypeptide has the most positive charge, contains more positively charged and highly polar amino acids (i.e. arginine and lysine), and forms more helical structures; and it is proved that the effect of Pth-Ca1 polypeptide on inhibiting Escherichia coli is better than that of Pth-St1, so the antibacterial peptide is designed based on the improvement of Pth-Ca1 polypeptide.
[0007] Then, based on the Pth-Ca1 polypeptide, thousands of derivative peptides are designed by means of bioinformatics, and the top 8 polypeptides with predicted comprehensive scores are selected for antibacterial experiment verification. The number of mutation sites in these polypeptides is 5-8, and they can all form 17 helix structures, the net charge is greater than +5, and the hydrophobic percentage is greater than 21%. The experimental results show that the antibacterial activities of Design_1867 (SEQ ID NO: 3), Design_1937 (SEQ ID NO: 6), Design_306 (SEQ ID NO: 7), Design_3240 (SEQ ID NO: 4), Design_2831 (SEQ ID NO: 9), and Design_1760 (SEQ ID NO: 10) polypeptides are all different degrees higher than that of the Pth-Ca1 polypeptide. Only the antibacterial effect of Design_34 (SEQ ID NO: 5) and Design_1216 (SEQ ID NO: 10) is inferior to that of the Pth-Ca1 polypeptide.
[0008] Further, taking Design_1867 with the best antibacterial effect as an example, the effects of inhibiting Escherichia coli and Pectobacterium carotovorum are explored, and it is found that the inhibitory effect is significantly better than that of Pth-Ca1; similarly, Design_1937 (SEQ ID NO: 6), Design_306 (SEQ ID NO: 7), Design_3240 (SEQ ID NO: 4), Design_2831 (SEQ ID NO: 9), and Design_1760 (SEQ ID NO: 10) polypeptides also have corresponding functions. Specifically, the MIC values of Design_1867 for inhibiting Escherichia coli and Pectobacterium carotovorum are both 31.25 µg / mL; and the concentrations required for completely inhibiting the growth of Escherichia coli and Pectobacterium carotovorum within 12 hours are 8 × MIC (250 µg / mL) and 2 × MIC (62.5 µg / mL) respectively, indicating that the inhibitory effect of Design_1867 on Pectobacterium carotovorum is better. Finally, the safety of the Design_1867 polypeptide is proved at the cell level and the plant level, that is, the polypeptide has little or even no effect on the growth of cells and plants.
[0009] To achieve the above object, the technical scheme adopted by the present application is as follows:
[0010] On the one hand, the present application provides an antibacterial peptide, which is modified based on the sequence shown in Pth-St1 (SEQ ID NO: 1) and / or Pth-Ca1 (SEQ ID NO: 2).
[0011] Preferably, the antibacterial peptide comprises 17 helix structures.
[0012] Specifically, the antibacterial peptide comprises an amino acid residue sequence shown in any one of SEQ ID NO: 3 ~ SEQ ID NO: 10.
[0013] More specifically, the antibacterial peptide comprises an amino acid residue sequence shown in any one of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 4, SEQ ID NO: 9, SEQ ID NO: 10.
[0014] Preferably, the antibacterial peptide comprises an amino acid residue sequence shown in SEQ ID NO: 3.
[0015] In another aspect, the present application provides an antibacterial composition comprising the polypeptide or the composition as described above.
[0016] In another aspect, the present application provides a method for inhibiting bacteria, characterized in that the polypeptide as described above is used.
[0017] Specifically, the bacteria to be inhibited by the method are bacteria; more specifically, Enterobacteriaceae; more specifically, Escherichia coli and Pectobacterium.
[0018] Further, the polypeptide is used at a concentration of 1 µg / mL ~ 5 mg / mL; more specifically, 4 µg / mL ~ 2 mg / mL.
[0019] In another aspect, the present application provides the use of the polypeptide as described above for the preparation of an antibacterial agent.
[0020] The beneficial effects of the present application include:
[0021] 1. Based on the homologous sequence Pth-Ca1 of Pth-St1, 6 polypeptides with stronger antibacterial activity are optimized, preferably Design_1867 (SEQ ID NO: 3).
[0022] 2. The Design_1867 polypeptide has inhibitory effect on Escherichia coli and Pectobacterium, preferably Pectobacterium; at the same time, the minimum inhibitory concentration of the Design_1867 polypeptide is much lower than that of Pth-Ca1 and Pth-St1.
[0023] 3. The Design_1867 polypeptide only contains 19 amino acid residues, has low synthesis cost, and does not produce obvious cytotoxicity within a certain concentration range, has certain safety, and provides a new choice for inhibiting the growth of Escherichia coli and Pectobacterium. BRIEF DESCRIPTION OF DRAWINGS
[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings required to be used in the embodiments or prior art description will be briefly introduced. Obviously, the drawings in the following description only constitute some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0025] Figure 1 : Comprehensive comparison of Pth-Ca1, Pth-St1 and Design_1867 polypeptides; wherein, Figure 1 A figure in the above is the physicochemical property of Pth-Ca1, Pth-St1 and Design_1867 polypeptides; Figure 1 B figure in the above is the E. coli inhibition performance test of Pth-Ca1, Pth-St1 and Design_1867 polypeptides; Figure 1 C figure in the above is the sequence alignment of Pth-Ca1, Pth-St1 and Design_1867 polypeptides; Figure 1 D figure in the above is the three-dimensional structure diagram of Pth-Ca1, Pth-St1 and Design_1867 polypeptides.
[0026] Figure 2 : Screening of Pth-Ca1 improved polypeptides; wherein, Figure 2 A figure in the above is the physicochemical property of Pth-Ca1 improved polypeptides; Figure 2 B figure in the above is the bacteriostatic activity test of Pth-Ca1 improved polypeptides; Figure 2 C figure in the above is the colony statistics of Pth-Ca1 improved polypeptides; Figure 2 B.
[0027] Figure 3 : Verification of Design_1867 polypeptide bacteriostatic function; wherein, Figure 3 A figure in the above is the bacteriostatic curve of Design_1867 / Pth-Ca1 / Pth-St1 polypeptides; Figure 3 B figure in the above is the bacteriostatic effect of different concentrations of Design_1867 polypeptides; Figure 3 C figure in the above is the verification of the binding ability of Design_1867 / Pth-Ca1 / Pth-St1 polypeptides to E. coli genomic DNA.
[0028] Figure 4 : Inhibition of Design_1867 polypeptide on Pectobacterium; wherein, Figure 4 A figure in the above is the bacteriostatic curve of Design_1867 polypeptides; Figure 4 B figure in the above is the inhibition effect of different concentrations of Design_1867 polypeptides on Pectobacterium.
[0029] Figure 5 : Inhibition effect of Design_1867 polypeptide on Pectobacterium in plants; wherein, Figure 5 Figure A in the above table is the effect of Design_1867 injection alone on plant leaves; Figure 5 Figure B in the above table is the effect of Pectobacterium injection alone, Design_1867 injection alone and mixed injection of Pectobacterium and Design_1867 on plant leaves; Figure 5 Figure C in the above table is the comparison of the copy number of Pectobacterium in leaves injected with Pectobacterium alone, Design_1867 alone and mixed injection of Pectobacterium and Design_1867.
[0030] Figure 6 : Preliminary exploration of the antibacterial mechanism of Design_1867 polypeptide; wherein, Figure 6 Figure A in the above table is Pectobacterium treated with Design_1867 or Alametihicinc polypeptide for 6 h; Figure 6 Figure B in the above table is the expression level of bolA, ompC, robA and lptF genes in Pectobacterium treated with Design_1867 or Alametihicinc polypeptide for 6 h, n = 3. DETAILED DESCRIPTION
[0031] The present application will be further described in conjunction with the drawings and specific examples in the specification, which are only used to explain the present application and are not used to limit the scope of the present application; all other examples obtained by those skilled in the art without creative labor on the basis of the examples in the present application belong to the scope of protection of the present application.
[0032] The naming method of defensin-like proteins in different species in the present application is as follows: Pth-xx1, xx is the abbreviation of the Latin name of the species, such as Pth-St1 (SEQ ID NO: 1) is the defensin-like protein in potato; Pth-Ca1 (SEQ ID NO: 2) is the defensin-like protein in pepper; Pth-Me1 is the defensin-like protein in cassava. The test methods used in the following examples are conventional methods unless otherwise specified; the polypeptides involved in the present application are synthesized by Shengong Biotechnology (Shanghai) Co., Ltd., and the specific sequences of the polypeptides are shown in Table 1; the Escherichia coli used is Escherichia coli ATCC 25922 strain from Henan Industrial Microbial Strain Engineering Technology Research Center, and the Pectobacterium is Pectobacterium Brasiliense Pcb SZCX strain isolated from flowering cabbage by Suzhou Academy of Agricultural Sciences, the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.
[0033] Table 1. Antimicrobial peptides involved in this invention
[0034]
[0035] Example 1: Pth-St1 sequence optimization
[0036] To study the gene evolution process, homologous sequences of the Pth-St1 peptide in different species were compared. Table 1 shows that the homologous genes of Pth-St1 are highly conserved in most crops. The antimicrobial activity of antimicrobial peptides mainly depends on the electrostatic interaction between positively charged amino acids and negatively charged cell membranes, and the penetration and disruption of cell membranes by hydrophobic amino acids. Therefore, the higher the proportion of these two types of amino acids (i.e., positively charged polar amino acids and hydrophobic amino acids) in the peptide, the better the activity. Among them, the defensin-like proteins (Pth-Ca1 and Pth-Me1) in chili pepper (Capsicum annuum) and cassava (Manihot esculenta) have the most positively charged amino acids (Table 2). Furthermore, the positively charged amino acids include arginine (R), lysine (K), and histidine (H). The charge polarity of H is weaker than the other two, and the positive charge it carries is unstable under physiological conditions. Therefore, sequences with fewer H values should be selected whenever possible. Compared to Pth-Me1, the Pth-Ca1 polypeptide (R: 3; K: 3; H: 1) has fewer H atoms, so subsequent experiments were based on Pth-Ca1.
[0037] Table 2. Homologous sequences of Pth-St1 peptides in different species
[0038]
[0039]
[0040]
[0041] To investigate the three-dimensional (3D) structure of antimicrobial peptides (AMPs), AlphaFold 3 was used to predict the structure of AMPs. Figure 1 A, Figure 1 C and Figure 1 D). The number of helices may affect the antibacterial efficiency of AMPs; generally, the number of helices is positively correlated with antibacterial activity, and the more helices, the stronger the antibacterial properties of AMPs. Predicted structures show that Pth-St1 and Pth-Ca1 contain 8 and 12 helices, respectively, meaning that Pth-Ca1 may have stronger antibacterial activity than Pth-St1. The higher helical number in Pth-Ca1 is likely due to the retention of its positively charged amino acids, enhancing the effect of hydrophobic amino acids and forming a helical structure.
[0042] To further evaluate the antibacterial activity of Pth-St1 and Pth-Ca1, polypeptides (1 mg / mL) were added to E. coli (1 × 10 6 CFU / mL). Specifically, E. coli was cultured in sterile NB broth (Guangdong Huankai Biological Technology Co., Ltd.) for 6 h, then diluted to 1 × 10 6 cfu / mL with sterile NB broth; polypeptides were diluted to 2,000 µg / mL with sterile water; 100 µL of E. coli solution and 100 µL of polypeptide were mixed and incubated in a 37°C incubator for 12 h, then 30 µL of the mixture was evenly spread on NA medium (Guangdong Huankai Biological Technology Co., Ltd.) and incubated in a 37°C incubator for 12 h before the results were observed. The results showed that the antibacterial activity of Pth-Ca1 was slightly better than that of Pth-St1 (Pth-Ca1: 0 / 3; Pth-St1: 1 / 3). Figure 1 B}.
[0043] Based on this, the present embodiment takes the Pth-Ca1 sequence (SEQ ID NO: 2) as the optimization basis, retains its positively charged amino acids, enhances the role of hydrophobic amino acids, and uses the ESM3 model to predict the helical structure. The sequence in this direction is suggested as: RK_____HR_K____RK__ (fixed mutation) and _______________ (random mutation), and the secondary structure is suggested as: HHHHHHHHHHHHHHHHHHHH; multiple temperature factors (0.0, 0.1, 0.2, 0.3, 0.4, and 0.5) are set, and for each temperature factor, 1,000 peptide sequences are generated. After generation, the result sequences are first de-duplicated to ensure the uniqueness of each sequence; then, ESMFold is used to predict the three-dimensional structure of each peptide and calculate its pLDDT value and the number of helical amino acids. The net charge and hydrophobicity (%) of the peptide are calculated by APD3 (https: / / aps.unmc.edu / prediction).
[0044] The results of the optimized sequences show that the maximum number of helices of the optimized peptides is 17, and the top 8 sequences (SEQ ID NO: 3 ~ SEQ ID NO: 10) are selected as screening objects based on the following criteria: Predicted Local Distance Difference Test (pLDDT), number of helices, net charge greater than +5, and hydrophobicity percentage greater than 21% Figure 2 A), after 2 mg / mL candidate polypeptides were mixed with E. coli for 12 h, the plates were plated (the specific steps are described above), and water was used as a negative control, Pth-Ca1 was used as a positive control, and 3 replicates were set for each experiment. The results show that (Table 2) Figure 2 B and Figure 2C), the antibacterial effect of the eight polypeptides optimized based on Pth-Ca1 is not the same, among which, the colony number of Design_1867 (SEQ ID NO: 3) is 0, which is the optimal candidate polypeptide, followed by Design_3240 (SEQ ID NO: 4) and Design_306 (SEQ ID NO: 7); on the contrary, the antibacterial effect of Design_34 (SEQ ID NO: 5) and Design_1216 (SEQ ID NO: 8) is worse than that of Pth-Ca1. Further, the helix, net charge and hydrophobicity of Design_1867 are 17, +8.5 and 37% respectively (A); in addition, the antibacterial activity also shows that the efficacy of Design_1867 is better than that of Pth-Ca1 and Pth-St1 (B), which indicates that a higher number of helix, net charge and hydrophobicity are very important for improving the antibacterial activity of AMPs. Figure 1 A); in addition, the antibacterial activity also shows that the efficacy of Design_1867 is better than that of Pth-Ca1 and Pth-St1 (B), which indicates that a higher number of helix, net charge and hydrophobicity are very important for improving the antibacterial activity of AMPs. Figure 1 B), which indicates that a higher number of helix, net charge and hydrophobicity are very important for improving the antibacterial activity of AMPs.
[0045] In summary, by mining and optimizing the homologous sequences of Pth-St1, the embodiment obtains a plurality of polypeptides with stronger antibacterial performance, among which, Design_1867 (SEQ ID NO: 3) is the most preferred.
[0046] Example 2: Further exploration of antibacterial activity of Design_1867 polypeptide
[0047] In order to further verify the antibacterial effect of Design_1867, the present embodiment uses double dilution method to determine the minimum inhibitory concentration (MIC) of Design_1867 on E. coli. Specifically, E. coli is cultured in sterile NB culture solution for 6 h, and then diluted to 1×10 6 cfu / mL with sterile NB culture solution; the polypeptides (Pth-St1, Pth-Ca1, Design_1867) are diluted to 2000 µg / mL with sterile water; the minimum inhibitory concentration of Pth-St1, Pth-Ca1 and Design_1867 on E. coli is determined by double dilution method, with 50 mg / mL Kanamycin (Biyun Tian Co., Ltd.) as positive control and sterile water as negative control; E. coli and polypeptides are mixed in proportion and cultured in a 37℃ incubator for 12 h, until the negative turbidity is determined, and the value of OD 600 ; each experimental group is set in triplicate. The results show that Figure 3A), the MIC value of Pth-Ca1 was 2 mg / mL, the MIC value of Pth-St1 was greater than 2 mg / mL, and the MIC value of Design_1867 was 31.25 µg / mL, which further proved that the antibacterial effect of Design_1867 was significantly better than that of Pth-Ca1 and Pth-St1.
[0048] Next, the antibacterial curve was also used to evaluate the antibacterial activity of Design_1867 at different growth stages. Specifically, after the E. coli was cultured in sterile NB culture solution for 6 h, the bacterial solution was diluted to 1x10 6 cfu / mL with sterile NB culture solution; the polypeptide was diluted to 2,000 µg / mL with sterile water; the minimum inhibitory concentration of Design_1867 on E. coli was determined by the doubling dilution method, with 50 mg / mL Kanamycin as a positive control and sterile water as a negative control; the E. coli and the polypeptide were mixed in proportion and cultured in a 37°C incubator for 12 h until the negative turbidity; 30 µL of the mixture was evenly spread on NA culture medium and cultured in a 37°C incubator for 12 h, and the growth of E. coli was observed. Compared with the phosphate buffer solution (PBS) control, 8 MIC (250 µg / mL) of Design_1867 could completely inhibit the growth of E. coli within 12 h Figure 3 B}.
[0049] Previous studies have shown that antibacterial peptides have the ability to pass through the cell membrane and bind to bacterial DNA, and then inhibit the function of bacterial DNA, so the DNA binding ability of the polypeptide is also used as a standard to evaluate the activity of the antibacterial peptide. In order to investigate the binding effect of Design_1867 on E. coli DNA, Design_1867, Pth-Ca1 and Pth-St1 with a concentration of 250 µg / mL were incubated with 0.5 µg of E. coli DNA (DNA concentration was 93 ng / µL) at 37°C for 30 minutes, and A19 (AAAAAAAAAAAAAAAAAAA) was used as a control; after incubation, the samples were analyzed by nucleic acid gel electrophoresis. The results showed that Figure 3C), except for A19 control, the band intensity of E. coli genomic DNA was gradually weakened with the increase of the concentration of antibacterial peptides; specifically, when the concentration ratio of Design_1867: E. coli genomic DNA was 5:1, the band intensity of E. coli DNA was 2 / 3 weaker than that of A19 control, and when the ratio increased to 10:1, the DNA band of E. coli could not be detected; in contrast, when the concentration ratio of Pth-Ca1: E. coli genomic DNA was 50:1, the diffuse DNA band could still be detected, and under the same conditions, the band of E. coli DNA treated by Pth-St1 was brighter, which indicated that Design_1867 had the best binding ability with E. coli DNA, and further proved that Design_1867 had superior antibacterial effect.
[0050] Example 3: Inhibition effect of Design_1867 polypeptide on Pectobacterium
[0051] To further verify the antibacterial effect of Design_1867 on Pectobacterium, the minimum inhibitory concentration (MIC) of Design_1867 on Pectobacterium was determined by double dilution method, and the specific experimental steps were the same as those described in Example 2. The results showed that (Figure 3A) Figure 4 A), the MIC value of Design_1867 for inhibiting Pectobacterium was 31.25 mg / mL; then, the antibacterial activity of Design_1867 at different growth stages was evaluated according to the antibacterial curve. Compared with the phosphate buffer solution (PBS) control, within 12 hours, 2 MIC (62.5 µg / mL) of Design_1867 completely inhibited the growth of Pectobacterium (Figure 3B) Figure 4 B).
[0052] Meanwhile, the cytotoxicity of Design_1867 to cells was also explored. Specifically, 100 µL of HK-2 cells (Hefei Wanyu Biotechnology Co., Ltd.) were inoculated in a 96-well plate at a cell density of 5×10 3 The cytotoxicity experiment showed that when the concentration was 0-500 µg / mL, Design_1867 did not produce obvious cytotoxicity (Table 3).
[0053] Table 3 CCK8 cytotoxicity experiment
[0054]
[0055] Example 4: Inhibition effect of Design_1867 polypeptide on Pectobacterium in plants
[0056] In order to further verify the anti-Pectobacterium effect of Design_1867 and its safety in plants, the Design_1867 polypeptide was inoculated into tobacco leaves in this embodiment. Specifically, Nicotiana benthamiana was cultured at 26°C with light for 14 h and darkness for 8 h; sterile water (as a negative control), Design_1867 (61.25 μg / mL), Pectobacterium bacterial suspension (OD 600 = 0.1), Pectobacterium bacterial suspension (OD 600 = 0.1) and Design_1867 (61.25 μg / mL) were injected into tobacco leaves at a volume ratio of 1:1, and the total volume of the injection liquid for each experimental group was 150 μL; after inoculation, the plants were cultured for 6 h, and the phenotype was recorded by taking pictures. The results showed that the phenotype of the plant leaves injected with Design_1867 alone was consistent with that of the negative control, and no obvious necrosis symptoms appeared, indicating that the Design_1867 polypeptide had little or no toxic effect on plants ( Figure 5 A); the area of the tobacco leaf injected with Pectobacterium alone showed obvious necrosis, while the area co-injected with Pectobacterium and Design_1867 polypeptide showed no necrosis, further proving the bacteriostatic effect of Design_1867 polypeptide ( Figure 5 B). Subsequently, the colony copy number of the leaves was compared. First, plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd.) was used to extract plant leaf DNA, primers were designed using the rpoS gene (rpoS-F: GGAAGATGTGGGTCGTGAAAT (SEQ ID NO: 11), rpoS-R: TCTTCAATGCTCAACCCCTG (SEQ ID NO: 12)), and polymerase chain reaction was performed using plant DNA as the template. The product was subjected to agarose gel electrophoresis, the obtained rpoS gene was cloned into the pEASY-Blunt Zero vector, the concentration was detected and the copy number was calculated (copies / μL = plasmid concentration (ng / μL) x 6.022 x 10 23 / plasmid molecular weight (g / mol) x 10 9 ); the plasmid was diluted by 10 -2 -10 -65 concentration gradients were used for qPCR to establish a standard curve, using rpoS-F (SEQ ID NO: 11) and rpoS-R (SEQ ID NO: 12) as qPCR primers; then qPCR was performed using the sample DNA with TOROGreen® qPCR Master Mix Kit (TOYOBO, Osaka, Japan), and the colony copy number of the sample was calculated using the standard curve. The quantitative results showed that the number of Pectobacterium bacteria in tobacco leaves decreased after applying the Design_1867 polypeptide Figure 5 C), which is consistent with Figure 5 B.
[0057] In summary, Examples 2-4 verified the inhibitory effect of the Design_1867 polypeptide on Pectobacterium and the safety of using the polypeptide in vivo and in vitro.
[0058] Example 5: Preliminary exploration of the mechanism by which the Design_1867 polypeptide inhibits Pectobacterium
[0059] To preliminarily explore the mechanism of action of Design_1867, this example selected Alamethicin (Shengong Bioengineering Co., Ltd.), an antibacterial peptide with a known mechanism of action "barrel stave model", as a reference, and treated Pectobacterium with Alamethicin and Design_1867 polypeptide, respectively. The outer shape of Pectobacterium was observed using a scanning electron microscope at 0 hours and 6 hours after treatment, respectively. The antibacterial peptide Alamethicin mainly destroys the permeability of the cell membrane by forming a voltage-dependent transmembrane ion channel, ultimately leading to cell death.
[0060] The scanning electron microscope observation results showed that after 6 hours of treatment, Design_1867 could induce the formation of 1 to 3 round holes with clear and sharp edges on the surface of the bacteria, and these holes showed clean and neat perforations on the membrane; the damage to the bacterial surface showed a localized feature, and the phospholipid molecules were only displaced from the hole site, while the surrounding membrane structure remained intact and smooth Figure 6 A). These properties are similar to the changes in bacteria caused by Alametihicinc polypeptide, consistent with the barrel model, meaning that the mechanism of action of Design_1867 may be the same as that of Alametihicinc.
[0061] Further, this example also detected the expression changes of bolA, ompC, robA and lptF genes related to biofilm after 6 hours of antibacterial peptide treatment using RT-PCR technology, wherein the quantitative primers in the RT-PCR experiment are shown in Table 4.
[0062] Table 4 Quantitative primers used in the RT-PCR experiment
[0063]
[0064] The results show that ompC gene is up-regulated after Design_1867 and alamethicin treatment, which indicates that the outer membrane is unstable; meanwhile, the expression trends of bolA, robA and lptF genes after the above two polypeptide treatments are the same (B), which further indicates that the mechanism of Design_1867 is similar to that of alamethicin, both of which are barrel model. Figure 6
[0065] The above shows and describes the basic principles and main features of the present application and the advantages of the present application, for those skilled in the art, it is obvious that the present application is not limited to the details of the above exemplary embodiments, and the present application can be realized in other specific forms without departing from the spirit or essential characteristics of the present application; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-limiting, the scope of the present application is defined by the appended claims rather than the above description, therefore all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present application, any reference signs in the claims should not be regarded as limiting the claims involved.
Claims
1. An antibacterial peptide, characterized in that, The antibacterial peptide is modified based on the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO:
2.
2. The polypeptide of claim 1, wherein, The antibacterial peptide comprises 17 helical structures.
3. The polypeptide of claim 1, wherein The antibacterial peptide comprises the amino acid residue sequence shown in any one of SEQ ID NO: 3 ~ SEQ ID NO:
10.
4. The polypeptide of claim 1, wherein, The antibacterial peptide comprises the amino acid residue sequence shown in any one of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 4, SEQ ID NO: 9, and SEQ ID NO:
10.
5. The polypeptide of claim 1, wherein, The antibacterial peptide comprises the amino acid residue sequence shown in SEQ ID NO:
3.
6. An antibacterial composition, characterized by, The antibacterial composition comprises the polypeptide according to any one of claims 1 ~ 5.
7. A method of inhibiting bacteria, characterized by, The polypeptide according to any one of claims 1 ~ 5 or the composition according to claim 6 is used.
8. The method of claim 7, wherein, The inhibition object is bacteria.
9. The method of claim 7, wherein, The polypeptide is used at a concentration of 1 µg / mL ~ 5 mg / mL.
10. Use of a polypeptide for the manufacture of an antibacterial agent, characterized in that, The polypeptide is according to any one of claims 1 ~ 5.