Functional small peptide LL10 of avian leukosis virus envelope protein Gp37, nucleic acid molecule, recombinant vector and application of functional small peptide LL10

Abstract

The invention discloses a conservative functional small peptide LL10 on the surface of avian leukosis virus (ALV) envelope protein gp37, a nucleic acid molecule, a recombinant vector and application of the conservative functional small peptide LL10 in diagnosis and detection of different subgroup ALV infection. The recombinant bacteria provided by the invention can specifically recognize different subgroup ALV infectious antibody serum samples. The recombinant thallus is taken as an agglutination antigen and can be subjected to specific reaction with serum infected by different subgroups of ALV to form clear and visible agglutination particles, and meanwhile, the agglutination antigen does not react with serum infected by other pathogens. A rapid and convenient detection method for different subgroup ALV infection is established, qualitative and quantitative detection of specific antibodies after ALV infection can be achieved, and a reliable novel technical method is provided for ALV diagnosis and purification.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology and immunodiagnostic detection, and particularly relates to a conserved functional small peptide LL10 of avian leukosis virus envelope protein Gp37, a nucleic acid molecule, a recombinant vector and application of the same in serological detection of different subgroups of ALV infection. BACKGROUND

[0002] Avian leukosis (AL) is an infectious tumor disease of poultry caused by avian leukosis virus (ALV), belongs to the family of retroviruses, the genus of alpha retroviruses, and is a recombinant virus between endogenous and exogenous viruses. ALV can be transmitted vertically and horizontally, and can cause malignant tumor diseases such as myeloma, hemangioma and nephroma in chickens, and also causes the decline of immune function, slow growth, and decline of egg production in chicken flocks, and even death in severe cases. At present, ALV is divided into 11 subgroups, namely subgroups A to K. In China, the main dominant subgroups of ALV are J, A and K, and the subgroup B is scattered and often mixedly infected with subgroup A. The phenomenon of co-infection between different ALV subgroups is very serious in chicken breeding, and worse still, the immune suppression caused by the same can also lead to the decline of the effect of conventional vaccines, making the chicken flocks more susceptible to other pathogenic microorganisms, causing huge economic losses to the global poultry industry. There is no commercial vaccine to prevent ALV infection in China at present, so when introducing breeding chickens, strict ALV antibody detection must be carried out, and positive chickens must be eliminated in time to cut off the vertical transmission route of ALV. The current purification method uses virus isolation and ELISA detection, which has the disadvantages of complicated steps and long time-consuming. Therefore, accurate and rapid early diagnosis of ALV is the premise of preventing its infection and prevalence.

[0003] ALV has a double-layer lipid structure of the capsid membrane, and the env gene encodes the viral envelope glycoprotein precursor, which is composed of a transmembrane (transmembrane glycoprotein, TM) protein subunit gp37 and a surface (surface glycoprotein, SU) protein subunit gp85. The gp85 protein has high variability and is responsible for binding to host cell receptors; while the transmembrane protein gp37 is responsible for mediating the fusion of viral proteins with host cell membranes and is more conserved than gp85. The transmembrane protein gp37 is anchored in the cell or viral membrane and can be divided into an extracellular region, a transmembrane domain (TM) and a cytoplasmic tail (CT), with significant differences in the conservation of different regions. The C-terminal and N-terminal both contain important hydrophobic regions, which can mediate the fusion of the viral particle envelope with the cell membrane, allowing the virus to enter the host cell and play an indispensable role in the process of host infection, pathogenesis and host adaptive immune response. Because the extracellular region of gp37 protein is antigenic and moderately conserved, gp37 protein has the potential to be used as a target antigen to develop a serological detection method.

[0004] The serological detection methods of ALV mainly include traditional neutralization test, indirect immunofluorescence antibody test, enzyme-linked immunosorbent assay and colloidal gold immunochromatography technology. The development and application of nucleic acid detection methods and metagenomic sequencing technology also provide new means for detecting ALV infection. However, the existing detection technologies still have different degrees of limitations, for example: the traditional method has a long virus isolation and culture and detection period, which is difficult to meet the needs of large-scale clinical screening; molecular techniques are easily affected by primer specificity and virus variation, resulting in false positive or false negative detection results, and high missed detection rate in low viral load samples (such as vertically transmitted chicks); some emerging technologies are high in cost and complex in process, which are limited in practical application; the ELISA method relied on in the traditional purification scheme of ALV also has many drawbacks, such as the use of complete protein antigen coating easily causing non-specific binding; the difference in cut-off threshold value of kits produced by different companies leads to the lack of standardization in result interpretation; the absence of individual sample detection control makes it difficult to identify false positive and false negative situations; the amount of complete antigen that can be carried by the solid carrier medium is limited, and the detection sensitivity is insufficient; ELISA operation is complex and requires special equipment, which is difficult to meet the needs of large-scale clinical detection in the grass-roots level.

[0005] In view of the universal prevalence of ALV in China and the serious mixed infection, it is urgent to develop a new detection technology with high sensitivity, which can detect low viral load samples; strong specificity, which can cover different subgroups of co-infection; simple operation, which is suitable for grass-roots field detection; controllable cost, which is suitable for large-scale application. The breakthrough of such technology will provide a powerful tool for ALV detection, monitoring and purification, which is of great significance to the healthy development of poultry industry. SUMMARY

[0006] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0007] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0008] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0009] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0010] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0011] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0012] The technical problem solved by the present application is to provide an ALV gp37 protein surface conservative functional small peptide LL10, an antibody-mediated plate agglutination test capable of directly recognizing and combining ALV infection, and application of the antibody-mediated plate agglutination test in serological detection of different subgroups of ALV infection.

[0013] Technical scheme: In order to solve the above technical problems, the first aspect of the present application provides an avian leukosis virus protein gp37 protein conservative functional small peptide, and the amino acid sequence of the functional small peptide is LQNRAAIDFL.

[0014] Among them, the LL10 is the 445-454th amino acid residue from the N terminal of ALV-J env protein, and the 73-82th amino acid residue of gp37 protein.

[0015] The second aspect of the present application provides a nucleic acid molecule encoding the epitope peptide, and the DNA sequence of the nucleic acid molecule is CTGCAGAACCGAGCGGCTATTGACTTCTTG.

[0016] The third aspect of the present application provides a recombinant gene fragment, which is obtained by inserting the nucleic acid molecule into the peg pilus coding gene sequence, and the nucleotide sequence of the recombinant gene fragment is shown in SEQ ID NO. 1.

[0017] The recombinant gene fragment of the present application is a recombinant gene peg-gp37-LL10 by inserting the LL10 epitope sequence into the peg gene.

[0018] The fourth aspect of the present application provides a recombinant protein of the recombinant gene, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO. 2.

[0019] The fifth aspect of the present application provides an expression cassette, a recombinant expression vector, a recombinant cell or a recombinant strain, which comprises the nucleic acid molecule or the recombinant gene fragment peg-gp37-LL10.

[0020] The sixth aspect of the present application provides a construction method of the recombinant expression vector, which comprises the following steps: inserting the nucleic acid molecule of the functional small peptide into the peg pilus coding gene sequence and introducing into a vector or introducing the recombinant gene fragment into a vector to construct a recombinant expression vector.

[0021] Specifically, the present application further provides an expression vector pBR322-peg-gp37-LL10, the DNA sequence of a conservative functional small peptide LL10 of the ALV gp37 protein is inserted into the coding gene sequence of the peg pilus, and the peg pilus coding gene sequence with the conservative functional small peptide LL10 is cloned into the pBR322 vector for expression to obtain the pBR322-peg-gp37-LL10 expression vector.

[0022] The seventh aspect of the present application provides a construction method of the recombinant strain, which comprises transforming the recombinant expression vector into a carrier bacterium to obtain the recombinant strain. The carrier bacterium is an inert carrier bacterium, and the transformation mode is an electrotransformation mode.

[0023] Specifically, the present application further provides an S9H-pBR322-peg-gp37-LL10 recombinant bacterium for displaying the conservative functional small peptide LL10 of the ALV gp37 protein on the surface, the expression vector pBR322-peg-gp37-LL10 is introduced into the inert carrier Salmonella S9H by electrotransformation, and the expression of the peg pilus and the conservative functional small peptide LL10 of the ALV gp37 protein on the surface of the S9H-pBR322-peg-gp37-LL10 recombinant bacterium is verified by agglutination test.

[0024] The eighth aspect of the present application provides an avian leukosis virus infectious antibody detection system, and the detection system comprises the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain.

[0025] The ninth aspect of the present application provides application of the functional small peptide, the nucleic acid molecule of the functional small peptide, the gene fragment, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the avian leukosis virus infectious antibody detection system in preparation of a reagent or a kit for detecting avian leukosis virus infectious antibody.

[0026] The tenth aspect of the present application provides a reagent or kit for detecting avian leukosis virus infective antibody, which comprises the functional small peptide, the nucleic acid molecule of the functional small peptide, the gene fragment, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the avian leukosis virus infective antibody detection system.

[0027] The eleventh aspect of the present application provides an in vitro agglutination test detection method of ALV infective antibody specific recognition and combination directly mediated by the conservative functional small peptide LL10, wherein the detection antigen in the plate agglutination test detection method is S9H-pBR322-peg-gp37-LL10 recombinant bacteria expressing the conservative functional small peptide LL10, and the detection control is S9H-pBR-peg.

[0028] Advantages: Compared with the prior art, the present application has the following advantages:

[0029] (1) The conservative functional small peptide LL10 provided by the present application is a functional domain of a conserved epitope possessed by gp37 protein of different subgroups of ALV (subgroups A, B, J and K).

[0030] (2) The present application further verifies that the vector bacteria surface expresses peg fimbriae, and the functional domain of the specific antigen epitope of ALV gp37 protein is functionally displayed and expressed on the surface of the vector bacteria through the peg fimbriae, which can specifically recognize and combine ALV infective antibody against the epitope antigen of gp37 protein.

[0031] (3) The detection antigen S9H-pBR322-peg-gp37-LL10 of the present application only increases the conservative functional small peptide LL10 compared with the detection control S9H-pBR-peg, which ensures the specificity of the agglutination test detection method directly mediated by the conservative functional small peptide LL10.

[0032] (4) The present application uses the peg fimbriae display expression system to amplify the number of the conservative functional small peptide LL10 of ALV gp37 protein on the surface of the inert carrier bacteria S9H, which ensures the sensitivity of the detection.

[0033] (5) The present application selects the conservative functional small peptide LL10 and establishes the in vitro agglutination test detection method of ALV infective antibody specific recognition and combination directly mediated by the conservative functional small peptide LL10. This method does not need virus isolation and culture, which reduces the time required for identification.

[0034] In conclusion, the application provides a detection reagent, kit and detection method of agglutination test suitable for different subgroups of ALV infection, the functional small peptide LL10 selected in the application is highly conserved in different subgroups of ALV, and is expected to become an important technology and platform for ALV infection diagnosis, monitoring and prevention and control. The recombinant bacteria of the application can specifically recognize different subgroups of ALV infection antibody serum samples. The recombinant bacteria are used as agglutination antigens, can specifically react with serum infected by different subgroups of ALV, form clear visible agglutination particles, and do not react with serum infected by other pathogens. The application establishes a rapid and convenient detection method for different subgroups of ALV infection, and can realize qualitative and quantitative detection of specific antibodies after ALV infection, and provides a reliable new type of technical method for ALV diagnosis and purification implementation. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Figure 4 is a gp37 protein alignment of A, B, J, K subgroups of ALV and functional small peptide conservation analysis result graph. The red rectangular frame shows the gp37 protein conservative functional small peptide sequence LL10 provided by the application.

[0036] Figure 2 Figure 5 is a schematic diagram of the pUC57-Peg-gp37-LL10 plasmid for expressing LL10.

[0037] Figure 3 Figure 6 is a schematic diagram of the recombinant vector pBR322-peg-gp37-LL10 plasmid for expressing LL10.

[0038] Figure 4 Figure 7 is a PCR amplification identification electrophoretogram of peg-gp37-LL10 and the peg operon gene carried by the standard strain CVCC 526 of chicken pullorum Salmonella, wherein lane M is Trans 2K plus II DNA Marker, lane 1 is the genome amplification product of DH5a engineering bacteria as a negative control, lane 2 is the PCR amplification product of the peg pilus operon containing the LL10 functional small peptide of pUC57-Peg-gp37-LL10, and lane 3 is the PCR amplification product of the peg pilus operon of the standard strain CVCC 526 of chicken pullorum Salmonella.

[0039] Figure 5 Figure 8 is a nucleic acid electrophoretogram of the expression vector pBR322-peg-gp37-LL10. Wherein lane M is Trans 2K plus II DNA Marker, lane 1 is pBR322 plasmid, lane 2 is the recombinant circular plasmid pBR322-peg-gp37-LL10, and lane 3 is the product of double enzyme digestion of pBR322-peg-gp37-LL10 by NheI and EagI.

[0040] Figure 6 The specificity verification detection results of the in vitro agglutination test method for the specific recognition and binding of antibodies mediated by the conserved functional small peptide LL10 in the avian leukosis virus infection, in which the detection antigen is recombinant bacteria S9H-pBR-peg-gp37-LL10 expressing LL10 (right) and the detection control is S9H-pBR-peg (left). If the agglutination reaction is negative, there are no agglutination particles in the reaction solution, and the background is turbid; if the agglutination reaction is positive, visible agglutination particles are produced in the reaction solution, and white agglutination particles are deposited on both sides of the reaction solution. “-” represents a negative agglutination reaction, and “+” represents a positive agglutination reaction. The agglutination particles in the positive reaction are marked with a red arrow in the figure. DETAILED DESCRIPTION

[0041] Before further describing the specific embodiments of the present application, it should be understood that the scope of protection of the present application is not limited to the following specific embodiments; it should also be understood that the terms used in the embodiments of the present application are used to describe the specific embodiments, and are not intended to limit the scope of protection of the present application. Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art. The embodiments of the present application will be further described below in conjunction with the examples, which are intended to exemplify the present application, and should not be regarded as limiting the scope of the present application. In addition to the specific methods, devices, and materials used in the examples, any method, device, and material of the prior art similar or equivalent to those described in the embodiments of the present application can also be used to implement the present application according to the mastery of the prior art by those skilled in the art and the description of the present application.

[0042] Example 1 Sequence alignment analysis of avian leukosis virus gp37 protein and acquisition of conserved functional small peptide LL10 sequence

[0043] The ALV genome sequence was retrieved by the National Center for Biotechnology Information (NCBI, https: / / www.ncbi.nlm.nih.gov / ), only strains with complete genome information were collected, and 7 strains of ALV-A, 9 strains of ALV-B, 42 strains of ALV-J, and 19 strains of ALV-K were downloaded from NCBI for alignment analysis. The results showed that the gp37 protein amino acid sequence conservation of A / B / J / K subgroups of avian leukosis virus was between 91.5% and 100%, indicating that the protein was highly conserved in ALV and could be used as a candidate antigen protein for diagnosing ALV infection of popular serotypes. The gp37 protein conserved sequence was selected for further analysis, and the sequence analysis of the protein was performed by MegAlign software. The results showed that the small peptide LQNRAAIDFL was highly conserved in the A, B, J, and K subgroups of ALV, and it was a potential functional small peptide sequence. The sequence was named LL10: LQNRAAIDFL.

[0044] The nucleotide sequence of the conserved functional small peptide LL10 of ALV gp37 protein is: CTGCAGAACCGAGCGGCTATTGACTTCTTG.

[0045] Example 2 Selection of substitution site of gp37 conserved functional small peptide LL10 in peg pilus

[0046] According to the Salmonella Pullorum CVCC 526 peg operon sequence (shown in SEQ ID NO. 4), the Salmonella Pullorum CVCC 526 peg pilus was predicted using the PredictProtein online website (https: / / predictprotein.org / ), to find the amino acids exposed on the surface of the peg pilus. The spatial structure of peg was predicted using the online protein tertiary structure prediction website SWISS-MODEL, and the spatial structure of peg was visualized using the protein analysis software Pymol (https: / / pymol.org / 2 / ). The position of PegA with better exposure was selected as the substitution site of the gp37 protein conserved functional small peptide LL10, which started from the 63rd amino acid at the N terminus of the PegA protein.

[0047] Example 3 Construction of recombinant vector pBR322-peg-gp37-LL10 carrying LL10 expression

[0048] According to the Salmonella Pullorum CVCC 526 peg operon sequence (Yang Weifeng. Preparation and preliminary clinical application of anti-salmonella peg fimbria monoclonal antibody[D]. Yangzhou University, 2016.) (SEQ ID NO. 4), the LL10 sequence of the gp37 protein conservative functional small peptide determined above was replaced into the alternative exposure site in PegA, and the peg operon full-length plasmid containing the gp37 conservative functional small peptide LL10 nucleotide sequence was synthesized by Nanjing Qikexin Biotechnology Co., Ltd., named pUC57-Peg-gp37-LL10 (the plasmid map is shown in Figure 1). Figure 2 The peg operon containing the LL10 nucleotide sequence was inserted between the Xba I and BamH I enzyme digestion sites of the pUC57 plasmid). At the same time, a pair of primers was designed for peg-gp37-LL10 (SEQ ID NO. 1), the upstream primer was peg-F: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3', and the downstream primer was peg-R: 5'-CT CGGCCG TTAATTATAAGATACCACGATTAATGC-3', and the underlined sequences represent Nhe I and Eag I restriction enzyme digestion sites, respectively. Using the upstream and downstream primers peg-F / R, pUC57-PegA-gp37-LL10 plasmid (synthesized by Nanjing Qikexin Biotechnology Co., Ltd.), Salmonella Pullorum standard strain CVCC 526 (purchased from China Institute for Control of Animal Product Food Safety, China National Veterinary Drug Market Supervision Center) genomic DNA (positive control), and Escherichia coli DH5a genomic DNA (negative control) as templates, PCR amplification was performed, and the amplification system was as follows: pfu high-fidelity DNA Polymerase (concentration of 2.5 U / μL) (Beijing Zhenben Golden Biotechnology Co., Ltd.) 2 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 5 μL, each 2 μL of the upstream and downstream primers (10 mM), 2 μL of pUC57-Peg-gp37-LL10 (250 ng / μL), CVCC 526 genomic or DH5a genomic DNA, and 27 μL of ultrapure water. After mixing the above system uniformly, PCR amplification was performed using a thermal cycler (Bio-Red), and the program was as follows: pre-denaturation at 94℃ for 5 min, a total of 30 cycles of amplification, including denaturation at 94℃ for 30 s, annealing at 52℃ for 30 s, and extension at 72℃ for 5 min, further amplification at 72℃ for 10 min, and the temperature was reduced to 12℃ after amplification. The PCR product was electrophoresed in a 1.0% agarose gel at a voltage of 110 V, and after electrophoresis, it was stained with ethidium bromide, and the results were observed using a gel imaging instrument. The electrophoresis results are shown in Figure 2. Figure 4As shown, the DNA product of 4850bp was amplified from both Salmonella pullorum CVCC 526 and pUC57-PegA-gp37-LL10, while no band was amplified from the negative control E. coli engineering bacteria DH5a genome. The peg-gp37-LL10 (4850bp) amplified from pUC57-PegA-gp37-LL10 was purified using universal DNA purification recovery kit (Tiangen Biotech (Beijing) Co., Ltd., Catalog No: DP105) and stored at -20℃ for later use.

[0049] The pBR322 plasmid and the purified peg-gp37-LL10 gene fragment were double-digested with Nhe I and Eag I restriction endonucleases. The digested products were electrophoresed in a 1.0% agarose gel at 110V for 45min, and the target band was purified using universal DNA purification recovery kit. The purified pBR322 plasmid digested fragment and the peg-gp37-LL10 digested fragment were ligated using T4 DNA ligase (NEB, Beijing, Catalog No: M0202) at 16℃ metal bath overnight. The next day, the ligation product was transformed into DH5a competent cells, which were plated on LB solid medium containing 100μg / mL Amp+ and incubated at 37℃ for 16h. A single colony was inoculated into liquid LB medium containing 100μg / mL Amp+, and the plasmid was extracted after overnight culture. The plasmid was identified again by double digestion with Nhe I and Eag I. The digested products were electrophoresed in a 1.0% agarose gel at 110V for 45min, and observed in a gel imaging system after ethidium bromide staining. The results are shown in Figure 2. Figure 5 As shown, the double-digested products of the recombinant plasmid pBR322-peg-gp37-LL10 were a linear pBR322 vector of 3651bp and a peg-gp37-LL10 fragment of 4850bp, which was consistent with the expectation. According to the identification primers of the PegA gene, the primer sequences were: upstream primer pegA-F (5'-ATGAAACGTTCACTTATTGCTGCT-3') and downstream primer pegA-R (5'-TTAATCAGTTAATACCGTCATCGTCA-3'), the recombinant plasmid pBR322-peg-gp37-LL10 and the identification primers were sent to Nanjing Qikang Biological Technology Co., Ltd. for sequencing, and the results confirmed that gp37-LL10 was successfully inserted into the PegA gene.

[0050] Example 4 Construction and functional verification of in vitro agglutination test detection method for direct mediation of ALV infection by the conserved functional small peptide LL10

[0051] Take 200 ng of pBR322-peg-gp37-LL10 plasmid constructed in Example 3, gently mix with 100 μL S9H competent cells (prepared by the laboratory, S9H strain (Chinese patent ZL202010427735.8, a pan-type inert carrier Salmonella and its potential applications)), use an electroporator to perform electric shock transformation at a voltage of 2.2 KV, immediately add 1 mL of SOC medium after the electric shock is completed, and obtain S9H recombinant bacteria carrying the pBR322-peg-gp37-LL10 plasmid. Incubate at 37°C, 220 rpm for 1 h, inoculate the recovered bacterial solution into liquid LB medium containing 100 μg / mL Amp+, and incubate at 37°C, 220 rpm until the late logarithmic growth phase. Centrifuge at 4°C, 4000 rpm for 5 min to discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cell pellet with an equal volume of pre-cooled sterile normal saline, repeat the centrifugal washing twice. Finally, resuspend the bacterial cell pellet in an appropriate amount of sterile normal saline (the final concentration of the bacterial solution is 1×10 10 CFU / mL), prepare S9H-pBR322-peg-gp37-LL10 bacterial suspension, and control the use of S9H-pBR322-peg (S9H-pBR322-peg is from published Chinese patent application CN118496323A, conserved neutralizing epitope QT7 of North American type porcine reproductive and respiratory syndrome virus envelope major glycoprotein GP5, nucleic acid molecule, expression vector, neutralizing antibody and its application).

[0052] Use 90-day-old SPF chicken negative serum and chicken pullorum Salmonella positive serum as detection samples, wherein the positive serum is prepared by immunizing 90-day-old SPF chickens twice with chicken pullorum Salmonella standard strain CVCC 526 and collecting blood at 45 days after immunization; S9H-pBR322-peg-gp37-LL10 recombinant bacterial suspension, S9H-pBR322-peg recombinant bacterial suspension, and S9H-pBR322 empty vector control bacterial suspension (S9H-pBR322 empty vector is from published Chinese patent application CN118496323A, conserved neutralizing epitope QT7 of North American type porcine reproductive and respiratory syndrome virus envelope major glycoprotein GP5, nucleic acid molecule, expression vector, neutralizing antibody and its application) are used as detection bacterial solution (the concentration of the detection bacterial solution used is 1×10 10CFU / mL) were respectively reacted with negative serum and positive serum, and the agglutination phenomenon was observed. The results are shown in Table 1. The bacterial suspensions of S9H-pBR322-peg-gp37-LL10, S9H-pBR322-peg and S9H-pBR322 did not react with the negative serum. The bacterial suspensions of S9H-pBR322-peg-gp37-LL10 and S9H-pBR322-peg produced specific agglutination reaction with the positive serum (chicken salmonella pullorum), forming white agglutination particles and depositing to both sides of the reaction solution, while the bacterial suspension of S9H-pBR322 empty vector did not produce agglutination phenomenon with the positive serum (chicken salmonella pullorum), and no agglutination particles were produced, and the background was turbid. The results showed that the chicken salmonella pullorum positive serum was specifically recognized by chicken salmonella pullorum peg fimbria, and the peg fimbria could be successfully and functionally displayed on the surface of the inert carrier salmonella S9H.

[0053] Table 1 Functional display verification of peg fimbria on the surface of inert carrier salmonella S9H

[0054]

[0055] Note: "negative" refers to negative agglutination reaction, no agglutination particles, and the background is turbid; "positive" refers to positive agglutination reaction, white agglutination particles depositing to both sides of the reaction solution.

[0056] The above S9H-pBR322-peg-gp37-LL10 bacterial suspension (final concentration of 1×10 10 CFU / mL) was reacted with 10 portions of SPF chicken serum, 10 portions of ALV-J artificially infected SPF chicken positive serum (ALV-J JS09GY3 strain was artificially infected in SPF chickens to prepare and preserve in the laboratory), 10 portions of ALV-A infected SPF chicken positive serum, 10 portions of ALV-B infected SPF chicken positive serum, and 10 portions of ALV-K infected SPF chicken positive serum (all were donated by Guizhou University), respectively, to carry out agglutination test, and the S9H-pBR-peg bacterial suspension containing pBR-peg was used as a negative control.

[0057] The results are shown in Table 2. The S9H-pBR322-peg-gp37-LL10 bacterial suspension and the S9H-pBR322-peg bacterial suspension did not agglutinate with the SPF chicken serum. The S9H-pBR322-peg-gp37-LL10 bacterial suspension significantly agglutinated with 10 positive sera from ALV-J artificially infected chickens, 10 positive sera from SPF chickens infected with ALV-A, 10 positive sera from SPF chickens infected with ALV-B, and 10 positive sera from SPF chickens infected with ALV-K. White agglutination particles were deposited on both sides of the reaction solution. The S9H-pBR322-peg control did not agglutinate with the above-mentioned sera, and no agglutination particles were produced, and the background was turbid. The results show that the conserved functional small peptide LL10 can be displayed on the surface of the inert carrier Salmonella by peg pilus, and can detect antibodies against ALV. In this detection method, S9H-pBR322-peg is used as a detection control, and compared with the detection antigen S9H-pBR322-peg-gp37-LL10, the detection control only lacks the conserved functional small peptide LL10, and the absence of agglutination in the control ensures the specificity of the detection results.

[0058] Table 2. Functional verification of the display and expression of the gp37 protein conserved functional small peptide LL10 on the surface of S9H

[0059]

[0060]

[0061] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0062] Example 5. Specificity and sensitivity test of the in vitro agglutination test method for specific recognition and binding of antibodies of avian leukosis virus infection directly mediated by the conserved functional small peptide LL10

[0063] According to the method in Example 4, the detection control S9H-pBR-peg bacterial suspension and the detection antigen S9H-pBR322-peg-gp37-LL10 bacterial suspension (bacterial solution concentration is 1×10 10 CFU / mL) were prepared, respectively, and the above two bacterial suspensions were agglutinated with positive sera / antibodies with different background information to verify the specificity of the plate agglutination detection method. The sera / antibodies used include:

[0064] The above S9H-pBR322-peg-gp37-LL10 bacterial suspension was subjected to agglutination test with 10 portions of SPF chicken serum (collected and preserved by the Comparative Medicine Center of Yangzhou University), 10 portions of ALV-J artificially infected SPF chicken positive serum (donated by Guizhou University), 10 portions of ALV-A, B and K infected SPF chicken serum (donated by Guizhou University), 10 portions of reticuloendotheliosis virus (REV) infected positive serum (prepared and preserved in the laboratory), 10 portions of chicken infectious bronchitis virus (IBV) infected positive serum (preserved in the laboratory), 10 portions of avian influenza virus (AIV) infected positive serum (prepared and preserved in the laboratory), 10 portions of Marek's disease virus (MDV) infected positive serum (provided by Yangzhou University), 10 portions of infectious bursal disease virus (IBDV) infected positive serum (provided by Yangzhou University), 10 portions of Newcastle disease virus (NDV) infected positive serum (provided by Yangzhou University), 10 portions of Salmonella enteritidis (SE) infected positive serum (prepared and preserved in the laboratory), and 10 portions of avian pathogenic Escherichia coli (APEC) infected positive serum (prepared and preserved in the laboratory), respectively, and the S9H-pBR-peg bacterial suspension containing pBR-peg was used as a negative control.

[0065] The experimental results are shown in Table 3, and part of the agglutination test results are shown in Table 4. Figure 6 S9H-pBR-peg detection control does not agglutinate with all serum / antibodies; S9H-pBR322-peg-gp37-LL10 only reacts with ALV positive serum, and does not react with negative serum and other pathogen positive serum / antibodies.

[0066] Table 3 Specificity verification of in vitro agglutination test detection method for specific recognition and binding of avian leukosis virus infection antibody mediated by conserved functional small peptide LL10

[0067]

[0068] Note: "-" represents negative agglutination reaction; "+" represents positive agglutination reaction

[0069] The sensitivity test of the present application is to determine the earliest detection time of avian leukosis virus antibody by detecting chicken serum at different days after avian leukosis virus infection of ALV strain (prepared and preserved in the laboratory). Before artificial infection, whole blood of chickens was collected, serum separation and preparation were performed; then 21-day-old chicks were injected with ALV-J JS09GY3 strain (Luo Huan. Exploration of chicken anti-ALV-J inhibitor based on c-Myc protein regulated glucose metabolism pathway [D]. Yangzhou University, 2023.) by muscle injection, and the infection dose was 0.2 mL 10 5 TCID 50ALV-J virus liquid, 7, 14 days collection and preparation of chicken serum, using the direct mediation of the small peptide antigen LL10 of the application of the function of the conservation of the in vitro agglutination test to detect the ALV infection antibody in the serum. The antibody detection results of the serum of the infected chicken are shown in Table 4.

[0070] Table 4 Sensitivity verification of the in vitro agglutination test detection method of the specific recognition and combination of the small peptide LL10 of the application of the function of the conservation of the ALV infection antibody

[0071] As can be seen from Table 4, the in vitro agglutination test detection method directly mediated by the small peptide LL10 of the application of the function of the conservation can detect the agglutination reaction antibody in the serum of the artificially infected ALV chicken on the 7th day, and has high sensitivity.

[0072] In summary, the in vitro agglutination test detection method directly mediated by the small peptide of the application based on the transmembrane protein gp37 of the avian leukemia virus (ALV) can specifically recognize and combine the ALV infection antibody, and has potential application prospects in the ALV purification. Using the detection system directly mediated by the small peptide LL10 of the application of the function of the conservation, the antibody level in the sample (serum) detected by the in vitro agglutination test can be specifically recognized and combined after the chicken is infected with ALV, so that a rapid, specific and sensitive in vitro agglutination test detection method is established. The method has the advantages of simple operation, low cost and intuitive results, and is suitable for batch detection and early screening of ALV infection in large-scale breeding farms.

[0073] SEQ ID NO. 1: Recombinant peg-ALV-gp37-LL10 gene fragment

[0074]

[0075] SEQ ID NO. 2: Recombinant pegA-ALV-gp37-LL10 gene sequence

[0076] ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTATTTATGAGCGCTGGGGTTTTTGCTGCTGATGAAGATATGGGGGAATTAAAAATAAACGGAGAAGTGGTGGGAACATCCTGTACTTTCGAAGGTGCAAATAGCGCGACTATTGAATTATCCCAGGTAGGTGTTGATAGATTGACTCTGCAGAACCGAGCGGCTATTGACTTCTTGTACACTAGCCCAGAAGCGATTTTAAAAGTAAGATGTACGAATACAGCTAATCCACGAATTAGTTTTAACCGTTCTCAATTTGTGGATAACATGCAAATCACCAAAAATAATGCTACTAATAATGGTGCGGGCTTCGCTGTTTATCTTGATGGTATTCAGGTGAAACCGGATGAGGCGGGGAATTACACTCTGAATTCAAGTAAGTTTGAAAATGGTGTATATACCCTGAACTTTTCTGCCCGCTATGCCGCCGTTGAAAATACTGTAACACCAGGTTCTGTTGAATCTGTACTGACGATGACGGTATTAACTGATTAA

[0077] SEQ ID NO. 3: Recombinant PegA-LL10 protein amino acid sequence

[0078] MKRSLIAASVLSAVFMSAGVFAADEDMGELKINGEVVGTSCTFEGANSATIELSQVGVDRLTLQNRAAIDFLYTSPEAILKVRCTNTANPRISFNRSQFVDNMQITKNNATNNGAGFAVYLDGIQVKPDEAGNYTLNSSKFENGVYTLNFSARYAAVENTVTPGSVESVLTMTVLTD

[0079] SEQ ID NO. 4: Full length of peg operon

[0080]

Claims

1. A conserved functional small peptide of avian leukemia virus protein gp37, characterized in that, The amino acid sequence of the functional peptide is LQNRAAIDFL.

2. A nucleic acid molecule encoding the functional small peptide of claim 1, characterized in that, The DNA sequence of the nucleic acid molecule is CTGCAGAACCGAGCGGCTATTGACTTCTTG.

3. A recombinant gene fragment, characterized in that, The recombinant gene fragment is obtained by inserting the nucleic acid molecule of claim 2 into the Peg fimbriae coding gene sequence, and the nucleotide sequence of the recombinant gene fragment is shown in SEQ ID NO.

1.

4. The recombinant protein of the recombinant gene according to claim 3, characterized in that, The amino acid sequence of the recombinant protein is shown in SEQ ID NO.

2.

5. An expression cassette, a recombinant expression vector, a recombinant cell or a recombinant bacterial strain, characterized in that, It comprises the nucleic acid molecule of claim 2 or the recombinant gene fragment of claim 3.

6. The method for constructing the recombinant expression vector according to claim 5, characterized in that, The process includes the following steps: inserting the nucleic acid molecule of the functional small peptide described in claim 2 into the peg fimbriae encoding gene sequence and introducing it into a vector, or introducing the recombinant gene fragment described in claim 3 into a vector to construct a recombinant expression vector.

7. The method for constructing the recombinant strain according to claim 5, characterized in that, The method comprises converting the recombinant expression vector of claim 5 into a vector bacterium.

8. A detection system for avian leukosis virus infectious antibodies, characterized in that, The detection system includes the expression cassette, recombinant vector, recombinant cell or recombinant strain as described in claim 5.

9. The use of the functional small peptide of claim 1, the nucleic acid molecule of the functional small peptide of claim 2, the gene fragment of claim 3, the recombinant protein of claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain of claim 5, and the avian leukosis virus infectious antibody detection system of claim 8 in the preparation of reagents or kits for detecting avian leukosis virus infectious antibodies.

10. A reagent or kit for detecting infectious antibodies against avian leukosis virus, characterized in that, The reagents or kits include the functional small peptide of claim 1, the nucleic acid molecule of the functional small peptide of claim 2, the gene fragment of claim 3, the recombinant protein of claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain of claim 5, and the avian leukemia virus infectious antibody detection system of claim 8.

Images