Pichia kudriavzevii and application thereof
By screening out the Pichia pastoris strain suitable for cherry wine brewing, the problem of strain shortage in cherry wine research has been solved, improving the quality and flavor of cherry wine and aligning with the development direction of national policies.
Patent Information
- Application Number
- CN202510652528.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-12-19
AI Technical Summary
The existing technology lacks suitable patent specifications for cherry wine. In the patent specification for cherry wine, a strain of Kudriazvibichi yeast has been researched and developed, which is particularly suitable for the brewing of cherry wine.
A strain of Pichia kudriezweig was screened and found to be suitable for cherry wine brewing. A strain composition and preparation containing this strain are provided, as well as a method of application in the brewing of cherry wine.
It significantly improves the quality and flavor of cherry wine, meets market demand for cherry wine, and aligns with national policy development direction.
Smart Images

Figure HDA0005411526930000011 
Figure HDA0005411526930000012 
Figure HDA0005411526930000013
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of bioengineering, and particularly relates to a Pichia kudriavzevii strain and application thereof, especially application in fruit wine brewing. BACKGROUND
[0002] Cherry is a plant of Cerasus Mill. in Rosaceae, and is recognized as the "natural VC king" in the world. The harvest period of cherry is very short, and cherry is not resistant to storage and transportation. A large number of fresh fruits are prone to rot and spoilage. Therefore, developing cherry wine is an optimal way to improve the added value of cherry and promote the development of cherry industry.
[0003] In recent years, domestic researchers mainly focus on two aspects in the research of cherry wine. On the one hand, cherry beer is brewed by adding fruit juice or fruit flavor essence; on the other hand, cherry fruit wine is fermented by inoculating yeast with cherry as raw material. However, the research and development of cherry fruit wine are relatively less, and special fermentation strains for fruit wine other than grape wine and apple wine have not been formed in China.
[0004] It can be seen that there is an urgent need to select suitable fermentation strains for cherry raw materials and to develop the technology of brewing cherry fruit wine by using the strains. SUMMARY
[0005] In view of the above problems, after repeated groping, the present inventors finally screened a Pichia kudriavzevii strain through multiple separation and purification, which is particularly suitable for brewing cherry fruit wine.
[0006] Therefore, on the one hand, the present application provides a Pichia kudriavzevii, which is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20242729.
[0007] The strain is also referred to as Pichia kudriavzevii YYN-5 in the present application.
[0008] On the other hand, the present application provides a strain composition comprising the Pichia kudriavzevii YYN-5.
[0009] In specific embodiments, the strain composition further comprises any suitable commercial yeast strain, such as yeast strain Red Fruit.
[0010] Further, the present application provides a strain preparation comprising: i) the Pichia kudriavzevii YYN-5; or ii) the strain composition comprising the Pichia kudriavzevii YYN-5.
[0011] In a specific embodiment, the preparation is a starter culture preparation for food processing.
[0012] In another aspect, the present application provides use of Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof in brewing fruit wine, such as cherry wine, grape wine (e.g., red wine), strawberry wine, cider and tangerine wine.
[0013] In a specific embodiment, the present application provides use of Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof in brewing cherry wine.
[0014] In another aspect, the present application provides a method of brewing fruit wine, comprising a step of subjecting fruit juice to fermentation with Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof.
[0015] In a specific embodiment, the fruit juice is derived from cherry, grape, strawberry, apple or tangerine.
[0016] In a specific embodiment, the method comprises a step of formulating Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof as a seed broth with a cell concentration of not less than 10 7 cfu / mL.
[0017] In a specific embodiment, the method comprises the steps of: preparing fruit juice; inoculating the seed broth into the fruit juice, subjecting to fermentation at 20-30°C for 10-15 days, and obtaining base wine by solid-liquid separation technique.
[0018] In a specific embodiment, the method further comprises a step of subjecting the base wine to a temperature of 15-20°C for 30-90 days, filtering to remove bacteria, and obtaining fruit wine.
[0019] In another specific embodiment, the present application provides a method of brewing cherry wine, comprising a step of subjecting cherry juice to fermentation with Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof.
[0020] In a specific embodiment, the method comprises a step of formulating Pichia kudriavzevii YYN-5, a starter culture composition comprising Pichia kudriavzevii YYN-5 or a preparation thereof as a seed broth with a cell concentration of not less than 10 7 cfu / mL.
[0021] In a specific implementation plan, the method includes the following steps: preparing cherry juice; inoculating the juice with seed liquid and fermenting it at 20°C to 30°C for 10 to 15 days, obtaining cherry fruit wine through solid-liquid separation technology; and placing the cherry fruit wine at 15°C to 20°C for 30 to 90 days, filtering and sterilizing it to obtain cherry fruit wine.
[0022] Therefore, this application also provides fruit wine brewed by the above method.
[0023] In a specific implementation plan, this application provides cherry wine, grape wine, strawberry wine, apple wine, or Wogan wine brewed by the above method. Attached Figure Description
[0024] Figure 1 The colony morphology of Pichia pastoris YYN-5 provided in this application.
[0025] Figure 2 The ester production performance test results of Pichia pastoris YYN-5 provided for this application.
[0026] Figure 3 The ethanol production performance test results of Pichia pastoris YYN-5 provided for this application.
[0027] Figure 4 Phylogenetic tree of Pichia kudria zwiyni YYN-5 provided in this application.
[0028] The Pichia kudriavzevii YYN-5 strain described in this application was deposited on December 5, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, with accession number CCTCCNO:M 20242729. Detailed Implementation
[0029] Cherry wine is rich in various health-promoting components, offering beneficial effects on the blood, cardiovascular system, and overall health. Furthermore, transforming cherries into cherry wine not only preserves their nutrients in the wine but also increases its added value, aligning with the national policy of "reducing grain-based alcohol consumption and developing fruit-based alcohol consumption."
[0030] Cherry wine production is currently in the development stage. Yeast is key to fruit wine fermentation, directly determining its quality and sensory characteristics. However, there is currently no dedicated fermentation strain for cherry wine.
[0031] To this end, the inventors of this application, through repeated trials, obtained the Pichia pastoris strain YYN-5, suitable for cherry wine brewing, from cherry fermentation broth after primary screening, secondary screening, and purification. This strain exhibits strong ester production and fermentation properties. Accordingly, this application also provides a method for brewing cherry wine and the resulting cherry wine.
[0032] In this application, the provided Pichia kudriezwiyne is named Pichia kudriezwiyne YYN-5.
[0033] Specifically, this application provides the following technical solution:
[0034] In the first aspect, this application provides Pichia pastoris YYN-5, with accession number CCTCCNO:M 20242729.
[0035] The Pichia pastoris YYN-5 strain provided in this application can be used with other fermentation strains.
[0036] Therefore, in a second aspect, this application provides a microbial composition comprising Pichia pastoris YYN-5.
[0037] In specific implementations, the microbial composition provided in this application also includes any suitable commercial yeast, such as Red Fruit yeast.
[0038] Furthermore, the Pichia pastoris YYN-5 or strain composition provided in this application can be prepared into an easy-to-use product form, such as a strain preparation.
[0039] Therefore, in a third aspect, this application provides a strain preparation comprising: i) Pichia kudriezwiyne YYN-5, or ii) a strain composition comprising Pichia kudriezwiyne YYN-5.
[0040] In the specific implementation plan, the preparation provided in this application is a microbial strain preparation for food processing.
[0041] In this application, microbial preparations for food processing refer to food raw material preparations made from one or more live microorganisms (including bacteria, filamentous fungi, and yeast) that can be used in food, through processes such as fermentation, enrichment, emulsification or non-emulsification, drying or non-drying, mixing or non-mixing, and packaging.
[0042] Based on the screened Pichia kudriezweig YYN-5, in a fourth aspect, this application provides the use of Pichia kudriezweig YYN-5 of the first aspect, the strain composition of the second aspect, or the strain preparation of the third aspect in the brewing of cherry wine, wine (red wine), strawberry wine, cider, or Wogan wine.
[0043] In specific implementations, this application provides the use of Pichia kudriezwiyne YYN-5 (first aspect), a microbial composition (second aspect), or a microbial preparation (third aspect) in the brewing of cherry wine.
[0044] In a sixth aspect, this application provides a method for brewing fruit wine, which includes brewing fruit wine using Pichia pastoris YYN-5 of the first aspect, a microbial composition of the second aspect, or a microbial preparation of the third aspect.
[0045] In a specific implementation, this application provides a method for brewing cherry wine, which includes the steps of using Pichia pastoris YYN-5 (a first aspect), a microbial composition (a second aspect), or a microbial preparation (a third aspect) to brew cherry wine.
[0046] In a specific implementation, this application provides a method for brewing cherry wine, which includes preparing Pichia pastoris YYN-5 of the first aspect, the strain composition of the second aspect, or the strain preparation of the third aspect to a cell concentration of not less than 10. 7 Steps for preparing seed culture at cfu / mL.
[0047] In a specific implementation plan, the method for brewing cherry wine provided in this application includes the following steps: reviving the seed liquid at 38°C for 30 minutes, adding the yeast solution seed liquid to the fruit pulp or juice, with a seed liquid to juice ratio of 1:2500, fermenting at 20-30°C for 10-15 days, separating the solid and liquid to obtain the base wine; and placing the base wine at 15-20°C for 30-90 days, filtering and sterilizing to obtain the cherry wine.
[0048] In a seventh aspect, this application also provides fruit wine brewed by the above method.
[0049] In specific implementations, this application provides cherry wine, wine (e.g., red wine), strawberry wine, cider, and Wogan liqueur produced by the above methods.
[0050] The cherry wine produced according to the method of this application has significantly improved quality and flavor.
[0051] The Pichia kudriavzevii YYN-5 strain screened in this application has strong ester production capacity and a certain ethanol production capacity. It is tolerant of low pH and high sugar environments and is particularly suitable for brewing fruit wine.
[0052] Example
[0053] The following embodiments are used to illustrate this application, but are not intended to limit the scope of this application. Any modifications or substitutions made to the methods, steps, or conditions of this application without departing from the spirit and substance of this application are within the scope of this application.
[0054] Unless otherwise specified, all reagents used in the examples are commercially available and all technical means used in the examples are conventional means well known to those skilled in the art.
[0055] The culture medium components involved in the following examples are as follows:
[0056] YPD liquid medium (1L): 10g yeast extract; 20g peptone; 20g glucose.
[0057] YPD solid medium (1L): Add 20g / L of agar powder to YPD liquid medium.
[0058] Ester production screening medium: Add 4 g / L of glyceryl tartrate to YPD solid medium.
[0059] TTC (2,3,5-triphenyltetrazolium chloride) upper culture medium: TTC 0.5 g / L, glucose 5 g / L, agar 15 g / L.
[0060] TTC lower layer medium: MgSO4 0.4g / L, KH2PO4 1.0g / L, yeast extract 1.5g / L, peptone 2g / L, glucose 10g / L, agar 20g / L.
[0061] Example 1: Screening and identification of Pichia pastoris YYN-5
[0062] In this embodiment, Pichia pastoris YYN-5 was selected from cherry juice.
[0063] 1. Isolation and purification of yeast
[0064] 200.77g of fresh Mengzi cherries (Prunus henryi (CKSchneid.) Koehne in Sarg.) were weighed, juiced, and placed into a sterilized 500mL beaker. The mixture was then naturally fermented at 28℃ for 3 days until a wine-like aroma was observed. The cherry fermentation broth was filtered through sterile gauze and serially diluted 10-fold to obtain 10... -4 10 -5 10 -6Diluents of the above concentrations were prepared. 0.2 mL of each diluent was spread onto malt extract solid medium and YPD solid medium containing antibiotics (nystatin 100 mg / L and chloramphenicol 100 mg / L), with each gradient replicated three times. The culture was incubated at 28°C for 2 days. Colony growth was observed, and single colonies exhibiting a milky white color and a strong alcoholic aroma were selected and streaked onto YPD solid medium for purification.
[0065] 2. Initial screening
[0066] Using a sterile inoculation loop, scrape a small amount of the isolated and purified yeast cells and inoculate them into YPD liquid medium near an alcohol lamp flame. Gently shake to mix, then incubate at 28-30℃ with shaking at 180-200 rpm for 18-24 hours, until the medium becomes turbid. Dilute 100 μL of the bacterial culture to a concentration of 10:1. -5 Then, 100 μL of bacterial culture was spread onto WL medium (purchased from Qingdao Rishui Biotechnology Co., Ltd.) and incubated at 28°C for 5 days.
[0067] Wipe the slide and coverslip with an alcohol swab to remove grease or impurities. Place one drop of sterile physiological saline (or 0.85% NaCl solution) in the center of the slide. Using an inoculation loop, pick up a small amount of bacteria from the activated colony or liquid culture medium, gently touch the edge of the droplet to disperse the bacteria within it, and slowly lower the coverslip at a 45° angle, avoiding the formation of air bubbles. Observe the prepared slide under a microscope (400×).
[0068] The yeast colonies were initially screened based on their surface morphology, color, and reproductive method. The colonies were homogeneous and smooth with neat edges, moist and glossy, with a raised center and flat or slightly thin edges. They were milky white to beige, with buds forming on the surface of the mother cells. After maturation, the colonies were separated and had a diameter of about 1-3 mm. 26 yeast strains with an alcoholic aroma were selected.
[0069] 3. Secondary screening
[0070] YYN-5 was further screened from the initial 26 yeast strains based on fermentation performance, hydrogen sulfide production characteristics, and ester production capacity. Its colony morphology is as follows: Figure 1 As shown.
[0071] Depend on Figure 1 As can be seen, the obtained Pichia pastoris YYN-5 colonies are oval with hairy edges, a bluish-green center, an uneven surface, and a strong alcoholic aroma.
[0072] The specific rescreening process is as follows.
[0073] Take 100 μL of bacterial suspension from a -20℃ glycerol tube, inoculate it into 5 mL of YPD liquid medium, and activate it in a shaker (28℃, 180 r / min) for 24 h to obtain a bacterial suspension for the following experiments.
[0074] 3.1 Yeast fermentation performance test
[0075] Inverted Durham tubes were placed in test tubes containing YPD liquid, and then inoculated with bacterial suspension. The tubes were incubated at 28°C for 3 days. Gas production was observed every 24 hours, and the gas height in the Durham tubes was recorded to assess the fermentation capacity of the strain. Compared with other strains, strain YYN-5 was found to have the fastest gas production rate, suggesting that it has strong fermentation performance. The results are shown in Table 1.
[0076] Table 1 Gas production in the Durham tubules
[0077] Numbering 24h 48h 72h Precipitation YYN-5 + ++ +++ White, loose
[0078] Note: "+", "++", and "++++" indicate that gas production reaches 1 / 3, 2 / 3, and all of the Durbin tubule volume, respectively.
[0079] 3.2 Ester production performance test
[0080] Yeast produces esterases that can break down tricresyl esters, resulting in a clear zone around the colony. The diameter of this clear zone is positively correlated with the esterase activity. A 5 μL bacterial suspension was spotted onto the ester-producing medium and incubated at 28°C for 4 days. The growth of the strain was observed and recorded. The results are as follows: Figure 2 As shown.
[0081] The ratio of the diameter of the transparent zone to the diameter of the colony was determined to be 1.21. Figure 2 The strain YYN-5 exhibits a distinct clear zone, indicating its high ester production capacity.
[0082] 3.3 Ethanol Production Performance Test
[0083] TTC (2,3,5-triphenyltetrazolium chloride) reacts with dehydrogenases produced during yeast metabolism to form red or purple formazan compounds, and the amount produced is positively correlated with dehydrogenase activity. 5 μL of bacterial suspension was inoculated into the lower layer of TTC medium and incubated at 28°C for 24–48 hours until yeast growth. Then, the upper layer of TTC medium was slowly covered (avoiding air bubbles). After 24 hours of incubation in the dark, the color development of the strain was observed and recorded. The results are as follows: Figure 3 As shown.
[0084] visible, Figure 3 The strain YYN-5 was clearly red, indicating that strain YYN-5 has a certain ability to produce ethanol.
[0085] 4. Identification of strain YYN-5
[0086] After centrifuging 1 mL of bacterial suspension at high speed for 5 min, the supernatant was discarded, and the suspension was placed in a microwave oven and baked for 2–3 hours until the bacterial precipitate turned a dark yellow color. Sterile water was added, and the suspension was centrifuged again at high speed for 5 min. The supernatant was collected to prepare a DNA template. Yeast genomic 26S rDNA D1 / D2 was amplified using primers NL1 (5'-GCATCAATAAGCGGAGGAAAAG-3', SEQ ID NO:2) and NL4 (5'-GGTCCGTTTCAAGACGG-3', SEQ ID NO:3). After passing 1% agarose gel electrophoresis, the PCR amplification products were sequenced by Kunming Qingke Biotechnology Co., Ltd.
[0087] The sequencing results of strain 26S rDNA are shown in SEQ ID NO:1 below:
[0088] GTGTCACGGGTGCTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTG AGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAG ATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGGCCTTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCA GGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCGCCCGTCTAAAAACCCGGGCCCAAATT
[0089] The sequencing results were compared with regional sequences in the GenBank database using BLAST homology. Gene sequences with high homology were selected, and a phylogenetic tree was constructed using MEGA X biological software to analyze the taxonomic position of the strains. Figure 4 The phylogenetic tree of the screened strain YYN-5 is shown.
[0090] The 26S rDNA sequence alignment results showed that strain YYN-5 had 100% base pair homology with Pichia kudriazwieldii, as detailed in Table 2.
[0091] Table 2 Results of yeast sequence alignment
[0092] Strain Number Reference Strain Fragment Length / bp Genebank Number Homology / % YYN-5 Pichia kudriavzevii JW2-1 583 KU316741.1 100
[0093] Based on morphological characteristics, strain YYN-5 was identified as *Pichiakudriavzevii*, which was deposited at the China Center for Type Culture Collection on December 5, 2024, with accession number CCTCCNO:M 20242729.
[0094] Example 2: Tolerance test of Pichia pastoris YYN-5
[0095] This embodiment further conducted tolerance experiments on the selected Pichia pastoris strain YYN-5, specifically including the following aspects.
[0096] The Pichia pastoris YYN-5 suspension used in the following experiments was prepared as follows: Under aseptic conditions, 100 μL of bacterial suspension was taken from a -20℃ glycerol culture tube and inoculated into a sterile centrifuge tube containing 5 mL of YPD liquid medium. The tube was then placed in a 28℃ constant temperature shaker and cultured at 180 r / min for 24 hours to allow the cells to fully recover and proliferate, thus obtaining activated yeast seed culture for subsequent experiments.
[0097] 1. High glucose tolerance test
[0098] Differences in sugar content create differences in osmotic pressure, which can then be used to determine the hyperosmotic tolerance of bacterial strains.
[0099] Pichia pastoris YYN-5 suspension was inoculated into YPD medium with glucose concentrations of 200, 250, 300, 350, and 400 g / L, and cultured at 28°C for 24 h. OD values at different glucose concentrations were then measured. 600 The growth of yeast was detected, and the results are shown in Table 3.
[0100] Table 3. Tolerance of Pichia pastoris YYN-5 to high sugar levels.
[0101] Glucose Concentration (g / L) 200 250 300 350 400 OD 600 ]] 1.154 1.169 0.716 0.561 0.511
[0102] 2. Sulfur dioxide tolerance test
[0103] Pichia pastoris YYN-5 suspension was inoculated into YPD liquid medium with sulfur dioxide (added as H2SO3) concentrations of 60, 120, 180, 240, 300, and 360 mg / L, respectively, and cultured at 28℃ for 24 h. OD values at different sulfur dioxide concentrations were then measured. 600 The growth of yeast was detected, and the results are shown in Table 4.
[0104] Table 4. Tolerance of Pichia pastoris YYN-5 to sulfur dioxide.
[0105] Sulfur Dioxide (mg / L) 60 120 180 240 300 360 OD 600 ]]> 1.483 1.518 1.362 1.341 1.327 1.112
[0106] 3. Alcohol tolerance test
[0107] Pichia pastoris YYN-5 suspension was inoculated into YPD liquid medium with alcohol concentrations of 3%, 6%, 9%, 12%, 15%, and 18% (v / v), and cultured at 28°C for 24 h. OD values at different alcohol concentrations were then measured. 600 The growth of yeast was detected, and the results are shown in Table 5.
[0108] Table 5. Alcohol tolerance of Pichia pastoris YYN-5.
[0109] Alcohol Volume Fraction (%) 3 6 9 12 15 18 OD 600 ]] 1.335 1.013 0.429 0.064 0.135 0.189
[0110] 4. Temperature tolerance test
[0111] A suspension of *Pichia pastoris* YYN-5 was inoculated into YPD liquid medium and cultured at 4℃, 15℃, 25℃, 35℃, and 40℃ for 24 h. The OD values at different culture temperatures were then measured. 600 The growth of yeast was detected, and the results are shown in Table 6.
[0112] Table 6 Temperature tolerance of Pichia pastoris YYN-5
[0113] Temperature (°C) 4 15 25 35 40 OD 600 ]]> 0.159 0.736 1.410 1.449 1.319
[0114] 5. Acidity tolerance test
[0115] Pichia pastoris YYN-5 suspension was inoculated into YPD liquid medium with pH values (adjusted with citric acid) of pH 2.8, pH 3.2, pH 3.6, and pH 3.8, respectively, and cultured at 28℃ for 24 h. OD values at different culture temperatures were then measured. 600 The growth of yeast was detected, and the results are shown in Table 7.
[0116] Table 7. Acidity tolerance of Pichia pastoris YYN-5
[0117] pH 2.8 3.2 3.6 3.8 OD 600 ]]> 0.617 1.172 1.248 1.248
[0118] The results show that the optimal growth pH for Pichia pastoris YYN-5 is 3.6, and it can also grow well in environments with pH 3.2-3.8; the highest ethanol concentration it can tolerate is 6%, and it can also grow well in environments with 9% ethanol concentration; the highest glucose concentration it can tolerate is 300 g / L, and it can also grow well in environments with 400 g / L glucose concentration; and it grows well in environments with sulfur dioxide concentrations of 60-360 mg / L.
[0119] Example 3: Application of Pichia pastoris YYN-5
[0120] In this embodiment, the selected Pichia pastoris YYN-5 was used to brew cherry wine.
[0121] 1. Fermentation experiment
[0122] Using Mengzi cherry juice as the fermentation substrate (sugar content adjusted to 22°Bx, pH adjusted to 3.8, and 50 mg / L SO2 added for antibacterial effect), yeast YYN-5 and commercial yeast Red Fruit were inoculated respectively (initial inoculum size of 1×10⁻⁶). 6 The strain was subjected to static anaerobic fermentation at a constant temperature of 15℃ (CFU / mL). Changes in residual sugar content and ethanol concentration were dynamically monitored. The fermentation period was set at 18-21 days, with three biological replicates per experiment to evaluate the fermentation efficiency and product stability of the strain. The results are shown in Table 8. Fermentation kinetics were investigated, residual sugar content was determined by HPLC, ethanol yield (concentration) was determined by hydrometer method, and biomass (OD) was measured. 600 ).
[0123] Table 8 Comparison of fermentation efficiency (Mengzi cherry juice, 15℃, 18-21 days)
[0124] Indicator YYN-5 Red Fruit Residual Sugar Amount (g / L) 3.5±0.2 5.2±1.1 Ethanol Yield (% v / v) 10.8±0.3 9.1±0.4 Fermentation Period (days) 18 21
[0125] It is evident that the Pichia pastoris YYN-5 strain screened in this invention can still complete fermentation at a low temperature of 15℃, with an ethanol yield 18.6% higher than the control strain and a residual sugar content of only 67% of the control strain, making it suitable for cool climate production areas or low-temperature processes.
[0126] 2. Determination of aroma compounds
[0127] Gas chromatography-mass spectrometry (GC-MS) analysis: The gas chromatograph was an Agilent 7890GC, and the mass spectrometer was an Agilent 5975B MS (Agilent, USA), equipped with an HP-INNOWAX (60m × 0.25mm × 0.25μm) column, a CTC HS-SPME autosampler, and high-purity helium as the carrier gas at a flow rate of 1.0 mL / min. The injection port temperature was 250℃, the mass spectrometer interface temperature was 280℃, and the ion source temperature was 230℃. The temperature program was an initial temperature of 50℃ held for 1 min, followed by an increase at 3℃ / min to 220℃ held for 5 min. Mass ionization was performed using EI, with an ion energy of 70 eV and a full scan mass spectrum range of 25–350 m / z. Each sample was analyzed in triplicate.
[0128] Qualitative analysis of aroma compounds: The qualitative analysis of compounds was performed using AMDIS software combined with an established aroma compound spectral library to deconvolve the GC-MS full-scan data files. The Automated Mass Spectrum Deconvolution and Identification System (AMDIS) is a software developed by the American National Standards Institute (ANSI) to assist in the qualitative analysis of GC-MS data. This software effectively overcomes the interference of matrix effects and co-elution effects in GC-MS qualitative analysis, increasing the accuracy and reliability of spectral interpretation. During the qualitative process, the corresponding retention index (RI) was calculated based on the retention time of each substance. The RI was calculated by comparing the retention time of the substance with that of C7-C24 n-alkanes (Supelco, Bellefonte, PA, USA) under the same chromatographic conditions. The RI of the component was compared with the RI of the standard, the mass spectrum, and the RI measured under wax column conditions listed in the NIST Chemical WebBook (http: / / webbook.nist.gov / chemistry / ). Components with an absolute difference of less than 50 were identified as the compound.
[0129] Quantitative analysis of aroma compounds: Compounds were qualitatively identified using the NIST14 library and by comparison with the NIST Chemical webbook retention index (RI). For substances without standards, semi-quantitative analysis was performed using standard curves of aroma compounds with similar chemical structures, functional groups, and carbon numbers. Both the standard curves and samples used the same concentration of 4-methyl-2-pentanol as an internal standard to correct the instrument response. All standards were chromatographic grade standards purchased from Sigma-Aldrich.
[0130] Odor Activity Value (OAV) Calculation: Odor Activity Value (OAV) is a commonly used indicator for evaluating the contribution of volatile components to the actual aroma. Currently, many researchers both domestically and internationally use this indicator to evaluate the aroma contribution of volatile components or to identify the main aroma compounds or characteristic compounds of a particular aroma. The OAV of each volatile component is obtained by dividing the content of that substance by its olfactory threshold.
[0131] Gas chromatography-olfactometry (GC-O) analysis of major aroma compounds: The contribution of each aroma compound to the overall aroma was determined using the dilution-based aroma analysis (AEDA). Headspace solid-phase microextraction (HS-SPME) was used for the enrichment of aroma compounds. The extraction method, GC conditions, and qualitative analysis were the same as above. The sample gradient dilution method was as follows: A 12% v / v ethanol solution containing 7 g / L tartaric acid was prepared with distilled water, and the pH was adjusted to 3.4 with 1M NaOH to serve as the model solution. The sample was then serially diluted with the model solution in increments of 5, i.e., diluted to 1 / 5, 1 / 25, 1 / 125, 1 / 625, etc., of the original concentration. Odor evaluation method: Each diluted sample was analyzed by an evaluation panel. The evaluators only needed to indicate at which dilution the analyte was still detectable and describe the odor, until the odor was no longer detectable. The highest dilution factor (FD) at which each aroma compound can be smelled is defined as the dilution factor. The results were statistically analyzed based on the smelling results of more than half of the evaluators. The results are shown in Table 9 below.
[0132] Table 9 Flavor compounds (GC-MS analysis)
[0133] Flavor Substances YYN-5 (pg / L) Red Fruit (pg / L) Sensory Contribution Acetic Acid Phenethyl Ester 520±25 280±18 Rose, Honey Aroma Ethyl Butyrate 85±6 42±5 Cherry, Strawberry Fruit Aroma Linalool 120±8 50±4 Citrus, Lavender Flower Aroma 4-Vinyl Guaiacol 18±2 Not Detected Spicy, Smoky Complexity
[0134] It is evident that the flavor compounds detected in cherry wine mainly include esters (phenethyl acetate, ethyl butyrate), terpenes (linalool), and phenols (cherry glycoside derivatives).
[0135] 3. Sensory evaluation
[0136] Five national level-two or above professional wine tasters scored the wine on a scale of 0-20, evaluating its color, fruit complexity, and acidity balance. Sensory evaluation used standard wine aromas, with characteristics referenced from the French wine aroma product "Le Nez du Vin" (The Nose of Wine). 30mL samples were placed in ISO standard crystal tasting glasses at room temperature (20-25℃). Tasters smelled the still sample for 5-8 seconds, then swirled the glass and smelled again for 5-10 seconds. They were required to describe the aroma characteristics of the sample using 5-6 characteristic terms from the standard wine aroma criteria. Sensory evaluation results are shown in Table 10.
[0137] Table 10 Sensory Evaluation Results (out of 20 points)
[0138] Evaluation Dimension YYN-5 Red Fruit Color (Purple Red Clarity) 18.5±0.5 16.0±0.8 Fruit Aroma Complexity 17.8±0.6 13.2±0.9 Acidity Balance (pH 3.6-3.8) 16.2±0.4 14.5±0.7 Overall Performance 17.5±0.3 13.8±0.6
[0139] As shown in Tables 8 and 9 above, the content of esters (ethyl acetate, ethyl butyrate) and terpenes (linalool) in YYN-5 is 85%-140% higher than that of the control strain, giving the cherry wine a richer floral and fruity aroma. The uniquely synthesized 4-vinylguaiacol adds a layer of spicy complexity to the wine. YYN-5 fermented wines have a more vibrant color, more complex fruit aromas, and a softer acidity, with sensory scores significantly superior to those of traditional brewing yeasts.
[0140] The application has been described in detail above with general descriptions and specific implementation schemes. Any modifications or improvements made based on this application without departing from its spirit shall fall within the scope of protection claimed in this application.
Claims
1. A strain of Pichia kudriavzevii, deposited at the China Center for Type Culture Collection, accession number CCTCC NO:M 20242729.
2. A microbial composition comprising Pichia kudriezweig as described in claim 1.
3. The microbial composition of claim 2, further comprising a commercial yeast, such as Red Fruit yeast.
4. A food processing microbial preparation comprising Pichia kudricazwiel as described in claim 1 or the microbial composition as described in claim 2 or 3.
5. The application of the Pichia kudricazwielderii yeast of claim 1, the microbial composition of claim 2 or 3, or the food processing microbial preparation of claim 4 in the brewing of fruit wine; preferably, the fruit wine is cherry wine, grape wine, strawberry wine, apple wine, or Wogan mandarin orange wine.
6. A method for brewing fruit wine, comprising the step of fermenting fruit juice using Pichia pastoris as described in claim 1, the microbial composition as described in claim 2 or 3, or the food processing microbial preparation as described in claim 4; preferably, wherein the fruit juice is derived from cherry, grape, strawberry, apple, or tangerine.
7. The method of claim 6, further comprising, prior to the fermentation step, preparing the *Pichia pastoris* of claim 1, the microbial composition of claim 2 or 3, or the food processing microbial preparation of claim 4 to a cell concentration of not less than 10-1. 7 Seed culture of cfu / mL.
8. The method of claim 7, further comprising the following steps: Preparing fruit juice; The seed liquid is inoculated into the juice and fermented at 20°C to 30°C for 10 to 15 days. The original wine is obtained by solid-liquid separation technology. as well as Optionally, the original wine is placed at 15°C to 20°C for 30 to 90 days, filtered and sterilized to obtain fruit wine.
9. A fruit wine, which is brewed by the method according to any one of claims 6 to 8.
10. The fruit wine as described in claim 9, wherein it is cherry wine, grape wine, strawberry wine, apple wine, or citrus wine.