A T7 RNA polymerase mutant that reduces transcription byproducts, its preparation method, and its applications.

Abstract

A T7 RNA polymerase mutant that reduces transcriptional byproducts, its preparation method, and its applications are disclosed, relating to the field of biotechnology. This T7 RNA polymerase mutant has a single mutation site, E242L, compared to the wild-type T7 RNA polymerase. Compared to existing multi-site mutations, this method is not only simpler to operate, but the single-point mutation is also more conducive to the study of functional mechanisms and subsequent precise regulation of function. This T7 RNA polymerase mutant exhibits better thermostability, still yielding a large amount of transcription product at 45℃, and significantly reduces transcriptional byproducts.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a T7 RNA polymerase mutant that reduces byproducts during transcription, its preparation method, and its application. Background Technology

[0002] T7 RNA polymerase (T7 RNAP) is a single-subunit RNA polymerase with a molecular weight of approximately 99 kDa, composed of 883 amino acids, catalyzing RNA synthesis in the 5'→3' direction. This enzyme exhibits high specificity for the T7 promoter, completing the transcription cycle without the need for additional transcription factors. Its elongation rate (approximately 300 nt / s) is more than 5 times faster than that of *E. coli* RNA polymerase, enabling efficient synthesis of long RNA transcripts exceeding 10 kb. Structurally, T7 RNAP contains an N-terminal domain (1-300 aa, involved in promoter recognition) and a C-terminal domain (301-883 aa, containing the catalytic core). Structural studies have shown that the N-terminal domain undergoes conformational rearrangement during transcription initiation and elongation, a process closely related to enzyme stability and byproduct formation.

[0003] Although T7 RNAP is widely used in in vitro transcription (IVT), it suffers from two major technical bottlenecks: insufficient thermostability and high byproduct generation rate. Wild-type T7 RNAP undergoes irreversible denaturation at 48.3°C (confirmed by calorimetry, circular dichroism spectroscopy, and fluorescence spectroscopy). After incubation at 40-42°C or higher for 30 minutes, the enzyme activity is lost by more than 80%. This severely limits its application in high-temperature amplification techniques (such as NASBA, TMA, and isothermal amplification). Furthermore, wild-type T7 RNAP generates various byproducts during transcription, mainly including:

[0004] 1. Abortive RNA: Short oligonucleotides of 2-10 nt synthesized during the initiation stage (accounting for 30-40% of nucleotide consumption), resulting from promoter clearance failure;

[0005] 2. Double-stranded RNA (dsRNA): Formed by two mechanisms:

[0006] RNA-dependent RNA polymerase (RdRP) activity: synthesizing complementary strands (such as 3' extension products) using RNA as a template.

[0007] Terminal transferase activity: Adding non-template nucleotides (especially cytosine) to the 3' end of RNA promotes reverse complementary pairing.

[0008] 3. Shortened RNA: Incomplete transcripts caused by internal termination signals.

[0009] These byproducts (especially dsRNA) can activate the host's innate immune response (through pathways such as PKR, TLR3, and RIG-I), inhibit translation efficiency, and induce inflammatory responses. Experiments have shown that after transfection of cells with mRNA synthesized by wild-type enzymes, the expression level of interferon-β (IFN-β) is as high as 1200 pg / mL, while the protein expression efficiency is reduced by 60-70%.

[0010] There are two main methods to reduce the generation of byproducts. The first method is post-purification processing: chromatography (such as dsRNA affinity chromatography) can remove 70-80% of dsRNA, but this method leads to a decrease in RNA recovery rate (about 50%) and cannot eliminate aborted RNA, which greatly increases production costs.

[0011] Another approach is enzyme mutation modification. Existing technologies contain numerous studies on T7 RNA polymerase, such as the mutants T7-E1 and T7-E2 disclosed in CN202510056666.7. However, these two mutants address only one of the problems: thermostability or byproducts. Current technologies lack T7 RNAP mutants that simultaneously solve both thermostability and byproduct issues. Furthermore, existing mutants employ multi-site gene mutations, making it difficult to precisely elucidate the mechanisms of action at each site, and the experimental procedures are more complex.

[0012] Therefore, it is urgent to develop new mutants to overcome the above-mentioned bottlenecks. Summary of the Invention

[0013] The purpose of this invention is to provide a T7 RNA polymerase mutant that reduces transcription byproducts, its preparation method, and its application. This T7 RNA polymerase mutant not only has better thermal stability but also significantly reduces transcription byproducts.

[0014] The embodiments of the present invention are implemented as follows:

[0015] A T7 RNA polymerase mutant that reduces byproducts during transcription, wherein the mutation site of the T7 RNA polymerase mutant compared to the wild-type T7 RNA polymerase is E242L; the amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO.1.

[0016] Furthermore, in other preferred embodiments of the present invention, the amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO.2.

[0017] Biological materials related to the above-mentioned T7 RNA polymerase mutants, wherein the biological materials are any one of A1) to A3):

[0018] A1) Nucleic acid molecules capable of encoding the aforementioned T7 RNA polymerase mutant;

[0019] A2) Recombinant expression vectors containing A1) nucleic acid molecules;

[0020] A3) Recombinant cells containing A1) nucleic acid molecules or A2) recombinant expression vectors.

[0021] Furthermore, in other preferred embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3, and encodes a DNA molecule of a T7 RNA polymerase mutant.

[0022] A method for preparing the above-mentioned T7 RNA polymerase mutant, comprising:

[0023] The coding gene of the T7 RNA polymerase mutant was introduced into biological cells, and the coding gene was expressed to obtain the T7 RNA polymerase mutant.

[0024] Furthermore, in other preferred embodiments of the present invention, the method of introducing the coding gene of the T7 RNA polymerase mutant into biological cells includes:

[0025] The nucleic acid molecule encoding wild-type T7 RNA polymerase was mutated using PCR point mutagenesis to obtain a nucleic acid molecule encoding a T7 RNA polymerase mutant.

[0026] The nucleic acid molecule encoding the T7 RNA polymerase mutant was ligated into a vector to obtain a recombinant expression vector;

[0027] The recombinant expression vector was transformed into competent cells and cultured. Positive clones of the recombinant expression vector were screened and then transformed into biological cells.

[0028] The sequence of the nucleic acid molecule encoding wild-type T7 RNA polymerase is shown in SEQ ID NO.4.

[0029] Furthermore, in other preferred embodiments of the present invention, the method includes:

[0030] By designing primers to amplify the nucleic acid molecule encoding the wild-type T7 RNA polymerase through site-directed mutagenesis, a nucleic acid molecule encoding the T7 RNA polymerase mutant was obtained; the nucleotide sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0031] Furthermore, in other preferred embodiments of the present invention, the vector is pET-28a and the competent cells are BL21 DE3star.

[0032] The above-mentioned T7 RNA polymerase mutant is used in the preparation of mRNA vaccines or RNA drug-related products.

[0033] The method for detecting the 3' end byproducts of the above-mentioned T7 RNA polymerase mutant includes:

[0034] Transcription of double-stranded DNA fragments, such as those shown in SEQ ID NO.7 and SEQ ID NO.8, was performed using a T7 RNA polymerase mutant, and the transcription products were detected using Native PAGE.

[0035] The method for detecting the dsRNA byproducts of the above-mentioned T7 RNA polymerase mutant includes:

[0036] The sequence shown in SEQ ID NO.9 was inserted into the pUC18 plasmid, primers were designed to amplify it, and the amplified DNA fragment was transcribed using a T7 RNA polymerase mutant. The transcription product was detected using Dotblot.

[0037] The beneficial effects of the embodiments of the present invention are:

[0038] This invention provides a T7 RNA polymerase mutant that reduces transcriptional byproducts, its preparation method, and its applications. Compared to wild-type T7 RNA polymerase, this mutant has a single mutation site, E242L. Compared to existing multi-site mutations, this method is not only simpler to operate, but the single-point mutation is also more conducive to studying the functional mechanism and further precise regulation of function. This T7 RNA polymerase mutant exhibits better thermostability, still yielding a large amount of transcription product at 45°C. Furthermore, it significantly reduces transcriptional byproducts. Attached Figure Description

[0039] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 This is a diagram showing the expression and purification results of the T7 RNA polymerase mutant provided in Example 2 of the present invention;

[0041] Figure 2 This is a diagram showing the expression and purification results of the wild-type T7 RNA polymerase provided in Example 2 of the present invention;

[0042] Figure 3The results of the detection of 3' end byproducts of T7 RNA polymerase wild-type provided in Example 3 of this invention;

[0043] Figure 4 The results of the detection of the 3' end byproducts of the T7 RNA polymerase mutant provided in Example 3 of this invention;

[0044] Figure 5 The results of Dotblot detection of T7 RNA polymerase and its mutant transcriptional byproducts (dsRNA) provided in Example 4 of this invention. Detailed Implementation

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0046] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0047] Example 1

[0048] This embodiment provides a T7 RNA polymerase mutant that reduces byproducts during transcription. The mutation site of the T7 RNA polymerase mutant compared to the wild-type T7 RNA polymerase is E242L.

[0049] The amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO.1, specifically:

[0050] MNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA。

[0051] The amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO.2, specifically:

[0052] MNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSLTIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA。

[0053] The nucleotide sequence encoding the above wild-type T7 RNA polymerase is shown in SEQ ID NO.4, specifically:

[0054]

[0055] The nucleotide sequence encoding the above-mentioned T7 RNA polymerase mutant is shown in SEQ ID NO.3, specifically:

[0056]

[0057] Example 2

[0058] This embodiment provides a method for preparing a T7 RNA polymerase mutant that reduces byproducts during transcription, including the following steps:

[0059] S1. Construction of recombinant expression vector:

[0060] By designing primers, site-directed mutagenesis amplification was performed on the nucleic acid molecule encoding wild-type T7 RNA polymerase as shown in SEQ ID NO.4, to obtain the nucleic acid molecule encoding the T7 RNA polymerase mutant as shown in SEQ ID NO.3.

[0061] The nucleotide sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.6, specifically:

[0062] SEQ ID NO.5

[0063] F:ctgactatcgaactcgcacctgaa;

[0064] SEQ ID NO.6

[0065] R: agagtcttgacctactacgccagc. The nucleic acid molecule encoding the T7 RNA polymerase mutant described above is ligated into the vector (pET-28a) to obtain the recombinant expression vector.

[0066] Culture and expression of S2. T7 RNA polymerase mutant:

[0067] The recombinant expression vector was transformed into competent cells (BL21 DE3 Star). Single colonies were picked and inoculated into 100 mL LB medium containing 50 μg / mL ampicillin. The colonies were then incubated overnight at 37°C with shaking. The overnight seed culture was inoculated into 2 L LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100 and incubated at 37°C with shaking until the OD600 reached 0.6-0.8. 10% IPTG was added to a final concentration of 0.4 mmol / L, and the cells were induced at 37°C with shaking for 6-8 h. The cells were collected by centrifugation and weighed. The wet weight of the cells was recorded and stored at -80°C.

[0068] Purification of the S3. T7 RNA polymerase mutant:

[0069] S3-1. High-pressure disruption of induced expression cells:

[0070] Bacterial cells frozen at -80℃ after induction of expression were collected. Based on the wet weight of the cells recorded in step S2, 5 mL of lysis buffer (50 mM Tris-HCl, pH 7.8 at 25℃, 300 mM NaCl, 50 mM Imidazole, 5% Glycerol) was added per gram of bacterial cells to resuspend the cells. The cells were then lysed using a high-pressure homogenizer at 650 bar for three cycles. The lysed cells were centrifuged at 12000 rpm for 30 min at 4℃, and the supernatant was collected into a 200 mL sterile beaker. The supernatant and precipitate were subjected to SDS-PAGE electrophoresis. The results are shown below. Figure 1 (The supernatant is lane 1, and the precipitate is lane 2) as shown.

[0071] S3-2. Nickel ion affinity chromatography purification:

[0072] Load the dissolved protein solution from step S3-1 into a chromatography column equilibrated with buffer A. After loading, rinse the column with equilibration buffer A, then perform a gradient elution with buffer B from 0% to 100%. Analyze the eluted fraction using SDS-PAGE protein electrophoresis and collect the eluent based on the results. Figure 1 (Middle lane 3), and dialyze the eluent to buffer A, collecting the dialysate for later use. Figure 1 Middle lane 4).

[0073] The chromatography column used was a Ni-NTA Purose 6 Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.). The binding buffer was buffer A: 50mM Tris-HCl, pH 7.8 at 25℃, 100mM NaCl, 80mM Imidazole, 5% Glycerol; the elution buffer was buffer B: 50mM Tris-HCl, pH 7.8 at 25℃, 100mM NaCl, 500mM Imidazole, 5% Glycerol.

[0074] S3-3. Secondary nickel ion affinity chromatography purification:

[0075] Repeat step S3-2 to perform SDS-PAGE protein electrophoresis on the eluted fraction, and collect the eluent based on the results. Figure 1 (Middle lane 5), and dialyze the eluent to buffer A, collecting the dialysate for later use. Figure 1 Lane 6 (middle lane). The eluent was dialyzed into buffer C (50 mM Tris-HCl pH 7.8 at 25 ℃, 50 mM NaCl, 1 mM DTT, 0.1 mM EDTA), and the dialysate was collected for later use.

[0076] S3-4. Strong anion exchange chromatography purification:

[0077] Add the dialysis buffer obtained in step S3-3 to the chromatography column that has been equilibrated with buffer C. After addition, wash the column with buffer C first, then perform a gradient elution with buffer D from 0% to 100%. Perform SDS-PAGE protein electrophoresis on the eluted fractions and collect the eluent based on the results. Figure 1 The medium lane (lane 7) was dialyzed to a storage solution: 20 mM KPB (pH 7.9), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, and 50% glycerol for later use. Figure 1 Middle lane 8).

[0078] The chromatography column used was Q Purose 6 Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.), the binding buffer was buffer C, and the elution buffer was buffer D: 50mM Tris-HCl pH7.8 at 25℃, 800mM NaCl, 1mM MTT, 0.1mM EDTA.

[0079] Following the same method, nucleic acid molecules encoding wild-type T7 RNA polymerase, as shown in SEQ ID NO.4, were cultured, expressed, and purified. The SDS-PAGE protein electrophoresis results are as follows: Figure 2 As shown, with Figure 1 All lanes are identical. Lane M is for protein markers; lane 1 is the supernatant obtained after centrifugation following cell lysis; lane 2 is the precipitate obtained after centrifugation following cell lysis; lanes 3 and 4 are the elution buffer for nickel ion affinity chromatography; lanes 5 and 6 are the elution buffer for strong anion exchange chromatography; lane 7 is the elution buffer for strong anion exchange chromatography; and lane 8 is the final collected T7 RNA polymerase protein solution. Figure 1 and Figure 2 As can be seen, the culture, expression and purification process is applicable to both wild-type and mutant T7 RNA polymerase, and can yield high-purity T7 RNA polymerase and mutants.

[0080] Example 3

[0081] This embodiment provides a method for detecting 3' transcriptional byproducts of T7 RNA polymerase wild-type and mutant strains, including the following steps:

[0082] S1. Design a DNA double strand approximately 30 bp long with a T7 promoter, the single-stranded sequence of which is shown in SEQ ID NO.7 and SEQ ID NO.8, specifically:

[0083] SEQ ID NO.7

[0084] 5'-TTCTAATACGACTCACTATAGGGAAACATCTTGTTGAGAGCAGTATACAACTC-3'.

[0085] SEQ ID NO.8

[0086] 5'-GAGTTGTATACTGCTCTCAACAAGATGTTTCCCTATAGTGAGTCGTATTAGAA-3'

[0087] S2. Anneal the two synthesized single strands to prepare a DNA template.

[0088] S3. Prepare the T7 RNA polymerase in vitro transcription system according to Table 1, and transcribe at 37℃, 42℃ and 45℃ for 3 hours after preparation.

[0089] Table 1. Composition of the in vitro transcription system

[0090] reagents 1x (μl) 10 x T7 Transcription buffer 2 NTP Solution 8 RNase inhibitor (40 U / ul) 0.5 T7 RNA Polymerase 2 Transcription template (250 ng / ul) 2 <![CDATA[RNase free H2O]]> 5.5 Total 20

[0091] S4. The transcribed product was digested with DNase I to remove the DNA template, and the product was subjected to Native Page assay using 15% urea.

[0092] Simultaneously, a wild-type T7 RNA polymerase was used as a control, following the same procedure. The detection results are as follows: Figure 3 (wild type) and Figure 4 As shown in the (mutant) diagram. (By) Figure 3 It can be seen that the transcription yield and dsRNA byproduct content of wild-type T7 RNA polymerase remain basically unchanged with increasing temperature, while... Figure 4 In this invention, the T7 RNA polymerase mutant exhibits a significant decrease in dsRNA byproduct content and a significant increase in target ssRNA content with increasing temperature. This is a significant characteristic that distinguishes the T7 RNA polymerase mutant provided by this invention from other existing mutants, which typically show a decrease in transcription yield with increasing temperature. However, the T7 RNA polymerase mutant of this invention demonstrates higher yield and purity at higher temperatures, suggesting its superior performance in high-temperature applications.

[0093] Example 4

[0094] This embodiment provides a method for detecting T7 RNA polymerase and mutant dsRNA byproducts, including the following steps:

[0095] S1. Insert the sequence shown in SEQ ID NO.9 into the pUC18 plasmid, specifically,

[0096] SEQ ID NO.9

[0097] 5'--3'.

[0098] Primers were designed to amplify the sample, and a template for detection was obtained.

[0099] S2. Dilute the wild-type T7 RNA polymerase and the T7 RNA polymerase mutant to 55 ng / ul and prepare the reaction solution according to Table 2.

[0100] Table 2. Composition of the reaction solution

[0101] reagents 1x (μl) 10 x T7 Transcription buffer 2 NTP Solution 8 RNase inhibitor (40 U / ul) 0.5 T7 RNA Polymerase 2 Transcription template (250 ng / ul) 2 RNase-free H2O 5.5 Total 20

[0102] The prepared reaction solution was placed in a PCR instrument and reacted at 37℃ and 42℃ for 2 hours, respectively. After the reaction was completed, DNase I was added to digest the DNA template before proceeding with subsequent operations.

[0103] S3. The digested transcription products were then recovered using an RNA recovery kit, and the yield of the recovered products was recorded. The recovered RNA was uniformly diluted to 833 ng / ul for subsequent detection. Nylon membranes of appropriate sizes were cut according to the experimental groups. No activation was required before use. The membranes were immersed in RNase-free H2O until completely wetted, then removed for use. 3ul of the prepared RNA sample was spotted onto the nylon membrane (keeping the membrane slightly wet during spotting). After spotting, the membrane was irradiated with UV light for 3 min to crosslink, and then dried at room temperature for 20 min. The sample-coated nylon membrane was then placed in PBST-5% skim milk powder and incubated overnight at 4°C. After incubation, the membrane was washed three times in PBST solution for 3 min each time. The washed nylon membrane was then immersed in Double-stranded RNA (dsRNA) Antibody (J2) (0.4 μg / ul) and incubated at room temperature for 2 h. After incubation, the membrane was washed three times with PBST solution for 3 minutes each time. Then, the nylon membrane was transferred to reporter antibody IgG-HRP (Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP) (0.4 μg / ml) and incubated at room temperature for 2 hours. After incubation, the membrane was washed three times with PBST solution for 3 minutes each time. After washing, the nylon membrane was immersed in BeyoECL Star and reacted at room temperature for 3-5 minutes. The membrane was then placed in a multi-functional imager for automatic exposure. The imaging results are as follows: Figure 5 As shown.

[0104] from Figure 5 As can be seen, regardless of whether transcription is performed at 37℃ or 42℃, the grayscale of the byproducts obtained by the T7 RNA polymerase mutant provided by this invention (corresponding mutant in the figure) is significantly lower than that of the wild-type T7 RNA polymerase (corresponding wild-type in the figure). Furthermore, quantitative analysis was performed using the transcription results at 37℃ as an example, and the results are shown in Table 3.

[0105] Table 3. Quantitative results of Dot blot detection

[0106] Transcription at 37℃ Integral area Gray integral value Grayscale integration (-backgrand) Percentage of wild type wild type 8816 880488 867239.7 mutant 8816 175756 162507.7 18.7 Background value 8816 13248.33

[0107] As can be seen, the gray value of the byproduct obtained by the T7 RNA polymerase mutant is only 18.7% of that of the wild-type T7 RNA polymerase, and the T7 RNA polymerase mutant has a very significant effect on reducing dsRNA.

[0108] Example 5

[0109] This embodiment provides a method for detecting the yield of T7 RNA polymerase and mutant transcribed RNA, including the following steps:

[0110] S1. Using the T7 RNA polymerase mutant, transcription was performed at 37°C for 2 hours, following the method described in Example 3 or Example 4.

[0111] S2. After transcription, the RNA was inactivated at 70℃ for 10 min, and the transcription product was quantified using a Qubit RNA quantification kit. The results are shown in Table 4.

[0112] Table 4. Qubit RNA Quantitative Detection Results

[0113]

[0114] As shown in Table 4, the RNA yield of the T7 RNA polymerase mutant provided by this invention is 16.51 ng, which is 61.6% of the yield of the wild-type T7 RNA polymerase. Although the yield of the T7 RNA polymerase mutant is lower than that of the wild-type T7 RNA polymerase, the overall yield is still better than that of the existing method of purification by chromatography (with a loss of about 50%), and it is also more cost-effective than chromatography.

[0115] In summary, this invention provides a T7 RNA polymerase mutant that reduces transcriptional byproducts, its preparation method, and its applications. Compared to wild-type T7 RNA polymerase, this mutant has a single mutation site, E242L. Compared to existing multi-site mutations, this method is not only simpler to operate, but the single-point mutation is also more conducive to studying the functional mechanism and further precise regulation of function. This T7 RNA polymerase mutant exhibits better thermostability, still yielding a large amount of transcription product at 45℃, and can significantly reduce transcriptional byproducts.

[0116] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A T7 RNA polymerase mutant that reduces byproducts during transcription, characterized in that, The mutation site of the T7 RNA polymerase mutant compared to the wild-type T7 RNA polymerase is E242L; the amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO.

1.

2. The T7 RNA polymerase mutant according to claim 1, characterized in that, The amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO.

2.

3. Biomaterials related to the T7 RNA polymerase mutant according to any one of claims 1-2, characterized in that, The biomaterial is any one of A1) to A3): A1) A nucleic acid molecule capable of encoding the T7 RNA polymerase mutant according to any one of claims 1 to 2; A2) A recombinant expression vector containing the nucleic acid molecules described in A1); A3) Recombinant cells containing the nucleic acid molecule described in A1) or the recombinant expression vector described in A2).

4. The biomaterial according to claim 3, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

3.

5. A method for preparing the T7 RNA polymerase mutant according to any one of claims 1 to 2, characterized in that, include: The coding gene of the T7 RNA polymerase mutant was introduced into a biological cell to express the coding gene, thus obtaining the T7 RNA polymerase mutant.

6. The preparation method according to claim 5, characterized in that, Methods for introducing the coding gene of the T7 RNA polymerase mutant into biological cells include: The nucleic acid molecule encoding wild-type T7 RNA polymerase was mutated using PCR point mutagenesis to obtain the nucleic acid molecule encoding the T7 RNA polymerase mutant. The nucleic acid molecule encoding the T7 RNA polymerase mutant was ligated into a vector to obtain a recombinant expression vector; The recombinant expression vector was transformed into competent cells and cultured. Positive clones of the recombinant expression vector were screened and then transformed into biological cells. The sequence of the nucleic acid molecule encoding wild-type T7 RNA polymerase is shown in SEQ ID NO.

4.

7. The preparation method according to claim 6, characterized in that, include: By designing primers, site-directed mutagenesis was performed on the nucleic acid molecule encoding the wild-type T7 RNA polymerase to obtain the nucleic acid molecule encoding the T7 RNA polymerase mutant. The nucleotide sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.

6.

8. The preparation method according to claim 7, characterized in that, The vector is pET-28a, and the competent cells are BL21 (DE3) star.

9. The use of the T7 RNA polymerase mutant according to claim 1 or 2 in the preparation of mRNA vaccines.

10. The use of the T7 RNA polymerase mutant according to claim 1 or 2 in the preparation of RNA drugs.

Images