Rahnella aquatica OmpW protein expression and preparation method and application of polyclonal antibody
By expressing the OmpW gene of *Laenia aquaticis* in a prokaryotic system and preparing polyclonal antibodies, the problem of lack of preventive measures for *Laenia aquaticis* infection was solved, enabling effective molecular diagnostics and vaccine development, and improving the prevention and control capabilities of the aquaculture industry.
Patent Information
- Application Number
- CN202510742155.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-12-19
AI Technical Summary
The lack of existing technologies for preventing diseases caused by Aquatic Raenella and the limited molecular identification and diagnostic techniques for this bacterium have resulted in huge economic losses for the aquaculture industry.
By designing specific primers using bioinformatics methods, the OmpW gene of *Laenia aquatica* was successfully expressed in a prokaryotic system. Polyclonal antibodies were prepared, and these antibodies were used for immunohistochemical analysis and molecular diagnostics to produce high-purity recombinant proteins for vaccine development.
This has enabled effective molecular diagnostics and vaccine development for aquatic Laenella, providing preventative measures for aquaculture and improving the ability to control Laenella infection.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological genetic engineering, and particularly relates to a method for cloning and prokaryotic expression of Rahnella Aquatilis OmpW gene and preparation and application of polyclonal antibody. BACKGROUND
[0002] Rahnella Aquatilis is a newly emerging fish pathogenic bacterium that can cause septicemia in humans and various aquatic animals. Carassius auratus is an important economic fish in China, and its resistance decreases with the rapid development of intensive aquaculture, which can lead to frequent outbreaks of bacterial septicemia. Rahnella Aquatilis can invade the host through the body surface wound or the intestinal tract, causing septicemia and intestinal inflammation. The important host of Rahnella Aquatilis is one of the important hosts, and the death rate after infection is high. Among them, Rahnella Aquatilis infection in Carassius auratus can cause skin and internal organs bleeding, ascites, enteritis and septicemia, etc. Clinical symptoms bring huge economic losses to the aquaculture industry. At present, the molecular identification and diagnosis technology of Rahnella Aquatilis is still very limited, and the pathogenicity and immune mechanism of fish infected by the bacteria are rarely reported. Recently, our research group found that the growth curve of Carassius auratus-derived Rahnella Aquatilis KCL-5 pathogenic strain is affected by different pH values. The cell envelope of gram-negative bacteria is composed of two membranes [inner membrane (IM) and outer membrane (OM)], which are separated by a hydrophilic space (periplasm) containing a thin layer of peptidoglycan (cell wall). With the increasing frequency of drug-resistant infections of gram-negative bacteria, people are increasingly interested in the evolutionarily conserved outer membrane protein (Omp) biosynthetic pathway, which contains excellent targets for the development of new antibiotics. Unlike most IM proteins containing one or more hydrophobic transmembrane alpha-helices, most Omps contain amphipathic beta-sheets that fold into cylindrical beta-barrel structures as transmembrane segments. The size of the beta-barrel ranges from 8 to 36 beta-strands and is closed by multiple hydrogen bonds between the first and last strands, resulting in a highly stable domain structure.
[0003] In some cases, toxic substances (such as antibiotics) cannot pass through the OM, which poses a considerable obstacle to traditional or new antibacterial agents to eradicate gram-negative bacterial infections. Porins are a subclass of Omps that form transmembrane pores, creating tiny channels in the membrane and allowing the passive transport of hydrophilic compounds, which helps to regulate cell permeability and increase antibiotic resistance. In gram-negative bacteria, porins are the most common Omps in the OM, which can be divided into two groups according to their functions: non-specific porins and specific porins. Porins seem to play a role in the integrity of the envelope of gram-negative bacteria, in addition to their role in the passive transport of a range of chemicals.
[0004] OmpW (a member of the small Omp family) forms an eight-stranded beta-barrel with a hydrophobic channel. OmpW plays a role in the transport of small hydrophobic chemicals, which helps to explain why some antibacterial agents are less efficient at inhibiting bacterial growth. In E. coli strains resistant to nalidixic acid, OmpW was found to be upregulated. However, mass spectrometry and Western blotting results showed that OmpW was downregulated in kanamycin-resistant E. coli, and again consistent with the fact that the pore protein limits beta-lactams from entering the cell. Knockout of the OmpW gene also demonstrated that OmpW showed antimicrobial resistance in many bacteria. OmpW appears to be a receptor or component of receptors for colistin S4, chlortetracycline, neomycin, and ampicillin, and E. coli mutants lacking OmpW are resistant to these drugs, in terms of sensitivity to methyl viologen, 2.5 times that of the wild type. The absence of OmpW affects the sensitivity of bacteria to penicillin, kanamycin, and polymyxin B.
[0005] Raenella aquatilis is a gram-negative facultative anaerobic bacteria belonging to Enterobacteriaceae and Raenella. It is widely distributed in freshwater and soil and can cause diseases in fish, mammals and humans. There is no preventive measure for diseases caused by Raenella aquatilis, and there is an urgent need for a vaccine that can prevent Raenella aquatilis infection, so we prokaryotic express the virulence gene OmpW of Raenella aquatilis and prepare polyclonal serum, which provides a reference for the development and application of Raenella aquatilis subunit vaccine and molecular diagnostic technology in the future. SUMMARY
[0006] The purpose of the present application is to solve the technical problems of the prior art, and to provide a method for cloning and prokaryotic expression of OmpW gene of Raenella aquatilis and preparation of polyclonal antibody (polyserum) and its application. The present application uses bioinformatics method to identify the molecular characteristics of OmpW protein of Raenella aquatilis, further designs specific EcoR I and Hind III double enzyme digestion primer sequence OmpW-F / OmpW-R, successfully expresses OmpW gene of Raenella aquatilis in prokaryotic system, and obtains high-purity pET32a-OmpW recombinant protein. Rabbit polyclonal antibody is obtained by injecting New Zealand white rabbits subcutaneously at multiple points on the back. After 4 times of rabbit immunization for 52 days, the rabbit heart blood is taken, the antiserum is separated, and the rabbit polyclonal antibody is obtained. In-vivo and in-vitro immunoblotting detection, immunohistochemical analysis, two-way agar diffusion and OmpW molecular diagnostic technology application are carried out.
[0007] To achieve the above technical problems, the technical method of the present application is: a method for cloning and prokaryotic expression of OMP gene of Raenella aquatilis and preparation of polyclonal serum, which is: S1, bacterial strain and culture conditions: The Rahnella aquatilis strain KCL-5 used in the present study is isolated and identified by the research group in the diseased crucian and is preserved. The strain is frozen in 20% glycerol before use (-80℃), and when recovered, the Rahnella aquatilis KCL-5 bacterial liquid is expanded in Luria-Bertani liquid medium (LB) at a ratio of 1%, and then the single colony of the strain is inoculated into LB liquid medium and cultured at 25℃ for 12h as the inoculum for high temperature stress test.
[0008] The LB liquid medium with pH 7 is configured, inoculated at 2%, and cultured at 25℃ (control) and 35℃ 200rpm to the logarithmic growth phase, centrifuged at 4℃ 10000xg for 10min, washed with PBS, collected samples, and finally sent to the company for sequencing.
[0009] S2, Rahnella aquatilis OMPW gene cloning: the DNA of Rahnella aquatilis is extracted by boiling method, and the 633bp target gene is amplified by PCR amplification using the DNA as a template. The OmpW gene sequence fragment is amplified by using specific primers containing Hind III and EcoR I enzyme cutting sites. The recombinant plasmid pET32a-OmpW is constructed, and the recombinant plasmid is transformed into E. coli DH5α competent cells. The positive clones are selected and sent to the sequencing company for sequencing. After the preferred positive clones are successfully sequenced, the plasmid is extracted by the plasmid DNA extraction kit after overnight culture, and the positive clones are re-transformed into BL21(DE3) chemical competent cells and sent to the sequencing company for sequencing.
[0010] The cells in the BL21(DE3) cell liquid are destroyed by using an ultrasonic disrupter, and the expression of the OmpW recombinant protein is detected by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and coomassie brilliant blue staining, and the expression form of the OmpW recombinant protein is identified.
[0011] The His-Tag labeled OmpW recombinant protein is further purified by using His-tag protein purification method.
[0012] S3, preparation method of OMP protein polyclonal serum: in order to achieve the above purpose, the present application provides a preparation method of crucian Rahnella aquatilis OMP protein polyclonal serum, which can be obtained by immunizing animals with recombinant OmpW protein.
[0013] The rabbit anti-Carassius auratus Ralstonia aquatilis OMP protein polyclonal antibody is obtained when New Zealand rabbits are immunized, and the serum titer can reach 1:16. The antibody specificity of OmpW is detected by Western blotting. The application provides the Carassius auratus Ralstonia aquatilis OMP protein polyclonal antibody, and the immunohistochemical experiment result shows that the prepared OmpW antibody can be used for application of targeting the expression level of Ralstonia aquatilis in different tissues in a fish body.
[0014] Compared with the prior art, the application has the following advantages: the Carassius auratus Ralstonia aquatilis OMP gene is successfully expressed in a prokaryotic system, the OmpW protein is obtained by prokaryotic expression, the recombinant protein with high purity is obtained, the rabbit source polyclonal antibody is obtained by immunizing New Zealand rabbits, and the polyclonal antibody of the OmpW protein is successfully prepared. Through further experiments, the OmpW polyclonal antibody can detect and locate the expression of the Carassius auratus Ralstonia aquatilis OmpA protein in the fish body by immunoblotting and immunohistochemical methods, thereby providing a reference basis for research and development and application of a Ralstonia aquatilis subunit vaccine and a molecular diagnosis technology. BRIEF DESCRIPTION OF DRAWINGS
[0015] In order to more clearly illustrate the technical solutions in the embodiments of the application, the following will briefly introduce the drawings needed to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.
[0016] Figure 1 OmpW gene sequence Figure 2 OmpW structure domain Figure 3 OmpW tertiary structure diagram Figure 4 Amplification of the target gene Figure 5 Construction of the vector: (A) DH5a bacterial liquid PCR identification (B) BL21 bacterial liquid PCR verification (C) double enzyme digestion verification Figure 6 Expression of OmpW recombinant protein. (A) Expression of OmpW recombinant protein at different temperatures; M: protein molecular weight marker (15-120 kDa); (B) Expression results induced by different IPTG concentrations, M: protein molecular weight marker (15-120 kDa); (C) Expression of OmpW recombinant protein at different times Figure 7 Expression form of OmpW recombinant protein and protein after purification. (A) Expression of supernatant and precipitate after ultrasonic crushing; (B) Purified and concentrated protein Figure 8 Titration of the antibody by the double agar diffusion method Figure 9 . Western blotting detection of anti OmpW Specificity of polyclonal antiserum. M: protein molecular weight marker (15-120 kDa).
[0017] Figure 10 . Detection of the presence of A. hydrophila protein in the gill, liver and kidney of crucian carp by immunohistochemistry (×200). A: Incubate the liver tissue section of the diseased crucian carp with anti OmpW protein polyclonal serum, TMB staining, brownish yellow signal is OmpW the expression position of the protein; B: kidney; C: gill. OmpW
[0018] Figure 11 Growth curve of A. hydrophila under different temperature conditions.
[0019] Figure 12 OmpW temperature stress change chart of A. hydrophila Figure 13 Changes in the expression of A. hydrophila OmpW protein DETAILED DESCRIPTION
[0020] In order to make the technology of the present application clearer, the following examples will provide further illustration of the present application.
[0021] The test was carried out in the Tianjin Key Laboratory of Aquatic State and Cultivation of Tianjin Agricultural College, the strain was isolated and extracted from the intestinal tract of crucian carp randomly purchased from Tianjin market, the test rabbits were purchased from Wuqing District Keda Breeding Center in Tianjin, and other test materials were from commercial channels.
[0022] Example 1. Method for cloning and prokaryotic expression of A. hydrophila OMP gene of crucian carp and preparation of polyclonal serum, the specific operation steps are as follows: Test strain: A. hydrophila isolated and preserved by Tianjin Key Laboratory of Agricultural College.
[0023] Reagents: DNA Marker DL2000 (Bao Bioengineering (Dalian) Co., Ltd.), PCR Master Mix (Kangwei Century Co., Ltd.), Hind III and EcoR1 (both purchased from Takara), T4 DNA ligase (NEB), pET32a(+) plasmid, DH5α competent cells and BL21 competent cells (all purchased from Beijing Solaybao Biotechnology Co., Ltd.).
[0024] Example 2. Bacterial strain and culture conditions The Rahnella aquatilis KCL-5 strain used in this study was isolated and identified by the research group from the diseased crucian carp and stored. The strain was stored in 20% glycerol before use (-80℃), and was resuscitated twice in Luria-Bertani medium (LB). Then a single colony of the strain was inoculated into LB liquid medium and cultured at 25℃ for 12h as the inoculum for high temperature stress test.
[0025] S1. High temperature stress culture The LB liquid medium was configured at pH 7, inoculated at 2%, and cultured at 25℃ (control) and 35℃ 200rpm to the logarithmic growth phase, centrifuged at 10000xg for 10min at 4℃, washed with PBS, collected the sample, and finally sent to Shanghai Meiji Biomedicine Technology Co., Ltd. for prokaryotic transcriptome sequencing.
[0026] S2. Growth curve of Rahnella aquatilis KCL-5 under different temperature conditions The test strain was inoculated into LB medium, 600μL seed liquid was inoculated into 30mL sterile LB liquid medium in a 50mL centrifuge tube, and cultured at 16, 20, 25, 28, 30, 33℃, 35℃ and 37℃, 180r / min shaking, every 2h, each time point was detected 3 times and the average value was taken, 200μL culture was taken and the OD600 value was measured by enzyme marker. As shown in Figure 12 , low temperature can inhibit the growth of Rahnella aquatilis, and 25℃ is the optimum growth temperature. Example 3. The method for cloning and expressing OMP gene of Rahnella aquatilis in crucian carp according to example 1 and the preparation method of polyclonal serum, which is: S1、 OmpW Bioinformatics prediction of genes According to the whole nucleotide sequence of Rahnella aquatilis sequencing by the research group before, the transmembrane region (TMHMM2.0) and domain (SMART http: / / smart.embl-heidelberg.de / ) and tertiary structure (SWISS-MODEL) of Rahnella aquatilis OmpW protein were predicted by bioinformatics method. It is predicted that OmpW protein contains one domain PfamOmpW, and the tertiary structure shows that OmpW protein is a transmembrane protein. After the prediction is completed Figure 2 , the interval of the target protein is determined, and the corresponding primers are designed by Primer 5.0 (Table 1). OmpA
[0027] Table 1. OmpW primers Primer name Sequence (5'>3') Product size (bp) annealing temperature (°C) -F CCGGAATTCATGAAAGCAGCATATTGGGCAT -R CCAAGCTTTCAGAAACGATAGCCGGCG 650 65 S2、 OmpA Results of amplification of protein gene and construction of cloning vector and expression vector Step one, DNA extraction method of strain: water boiling method was used to extract DNA of Aquimarina sp. KCL-5. A single colony of Aquimarina sp. KCL-5 was inoculated in 1 ml LB and cultured at 30°C overnight; centrifuged at 12000 rpm for 1 min, and the supernatant was discarded; resuspended with DEPC water, 95°C water bath for 5 min, 12000 rpm centrifugation for 2 min, and the supernatant was the DNA template.
[0028] Step two, amplification of target gene: the DNA extracted in step one was used as the template for PCR amplification of the target gene, the reaction system was as shown in Table 2, and the reaction program was as shown in Table 3.
[0029] Table 2 Reaction system Table 3 Reaction program Step three, cloning, transformation and identification: the PCR product obtained in the above step was detected by 1.0% agarose gel electrophoresis and the gel was recovered. The recovered product and pET32a (+) were double-digested by restriction endonuclease EocR I and Hind III. The double-digested product of OmpW gene was combined with the double-digested extract of pET32a (+) to construct the recombinant plasmid pET32a-OmpW. The recombinant plasmid was introduced into E. coli DH5α competent cells by heat shock method, and then the transformed cells were inoculated in LB liquid medium and incubated at 37°C for 1.5 hours to activate the ampicillin resistance gene (Amp+) carried by the plasmid. The recovered bacterial solution was uniformly coated on the surface of LB solid medium containing Amp+, and incubated at 37°C for 12-16 hours. After single colonies were formed, positive clones were screened by colony PCR, and after electrophoresis identification, positive colonies were selected for expansion culture and extraction of recombinant plasmid.
[0030] Then, the extracted plasmid was introduced into BL21 (DE3) competent cells by the same transformation method. According to the above screening process, transformants were obtained by antibiotic resistance screening, and positive clones were identified by PCR method. Finally, the positive strain confirmed by molecular identification was expanded and cultured, and the sample was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing verification.
[0031] The DNA of Aquimarina sp. KCL-5 was used as the template, and specific primers were used for PCR amplification of a 650 bp target band, which was consistent with the expectation (as shown in Figure 4 ); T4 DNA ligase was used for ligation to form the recombinant plasmid pET32a- OmpWThe recombinant plasmid was transformed into DH5a, a single colony was picked for PCR, the target fragment was 1357 bp, then it was transformed into BL21, and PCR verification was performed, the target fragment was 1357 bp, the recombinant plasmid was identified by double enzyme digestion of EcoR I and Hind III, and the results showed two bands, one was a band of about 5881 bp of pET32a (+), and the other was about 650 bp.
[0032] wherein, OmpW The gene sequence is: ATGAAAGCAGCATATTGGGCATTAGTGGCAGCAGCGGCATTTCCGGCAGTCTCGAGCGCACATCAGGCAGGGGATGTGATTTTTCGCGTAGGGACAGCCACGGTTCGTCCGACAGAAGGCTCGGACAACGTGCTGGGTCTGGGTTCATTTAATATCAATAACAACACGCAGATGGGATTAACCCTCGGTTACATGTTCACTGACAATATCGGTATGGAGTTGCTGGCAGCCACACCGTTCCAGCACAAAGTCGGTCTGCAAAGTACCGGGACTATCGCAGAAGTGAAACAATTACCGCCGTCTCTGATGGCGCAGTATTACTTTGGTGACCGTCAGGACAAATTGCGTCCGTACCTCGGAGTGGGTATCAACTACACCACATTTTATGACGCGGATTTCAACCAGACCGGGCGTGATGCCGGGCTGTCTGATTTAAGCGTCAAAGATTCCTGGGGTGTGGCAACGCAGGCTGGTCTGGATTACAACCTGGACGATAACTGGTTAATTAACATGTCTGTCTGGTGGATGGATATTGATACGGAAGTCAAATTCAAAGCTGGTGGTGAGCAGCAAAACATCAACACCCGGATCGACCCATGGGTCTTTATGTTTGGCGCCGGCTATCGTTTCTGA S3、 Optimization of the induction conditions of the recombinant protein The recombinant plasmid bacteria successfully constructed and preserved were subjected to expression condition optimization. First, the effect of temperature on protein expression was investigated, and four temperature gradients, 16°C, 20°C, 28°C and 37°C, were set for induction expression. The predicted protein size was 41.58 kD, and SDS-PAGE analysis results showed that the protein was consistent with the expected size, and the recombinant protein expression reached the highest at 28°C, while the target protein expression was not detected in the uninduced control group and the empty vector transformed bacteria.
[0033] Further, under the condition of 28°C, the effect of IPTG concentration (0.1-1.0 mmol / L, gradient 0.1 mmol / L) on recombinant protein expression was investigated. Experimental data showed that when the IPTG concentration was 0.4 mmol / L, the expression level of recombinant protein reached the peak. Under this optimized condition (28°C, 0.4 mmol / L IPTG), the optimal induction time was determined by time gradient experiment (1-6h), and the results showed that the maximum protein yield could be obtained by inducing for 5h. It is worth noting that during the whole optimization process, the target protein expression was not detected in the uninduced recombinant plasmid engineering bacteria and the pET32a empty vector transformed bacteria, which confirmed the specificity of the expression system, (such as Figure 6 ) S4, identification and purification of recombinant protein expression form After 20mL of bacteria were induced at 28°C, 0.4mmol / L IPTG for 5h, the cells were broken by ultrasonic cell disruptor, and SDS-PAGE electrophoresis analysis results showed that the target protein mainly existed in the precipitate component after ultrasonic disruption, and almost no obvious protein band was detected in the supernatant Figure 7 A. This phenomenon suggests that the recombinant protein mainly exists in the form of inclusion body in the Escherichia coli expression system, showing insoluble expression. By comparing the electrophoretogram of supernatant and precipitate samples, it can be observed that the precipitate component appears obvious protein band at the expected molecular weight position, while no specific band is found at the corresponding position of the supernatant, further confirming the insoluble expression characteristics of the target protein.
[0034] Under the optimal induction conditions, 200mL of bacteria were induced, and His-tagged protein purification kit was used for purification. The purified protein was dialyzed in 6M, 4M, 2M urea and 0.01M PBS for 12h respectively, and the electrophoretogram of the sucrose-concentrated protein is shown in Figure 7 B.
[0035] S5, Aquimarina sp. OmpW Preparation and identification of polyclonal serum Before initiating the immunization program, blood samples (2-3 mL) were collected from New Zealand white rabbits via the marginal ear vein as negative control serum. For the initial immunization, 1 mg of purified OmpW protein was thoroughly emulsified with an equal volume of complete Freund's adjuvant and administered via subcutaneous injection at multiple points on the back (approximately 0.2 mL per point). Subsequent booster immunizations were performed using incomplete Freund's adjuvant emulsified with an equal volume of antigen protein, with an interval of 14 days between immunizations, for a total of four immunizations.
[0036] On day 7 post-final immunization, whole blood was collected via cardiac puncture into sterile centrifuge tubes and incubated at 4°C for 12-16 hours to allow for complete coagulation. The whole blood was then centrifuged at 3000 xg for 15 minutes to separate the serum, which was then aliquoted and stored at -80°C. Using 1% agarose gel plates, wells were punched, and antiserum and antigen were added. The plates were incubated at 37°C for 24-48 hours, and the formation of the precipitation line was observed. The antibody titer was determined based on the highest dilution. A serum titer of 1:16 was considered positive. Figure 8 .
[0037] S7, Western blotting analysis The purified OmpW recombinant protein was separated by SDS-PAGE and then transferred to a PVDF membrane using a wet transfer method. During the transfer process, air bubbles were prevented between the membrane and the gel, and a sandwich structure was used for fixation. Transfer was performed at a constant current of 200 mA for 90 min under ice bath conditions. After transfer, the PVDF membrane was washed in PBS buffer for 10 min. It was then blocked with 5% skim milk powder and incubated at 37°C with shaking for 2 h. Finally, it was washed three times with TBST buffer for 8 min each time. The membrane was transferred to an incubator containing a 1:200 dilution of polyclonal antibody and incubated overnight at 4°C with horizontal shaking. The next day, it was washed three times with TBST, incubated with a 1:1000 dilution of HRP-labeled goat anti-rabbit IgG secondary antibody at 37°C for 1 h, washed three times with TBST water, and then 2 mL of TMB matrix chromogenic solution was added. The membrane was developed in the dark for 15 min and photographed for observation.
[0038] Detection of antibodies using immunoblotting OmpW The specificity of polyclonal antibodies. For example... Figure 10 As shown, the prepared anti OmpW Polyantiserum against OmpW Proteins have high specificity.
[0039] Immunohistochemical analysis of S8-type aquatic Laenella bacteria-infected crucian carp Tissue sections of crucian carp infected with *Laenia aquaticis* KCL-5 were fixed by baking in a 55℃ oven for 5 hours. Dewaxing was then performed: sections were sequentially immersed in xylene I and xylene II for 10 minutes each, followed by hydration in a gradient of ethanol (100%, 95%, 85%, 75%) for 5 minutes each. To eliminate endogenous peroxidase activity, sections were incubated with 3% H2O2 at room temperature for 10 minutes and washed three times with PBS buffer (5 minutes each time).
[0040] Antigen retrieval was performed using 0.01M sodium citrate buffer (pH 6.0), heated in a 95°C water bath for 15 min, and then naturally cooled to room temperature before washing with PBS for 5 min. An immunohistochemical pen was used to draw a circle around the tissue to block the antigen, followed by the addition of 5% BSA blocking solution and incubation at 37°C for 45 min. After discarding the blocking solution, a 1:100 dilution of rabbit primary antibody was added, and the tissue was incubated at 37°C for 1 h, followed by three washes with PBS. Then, HRP-labeled goat anti-rabbit IgG secondary antibody (1:200) was added, and the tissue was incubated at 37°C for 45 min, followed by three washes with PBS. Freshly prepared DAB reagent was used for staining, and the staining process was monitored in real-time under a microscope. Once a brown signal was detected, the reaction was immediately stopped with distilled water. After hematoxylin counterstaining for 8 minutes, the tissue sections were rinsed with water, dissolved in 1% hydrochloric acid alcohol for 2-3 seconds, and then rinsed with water for 5 minutes. After soaking in xylene for 5 minutes, the sections were mounted with neutral resin. The tissue sections were examined and photographed under a microscope.
[0041] Immunohistochemical results showed that ( Figure 10 ), the prepared OmpW Antibodies can be used to target the invasion of aquatic Ranunculosis in different tissues of fish. Brown positive signals were detected in the liver, kidney and gills of crucian carp infected with aquatic Ranunculosis KCL-5, indicating that the gills, liver and kidney are the main invasion sites of aquatic Ranunculosis.
[0042] S9, OmpW gene changes under temperature stress The bacterial suspension of *Laenia natans* KCL-5 was expanded in LB liquid medium at a ratio of 1%, and cultured in shakers at 25℃ and 35℃ at 180 rpm until the logarithmic growth phase (OD600 = 0.4~0.6, 12000 rpm). After centrifugation at 4℃ for 1 min, the supernatant was discarded and the solution was quickly placed in liquid nitrogen, frozen, and then stored at -80℃.
[0043] Total RNA was extracted from tissues using the Beyotime RNA Extraction Kit, and the RNA was reverse transcribed into cDNA using the TaKara PrimeScript RTreagent Kit.
[0044] qRT-PCR was performed using the SYBR Green dye method; the reaction system is shown in Table 3. After thoroughly mixing all reagents in the reaction system, the tubes were centrifuged to remove air bubbles. The qRT-PCR reaction was then performed using a real-time PCR instrument; the specific reaction procedure is shown in Table 4. Melting curve analysis was used to verify the specificity of the primers used and ensure the uniformity of the amplified products. -ΔΔCT The relative expression levels of genes were calculated using a method that uses 16S rRNA as an internal reference gene. OmpW The expression levels of the T35 group were 16.54 times higher than those of the T25 group, indicating that increased temperature significantly promoted the expression of virulence genes. OmpW The expression. Table 3 qRT-PCR reaction system Ingredients Volume (μl) BeyoFast™ SYBR Green qPCR Mix (2X) 10 Forward Primer 1 Reverse Primer 1 RNase-Free Water 6 cDNA 2 Table 2-7 qRT-PCR reaction procedure Temperature (°C) Time Cycle number 95 2 min 1 95 15s 40 60 30s 40 95 5s 40 65 5s 95 5s S10, Changes in OmpW protein expression under temperature stress The bacterial strain was cultured at 25℃ and 35℃ respectively, and bacterial suspensions were prepared to infect crucian carp. Liver tissue was harvested after infection, and protein samples were prepared using a tissue protein extraction kit. GAPDH was used as an internal control, and Western blotting was used to analyze the expression differences of the target protein. The expression level of OmpW in liver tissue was analyzed by time series, and the results are as follows: Figure 13 As shown, the expression level of OmpA / W increases over time after infection.
Claims
1. The method of claim 1 for cloning the OmpW gene of *Laenia aquaticis*, characterized in that: Based on the OmpW gene sequence of *Laenia aquaticis*, corresponding upstream and downstream primers were designed to amplify the target OmpW gene. The nucleotide sequence of the upstream primer is CCGGAATTCATGAAAGCAGCATATTGGGCAT. (OmpW-F1) The nucleotide sequence of the downstream primer is CCAAGCTTTCAGAAACGATAGCCGGCG (OmpW-R1) .
2. The cloning and prokaryotic expression of the OmpW gene of *Laenia aquaticis* according to claim 1, characterized in that: Cloning, expression, and sequence analysis of the outer membrane protein OmpW gene from *Laenia aquaticis*: DNA was extracted from *Laenia aquaticis* and used as a template for PCR amplification of the target gene. The PCR product was detected by 1% agarose gel electrophoresis and then recovered from the gel. Two restriction enzyme sites, EcoRI and HindIII, were added to the 5' end of the designed specific primers. The two restriction enzyme sites are: the nucleotide sequence CCG at the 5' end of the specific primer (i.e., the upstream primer). GAATTC ATGAAAGCAGCATATTGGGCAT ( OmpW -F2), the downstream primer's nucleotide sequence is CC AAGCTT TCAGAAACGATAGCCGGCG ( OmpW -R2).
3. The cloning and prokaryotic expression of the OmpW gene of *Laenia aquaticis* according to claim 2, characterized in that: For the induction and identification of pET32a-OmpW, the PCR product of claim 1 was double-digested and ligated into the pET32a(+) plasmid to construct the recombinant expression vector pET32a-OmpW, which was then transformed into competent DH5α cells. Positive clones were selected for sequencing. After successful sequencing, the positive clones were cultured overnight, and the plasmid DNA was extracted and re-transformed into BL21(DE3) chemocompetent cells. Positive clones were then selected for sequencing.
4. The cloning and prokaryotic expression of the OmpW gene of *Laenia aquaticis* according to claim 3, characterized in that: The OmpW protein gene cloning and expression vectors were constructed as follows: Based on the OmpW gene sequence of *Laenia aquaticis*, upstream and downstream primers were designed to amplify the target OmpW gene. PCR amplification successfully yielded the expected product (650 bp). Blast analysis showed that the target sequence had 100% homology with the *Laenia aquaticis* OmpW gene.
5. The cloning and prokaryotic expression of the OmpW gene of *Laenia aquaticis* according to claim 4, characterized in that: BL21(DE3) engineered bacteria carrying the pET32a-OmpW recombinant plasmid were inoculated into LB medium and cultured in a shaker at 37°C until the logarithmic growth phase (OD600≈0.6). Subsequently, three temperature gradients (37°C, 28°C, and 16°C) were set, and IPTG was added to a final concentration of 0.5 mM for induction expression. After induction, the bacterial cells were collected by centrifugation at 12000×g for 2 min, washed and resuspended with sterile PBS buffer, and denatured at 95°C for 10 min with 5×SDS loading buffer. Protein expression was analyzed by 12% SDS-PAGE. Further, at the determined optimal induction temperature, the effect of IPTG concentration (0.1-1.0 mM, gradient 0.1 mM) on protein expression was observed; simultaneously, induction time was optimized by setting time gradients of 1-7 h (1 h intervals), and the expression effect was evaluated by SDS-PAGE.
6. The cloning and prokaryotic expression of the OmpW gene of *Laenia aquaticis* according to claim 5, characterized in that: The preparation and identification methods of polyclonal antiserum against Aquatic Ransobacterium arachnoides OmpW are as follows: (1) Recombinant protein induction and expression form identification: OmpW recombinant protein expression was induced with different final IPTG concentrations, temperatures and induction times. The predicted protein size was 41.58 kD. SDS-PAGE analysis showed that the protein size was consistent with the expected size, and the recombinant protein expression reached its highest level at 28℃. The target protein expression was not detected in the uninduced control group and the empty vector transformed bacteria. Further, the effect of IPTG concentration (0.1-1.0 mM, gradient 0.1 mM) on recombinant protein expression was observed at 28℃. Experimental data showed that the recombinant protein expression level reached its peak when the IPTG concentration was 0.4 mmol / L. Under these optimized conditions (28℃, 0.4 mM IPTG), the optimal induction time was determined by time gradient experiments (1-6 h). The results showed that the maximum protein yield could be obtained after 5 h of induction. In addition, the identification results showed that OmpW recombinant protein was mainly expressed in the form of inclusion bodies. (2) Protein purification: After induction at 28℃ with 0.4mM IPTG for 5h, BL21(DE3) engineered bacteria were collected by centrifugation and then resuspended in pre-cooled PBS. Subsequently, the bacteria were lysed by sonication, then centrifuged, and the target protein was purified according to the instructions of the protein purification kit. Finally, the protein was eluted with elution buffer to obtain a single OmpW recombinant protein. (3) Serum preparation and identification: 200mL of bacterial culture was induced under optimal induction conditions, and purified using a His-tagged protein purification kit. The purified protein was dialyzed for 12h in 6M, 4M, 2M urea and 0.01M PBS, respectively. The protein was concentrated with sucrose, and the protein concentration was determined to be 1mg / mL. Then, the protein and adjuvant were emulsified, and rabbits were immunized by subcutaneous injection at multiple points on the back. Blood was collected from the heart to successfully prepare polyclonal antibody serum. The middle well of the two-dimensional agar amplification method was the OmpW fusion protein, and the surrounding wells were the polyclonal antibody serum titers.
7. The detection application of the polyclonal antibody serum against the OmpW gene of *Laenia aquaticis* according to claim 6, characterized in that: Two-way agar diffusion, immunoblotting, and immunohistochemical analysis were performed on crucian carp tissue infected with Aquatic Ransobacterium arabinose.