Application of tae-miR399 in reduction of phosphorus content of wheat grains

By regulating miR399 through gene editing technology and designing sgRNA to target miR399 using the CRISPR/Cas9 system, the problem of excessive phosphorus content in wheat grains has been solved, achieving sustainable utilization of phosphorus resources and maintaining wheat yield.

CN121160765APending Publication Date: 2025-12-19INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511327212.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

The biological functions of miR399 in regulating phosphorus absorption, translocation and distribution in wheat have not been reported in the existing technology, which leads to excessively high phosphorus content in wheat grains and affects the sustainable utilization of phosphorus resources.

Method used

By using gene editing technology to regulate the expression or activity of the coding nucleic acid of miR399, and by designing sgRNAs to target miR399 using the CRISPR/Cas9 system, miR399 can be knocked out or silenced, thereby reducing the phosphorus content of wheat grains.

Benefits of technology

It significantly reduces the phosphorus content of wheat grains, reduces the depletion of phosphorus in the soil, promotes the sustainable use of phosphorus resources, and does not affect wheat yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005600098970000011
    Figure HDA0005600098970000011
  • Figure HDA0005600098970000021
    Figure HDA0005600098970000021
  • Figure HDA0005600098970000031
    Figure HDA0005600098970000031
Patent Text Reader

Abstract

The invention discloses an application of tae-miR399 in reduction of the phosphorus content of wheat grains. The invention provides application of miR399, a substance for regulating and controlling the expression of coding nucleic acid of the miR399 or a substance for regulating and controlling the activity or content of the miR399 in any one of the following aspects: A1) regulating and controlling the phosphorus content of plant grains; a2) preparing plants with low grain phosphorus content; and A3) plant breeding. According to the invention, the function of miR399 is regulated and controlled through a gene editing technology, a mutant material of which the grain phosphorus content is obviously reduced is obtained, the depletion of soil phosphorus by harvested wheat can be reduced, and the sustainable utilization of phosphorus resources is promoted.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to application of tae-miR399 in reducing phosphorus content in wheat grains. BACKGROUND

[0002] Phosphorus is an essential mineral nutrient element for plants, and application of phosphorus fertilizer is crucial for crops such as wheat to obtain high yield. However, phosphorus is a non-renewable resource, and according to the current consumption of phosphorus ore, the phosphorus ore reserves in China can only be maintained for about 20 years of mining. Long-term and large-scale application of phosphorus fertilizer causes excessive accumulation of phosphorus in soil. According to statistics, the effective phosphorus content in the soil where wheat is planted in China reaches 25-35 mg / kg, which is much higher than the soil effective phosphorus agronomic threshold of 17.5 mg / kg for wheat to obtain high yield. The phosphorus in wheat grains accounts for more than 80% of the phosphorus accumulation in the aboveground part. In the case where the effective phosphorus content in soil is higher than the agronomic threshold, reducing the phosphorus content in wheat grains and reducing the depletion of soil phosphorus by harvested wheat is an important way to promote the sustainable use of phosphorus resources and develop green agriculture.

[0003] At present, the biological function of miR399 in regulating phosphorus uptake, transport and distribution in wheat has not been reported. SUMMARY

[0004] The technical problem solved by the present application is how to reduce the phosphorus content in wheat grains.

[0005] In order to solve the above technical problem, the present application provides, in a first aspect, application of miR399, a substance for regulating expression of a coding nucleic acid of the miR399, or a substance for regulating activity or content of the miR399 in any one of the following:

[0006] A1) regulating the phosphorus content in grains of a plant;

[0007] A2) preparing a plant with low grain phosphorus content;

[0008] A3) plant breeding;

[0009] The miR399 is any one or any combination of miR399a and miR399b and miR399c;

[0010] The miR399a is as follows a1) or a2):

[0011] a1) the nucleotide sequence of the RNA comprises SEQ ID No: 5;

[0012] a2) RNA having 80% or more identity with the RNA of a1);

[0013] The miR399b is as follows a3) or a4):

[0014] a3) the nucleotide sequence of the RNA shown in SEQ ID No: 6;

[0015] a4) an RNA having 80% or more identity to the RNA shown in a3);

[0016] The miR399c is as follows a5) or a6):

[0017] a5) the nucleotide sequence of the RNA shown in SEQ ID No: 7;

[0018] a6) an RNA having 80% or more identity to the RNA shown in a5).

[0019] In the above, the miR399a is located in the A genome of wheat, the miR399b is located in the B genome of wheat; and the miR399c is located in the D genome of wheat.

[0020] In the above, since there is a conserved sequence in miR399a, miR399b and miR399c, one sgRNA group can be used for targeted gene editing.

[0021] In the above, the any combination can be a combination of any two, or a combination of any three.

[0022] The term "identity" refers to sequence similarity to a native nucleic acid sequence. The identity can be evaluated by naked eyes or computer software. Using computer software, the identity between two or more sequences can be expressed in percentage (%), which can be used to evaluate the identity between related sequences. The 80% or more identity can be at least 90%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity.

[0023] In the above, miR399 is also referred to as tae-miR399.

[0024] In the above application, the index of plant breeding refers to grain phosphorus content.

[0025] In the above application, the plant breeding refers to reducing the grain phosphorus content of plants and / or preparing plants with low grain phosphorus content.

[0026] In the above application, the regulation refers to reduction.

[0027] In the above application, the substance for regulating the expression of the coding nucleic acid of miR399 is any one of the following biological materials:

[0028] B1) a nucleic acid molecule which inhibits or reduces or down-regulates the expression of a nucleic acid encoding said miR399, or which inhibits or reduces or down-regulates the activity or content of said miR399;

[0029] B2) a nucleic acid molecule which expresses the nucleic acid molecule of B1);

[0030] B3) an expression cassette comprising the nucleic acid molecule of B2);

[0031] B4) a recombinant vector comprising the nucleic acid molecule of B2), or an expression cassette of B3);

[0032] B5) a recombinant microorganism comprising the nucleic acid molecule of B2), or an expression cassette of B3), or a recombinant vector of B4);

[0033] B6) a transgenic plant cell line comprising the nucleic acid molecule of B2), or an expression cassette of B3), or a recombinant vector of B4);

[0034] B7) a transgenic plant tissue comprising the nucleic acid molecule of B2), or an expression cassette of B3), or a recombinant vector of B4);

[0035] B8) a transgenic plant organ comprising the nucleic acid molecule of B2), or an expression cassette of B3), or a recombinant vector of B4).

[0036] In the above, the substance which inhibits or reduces the expression of a gene can be a substance which performs at least one of the following 6 kinds of regulation: 1) regulation at the transcription level of the gene; 2) regulation after the transcription of the gene (i.e., regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of the RNA transport of the gene (i.e., regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0037] In the above use, the inhibition or reduction of the expression of a nucleic acid encoding said miR399 can be achieved by gene knockout or by gene silencing.

[0038] The gene knockout refers to the phenomenon of inactivating a specific target gene by homologous recombination. The gene knockout is inactivation of a specific target gene by alteration of the DNA sequence.

[0039] The gene silencing refers to a phenomenon that a gene is not expressed or lowly expressed without damaging the original DNA. The gene silencing is premised on not changing the DNA sequence, so that the gene is not expressed or lowly expressed. The gene silencing can occur at two levels, one is the transcription level gene silencing caused by DNA methylation, heterochromatinization and position effect, and the other is the post-transcriptional gene silencing, i.e. the gene is inactivated by specifically inhibiting the target RNA at the level after the gene transcription, including antisense RNA, co-suppression, quelling, RNA interference (RNAi) and microRNA (miRNA) mediated translation inhibition, etc.

[0040] In the above-mentioned applications, the substance for inhibiting or reducing the expression of the coding nucleic acid of the miR399 can be a reagent for knocking out the coding nucleic acid of the miR399, such as a reagent for knocking out the coding nucleic acid of the miR399 by homologous recombination, or a reagent for knocking out the coding nucleic acid of the miR399 by CRISPR / Cas9. The reagent for inhibiting or reducing the expression of the coding nucleic acid of the miR399 can comprise a polynucleotide targeting the coding nucleic acid of the miR399, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0041] In some embodiments, the substance for inhibiting or reducing the expression of the coding nucleic acid of the miR399 is the biological material described in B1) to B8).

[0042] In some embodiments, the substance for inhibiting or reducing the expression of the coding nucleic acid of the miR399 can comprise sgRNA or a plasmid expressing the same.

[0043] The target point of the sgRNA is sgRNA01 target point and sgRNA02 target point;

[0044] The nucleotide sequence of the sgRNA01 target point is 7-29 of SEQ ID NO. 1;

[0045] The nucleotide sequence of the sgRNA02 target point is 75-97 of SEQ ID NO. 1.

[0046] The plasmid expressing the same is the recombinant vector pBUE-miR399abc constructed in the examples.

[0047] In a second aspect, the present application provides a method for reducing the phosphorus content of plant seeds, comprising the following steps: down-regulating or weakening or reducing the expression of the nucleic acid encoding the miR399 in the first aspect, or down-regulating or weakening or reducing the activity or content of the miR399 in the first aspect in the plant, so as to reduce the phosphorus content of the plant seeds.

[0048] In a third aspect, the present application provides a method for cultivating a plant with low phosphorus content in seeds, comprising the following steps: down-regulating or weakening or reducing the expression of the nucleic acid encoding the miR399 in the first aspect in the recipient plant, or down-regulating or weakening or reducing the activity or content of the miR399 in the first aspect in the recipient plant, so as to obtain a target plant, i.e., a plant with low phosphorus content in seeds.

[0049] In a fourth aspect, the present application provides the biological material described in B1) to B8) in the first aspect.

[0050] In the above, the plant is any one of the following c1) to c5): c1) a dicotyledonous plant; c2) a monocotyledonous plant; c3) a plant of the family Poaceae; c4) wheat.

[0051] The present application regulates the function of miR399 through gene editing technology, and obtains mutant material with significantly reduced phosphorus content in seeds, which can reduce the depletion of soil phosphorus by harvested wheat and promote the sustainable use of phosphorus resources. BRIEF DESCRIPTION OF DRAWINGS

[0052] Figure 1 Figure 1 is the creation of CRISPR / Cas9-mediated tae-miR399 gene editing lines; A is the T0 generation tae-miR399 mutation type; B is the secondary structure prediction of RNA of the generated tae-miR399 mutation. The yellow and red dashed box in the figure is the coding nucleic acid of the mature sequence region of tae-miR399, and the red number represents the mutation, and the arrow represents the cleavage site of tae-miR399.

[0053] Figure 2 Figure 3 is the comparison of Pi content of different leaf positions of tae-mir399 mutants at the flowering stage; A is a schematic diagram of sampling different leaf positions of wheat; B is the determination of inorganic phosphorus content of different leaf positions of Fielder and M4-abd three mutants at the flowering stage; the numerical value in the figure is mean±S.E. (n≥4). *, ** and *** represent that the difference between the wild type and the mutant material reaches the P<0.05, P<0.01 and P<0.001 level, respectively.

[0054] Figure 3Figure 6. Phenotypes of tae-mir399 mutants under normal phosphorus supply in the field; A, single plant yield; B, total phosphorus content in seeds; Values in the figure are mean ± S.E. (n≥8); Lowercase letters a and b represent the difference levels between different groups reaching a = 0.05. DETAILED DESCRIPTION

[0055] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0056] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0057] The quantitative tests in the following examples are all set up in triplicate, and the results are averaged, unless otherwise specified.

[0058] Example 1. Creation of tae-miR399 knockout mutants

[0059] First, the miR399 sequences in the wheat genome were analyzed. By querying the plant small RNA annotation database sRNAanno website (http: / / www.plantsrnas.org / ) and the wheat multi-omics website (http: / / wheatomics.sdau.edu.cn / ), it was found that there were 6 tae-miR399s (tae-miR399a-f) in wheat, tae-miR399a, b, c, d, e and f were located on 2A, 2B, 2D, 7A, 7B, 7D, respectively, and it was found that the expression levels of tae-miR399a\b\c were higher than those of tae-miR399d\e\f. Since the mature sequences of tae-miR399abc (5'-UGCCAAAGGAGAGUUGCCCUG-3') are completely identical, the precursor sequences of tae-miR399a / b / c were further aligned using DNAman. The results showed that the precursor sequences of tae-miR399a / b / c were all 99 bp in length, the nucleotide sequences of the coding nucleic acids of the precursor sequences of tae-miR399a / b / c were SEQ ID NO. 1-SEQ ID NO. 3, respectively, the nucleotide sequences of the precursor sequences of tae-miR399a / b / c were SEQ ID NO. 5-SEQ ID NO. 7, respectively, and the mature sequences were all on the 3' end arm of the precursor (Figure 1). Figure 1A), which is consistent with the universal characteristics of plant miRNA precursor sequences.

[0060] The tae-miR399a / b / c mutant material was created by using CRISPR / Cas9. Specific sgRNA sequences were designed for the miR399-5p-star region and the miR399-3p-mature region. The double-target system was used, which is more likely to obtain mutant material with large deletions.

[0061] 1. Vector construction

[0062] Two sgRNA sequences, sgRNA01 and sgRNA02, were designed for the mature region of tae-miR399abc. The design was based on the following principles: the sequence of sgRNA specifically binds to the mature region sequence of tae-miR399abc, the length is generally 19-22 bases, avoid more than 4 consecutive T bases at the end, the GC content is 40%-60%, there is no BsaI enzyme cutting site in the sequence of sgRNA and no PAM sequence.

[0063] The target point of sgRNA01 is the 7-29th of SEQ ID NO. 1, and the target point of sgRNA02 is the 75-97th of SEQ ID NO. 1.

[0064] The upstream primer was amplified as follows: sgRNA01F: 5'-aataat GGTCTC AGGCGGTTTCAGGGCTCCTCTTTATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAG-3'; the downstream primer is sgRNA02R: 5'-attatt GGTCTC TAAACAGTTACAGGGCAACTCTCCTCGCTTCTTGGTGCCGCG-3'. The lowercase letters are enzyme cutting site recognition sequences.

[0065] The pCBC-MT1T2 plasmid (Addgene plasmid #50593; http: / / n2t.net / addgene:50593) was used as a template, and KOD FX was used for PCR reaction. The reaction system was as follows: 25 μL 2x PCR buffer, 10 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 1 μL KOD FX (Toyobo), 2 μL template (100-200 ng / μL), and ddH2O was added to 50 μL.

[0066] The annealing temperature of the above PCR reaction was 60°C, and the annealing time was 1 min.

[0067] PCR reaction product: sgRNA1-gRNA-scaffold-OsU3ter-TaU3p-sgRNA2 tandem structure (SEQ ID NO. 4) was obtained, and the length of the fragment was 966 bp.

[0068] In SEQ ID NO. 4, positions 5-24 are the target binding region of sgRNA01, positions 25-100 are gRNA-scaffold, and positions 917-936 are the target binding region of sgRNA02.

[0069] The PCR reaction product was purified and recovered, and 50 ng of the recovered product was added to a new 200 μL centrifuge tube, 200 ng of linearized vector pBUE411 (Addgene plasmid #62200; http: / / n2t.net / addgene:62200) digested with BsaI, 2 μL of 10×BSA, 2 μL of 10×NEB T4 Buffer, 1 μL of BsaI (NEB), 1 μL of T4 Ligase (NEB), and ddH2O was added to 20 μL. Lightly mix, 37°C reaction for 5 min, 16°C reaction for 10 min, a total of 50 cycles, followed by 16°C storage for 1 h, to obtain the recombinant vector pBUE-miR399abc.

[0070] The recombinant vector pBUE-miR399abc is a vector obtained by inserting the sgRNA1-gRNA-scaffold-OsU3ter-TaU3p-sgRNA2 sequence (SEQ ID NO. 4) into the BsaI digestion site of the pBUE411 vector, which contains sgRNA01 encoding nucleic acid (positions 7-29 of SEQ ID NO. 1) and sgRNA02 encoding nucleic acid (positions 75-97 of SEQ ID NO. 1).

[0071] The recombinant vector pBUE-miR399abc was transformed into E. coli Trans1-T1, and after transformation, the plasmid was extracted from the clone and sent for sequencing, and the recombinant vector was successfully constructed.

[0072] The recombinant vector pBUE-miR399abc was transformed into Agrobacterium EHA105 (Beijing Huayueyang), and the recombinant bacteria were obtained.

[0073] The plasmid was extracted and sent for sequencing, and the results proved that the positive recombinant bacteria were obtained, named EHA105 / pBUE-miR399abc.

[0074] 2. Wheat immature embryo transformation

[0075] Using Fielder as the transformation receptor, the recombinant bacteria EHA105 / pBUE-miR399abc was transformed into the immature embryo of Fielder (hereinafter also referred to as wild type wheat) by the method of Agrobacterium infection to obtain T0 generation gene editing wheat.

[0076] 3. Detection of gene editing plants

[0077] The genomic DNA of T0 generation gene editing wheat was extracted by CTAB method, and the following primers were used for PCR reaction to identify the mutation of miR399 on A, B and D chromosomes, respectively:

[0078] The primer pair for identifying miR399 on A chromosome was as follows:

[0079] KO-tae-miR399-2A-F: GCTCTCAACACCCATGCT

[0080] KO-tae-miR399-2A-R: AGAAGAAGAAGGAAGCAGC

[0081] The primer pair for identifying miR399 on B chromosome was as follows:

[0082] KO-tae-miR399-2B-F: GCTGTCAACGCCGATACC

[0083] KO-tae-miR399-2B-R: GAAGAAGAAAGGAAGCGAC

[0084] The primer pair for identifying miR399 on D chromosome was as follows:

[0085] KO-tae-miR399-2D-F: GCTGTCAACGCCGATGCA

[0086] KO-tae-miR399-2D-R: AAGAAGAAGAAGGCCCGAAGCTC

[0087] The results showed that two types of heterozygous mutant plant strains (as shown in Figure 1 A) were obtained in T0 generation gene editing wheat: M1 and M4;

[0088] M1 is a tae-mir399a heterozygous single mutant (also referred to as M1-a), which produces a large 68bp deletion between the designed two target sites, i.e. the A genome of M1 has the following mutation: compared with wild type wheat, the region corresponding to the tae-miR399a encoding nucleic acid in the genome of the A chromosome of M1 has the following mutation: in the two homologous chromosomes, one nucleotide sequence is that the tae-miR399a encoding nucleic acid has the following change: 68 bases from 24th to 91st in SEQ ID No: 1 are deleted, resulting in a frame shift mutation of the tae-miR399a encoding nucleic acid, so as to knock out the tae-miR399a encoding nucleic acid, and the other is consistent with wild type wheat. The tae-miR399b encoding nucleic acid and the tae-miR399c encoding nucleic acid in the genomes of the B and D chromosomes are consistent with wild type wheat.

[0089] M4 is a tae-mir399a / b / c heterozygous triple mutant (also referred to as M4-abd):

[0090] M4-abd produces a 2bp deletion in the miR399-5p-star region on the A group, and an A-T base substitution and a 293bp insertion in the miR399-3p-mature region, and there are 69bp and 67bp deletions between the two target sites on the B group and the D group respectively; i.e. the A genome of M4-abd has the following mutation: compared with wild type wheat, the region corresponding to the tae-miR399a encoding nucleic acid in the genome of the A chromosome of M4-abd has the following mutation: in the two homologous chromosomes, one nucleotide sequence is that the tae-miR399a encoding nucleic acid has the following change: 2 bases from 23rd to 24th in SEQ ID No: 1 are deleted, and A at 80th in SEQ ID No: 1 is replaced by T, and GCCCTGTA from 84th to 91st in SEQ ID No: 1 is replaced by

[0091] TTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCGCGGTGATCACAGGCAGCAACGCTCT

[0092] GTCATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTC

[0093] TTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGG (add 293 bases), resulting in a frame-shift mutation in the tae-miR399a-encoding nucleic acid, thereby knocking out the tae-miR399a-encoding nucleic acid, and the other one is consistent with the wild-type wheat; the B genome has the following mutation: compared with the wild-type wheat, in the genome of the B chromosome, the region corresponding to the tae-miR399b-encoding nucleic acid has the following mutation: in the two homologous chromosomes, one nucleotide sequence is that the tae-miR399b-encoding nucleic acid has the following change: 69 bases from 22nd to 90th in SEQ ID No: 2 are deleted, resulting in a frame-shift mutation in the tae-miR399b-encoding nucleic acid, thereby knocking out the tae-miR399b-encoding nucleic acid, and the other one is consistent with the wild-type wheat; the D genome has the following mutation: compared with the wild-type wheat, in the genome of the D chromosome, the region corresponding to the tae-miR399c-encoding nucleic acid has the following mutation: in the two homologous chromosomes, one nucleotide sequence is that the tae-miR399c-encoding nucleic acid has the following change: 67 bases from 24th to 90th in SEQ ID No: 3 are deleted, resulting in a frame-shift mutation in the tae-miR399c-encoding nucleic acid, thereby knocking out the tae-miR399c-encoding nucleic acid, and the other one is consistent with the wild-type wheat.

[0094] The secondary structure of RNA was predicted for each type of mutation using RNAfold, taking the precursor secondary structure of tae-miR399a as a reference and comparing with each mutant. It was found that the mutations of M1 and M4 had a great influence on the formation of normal stem-loop structure, and seriously damaged the original stem-loop structure of tae-miR399 Figure 1 B), and tae-miR399 could not be normally transcribed and translated.

[0095] Each mutant T0 generation was bred to obtain a homozygous T2 generation.

[0096] The M4 system is a tae-mir399a / b / c hybrid three-point (also known as M4-abd) T0 generation bred to T2 generation, and the following homozygous double-point is obtained:

[0097] M4-ab produces a 2bp deletion in the miR399-5p-star region of A group, and a A-T base substitution and a 293bp insertion in the miR399-3p-mature region, and a 69bp and 67bp deletion between the two target points in B group; that is, the A genome of M4-ab has the following mutations: compared with the wild type wheat, the region corresponding to the tae-miR399a-encoding nucleic acid in the genome of the A chromosome of M4-ab has the following mutations: in the two homologous chromosomes, the tae-miR399a-encoding nucleic acid has the following changes: the 2bp bases of SEQ ID No: 1 23-24 are deleted, the A of SEQ ID No: 1 80 is replaced by T, and the GCCCTGTA of SEQ ID No: 1 84-91 is replaced by TTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCGCGGTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGG (an increase of 293 bases), so that the tae-miR399a-encoding nucleic acid is subjected to a frameshift mutation, thereby knocking out the tae-miR399a-encoding nucleic acid; the B genome has the following mutations: compared with the wild type wheat, the region corresponding to the tae-miR399b-encoding nucleic acid in the genome of the B chromosome of M4-ab has the following mutations: in the two homologous chromosomes, the tae-miR399b-encoding nucleic acid has the following changes: the 69bp bases of SEQ ID No: 2 22-90 are deleted, so that the tae-miR399b-encoding nucleic acid is subjected to a frameshift mutation, thereby knocking out the tae-miR399b-encoding nucleic acid.

[0098] M4-ad has 2bp deletion in miR399-5p-star region, and A-T base substitution and 293bp insertion in miR399-3p-mature region in A group, and 69bp and 67bp deletion between two target sites in D group; that is, the A genome of M4-ad has the following mutations: compared with wild type wheat, the region corresponding to the tae-miR399a-encoding nucleic acid in the genome of the A chromosome has the following mutations: in the two homologous chromosomes, the tae-miR399a-encoding nucleic acid has the following changes: 2bp of bases at positions 23-24 of SEQ ID No: 1 are deleted, A at position 80 of SEQ ID No: 1 is replaced by T, and GCCCTGTA at positions 84-91 of SEQ ID No: 1 is replaced by TTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCGCGGTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGG (an increase of 293 bases) are replaced by T, resulting in a frameshift mutation of the tae-miR399a-encoding nucleic acid, thereby knocking out the tae-miR399a-encoding nucleic acid; the D genome has the following mutations: compared with wild type wheat, the region corresponding to the tae-miR399c-encoding nucleic acid in the genome of the D chromosome has the following mutations: in the two homologous chromosomes, the tae-miR399c-encoding nucleic acid has the following changes: 67bp of bases at positions 24-90 of SEQ ID No: 3 are deleted, resulting in a frameshift mutation of the tae-miR399d-encoding nucleic acid, thereby knocking out the tae-miR399c-encoding nucleic acid.

[0099] Example 2, Field Test Phenotype Identification of tae-mir399 Gene Editing Mutant

[0100] 1. tae-miR399 affects the content and distribution of inorganic phosphorus (Pi) at different leaf positions

[0101] Pi content of different leaf positions of wild type wheat Fielder and T2 generation M4-abd mutant at flowering stage were determined respectively. The method for determining inorganic phosphorus (Pi) content in plant tissue is as follows:

[0102] 1) 5 mL ice acetic acid was added to 245 mL ddH2O to make 2% ice acetic acid; color developing solution: 1 part of A liquid (10% ascorbic acid) and 6 parts of B liquid (0.84 g of NH4MoO4·4H2O was weighed, dissolved in a small amount of ddH2O, and then 5.72 mL of H2SO4 was added, and ddH2O was added to 200 mL to make up the volume) were mixed uniformly and stored in the dark; 0.1361 g of KH2PO4 was weighed to constant weight, dissolved in ddH2O, and made up to 100 mL to make 10 mM phosphorus standard solution;

[0103] 2) About 0.01 g of wheat tissue powder quickly frozen and crushed by liquid nitrogen was taken, 1 mL of 2% ice acetic acid was added, and shaken uniformly, and then placed in a 42°C water bath for 30 min;

[0104] 3) 15,000 g centrifugation at room temperature for 5 min, and 150 μL of supernatant was taken in a new centrifuge tube for standby;

[0105] 4) 10 mM phosphorus standard solution 0 μL, 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, 6 μL, 7 μL, 8 μL, 9 μL, 10 μL were taken and placed in 1.5 mL centrifuge tubes, respectively, and 2% ice acetic acid was used to dilute the phosphorus standard solution to 150 μL, so as to form a series of standard solutions of 0, 0.02, 0.04, 0.06, 0.08, 0.10, 0.12, 0.14, 0.16, 0.18, 0.2 mM;

[0106] 5) 350 μL of color developing solution was added to the centrifuge tube containing the sample, mixed uniformly, and then placed in a 42°C water bath for 30 min;

[0107] 6) 200 μL of standard sample and experimental sample were taken and added to a 96-well enzyme-labeled plate, and the absorbance value was determined at a wavelength of 820 nm by using an enzyme-labeled instrument, with the blank as the reference, the inorganic phosphorus concentration as the abscissa, and the optical density as the ordinate, to draw a standard curve, and the inorganic phosphorus content was calculated according to the standard curve.

[0108] The results are as follows Figure 2As shown in Fig. 1A, it can be seen that the Pi content of the flag leaf is significantly higher than that of the second, third and fourth leaves, whether in wild type or mutant, indicating that the absorbed phosphorus is preferentially allocated to the newly formed tissues, which is consistent with previous studies. By comparing the Pi content of different leaf positions of T2 generation M4-abd mutant with wild type, it was found that the Pi content of the flag leaf and the second leaf of the M4-abd mutant showed a very significant decrease, with a decrease of about 30%, and the Pi content of the third and fourth leaves also showed a significant decrease, with a decrease lower than that of the flag leaf and the second leaf Figure 2 B). It is shown that the mutation of tae-mir399 (knocking out the tae-mir399 encoding nucleic acid) can significantly down-regulate the Pi content in different parts of the leaf.

[0109] 2, Effect of tae-mir399 mutation on wheat yield and grain phosphorus content

[0110] T2 generation M1-a mutant, T2 generation M4-ab mutant, T2 generation M4-ad mutant, T2 generation M4-abd mutant and wild type wheat were subjected to the following experiments:

[0111] During the spring sowing in 2024, each T2 generation homozygous mutant and wild type wheat plant was planted under normal phosphorus supply conditions. Field phenotypic identification was carried out in the transgenic intermediate test base of Zhaoxian experimental base, and only normal fertilization treatment was set, with base fertilizer of 120 kg N / ha and 90 kg P2O5 / ha, and 60 kg N / ha at the jointing stage. Field experiment set 4 repeats for each material, sowed 2 rows per repeat, row length 2m, plant spacing 10cm, row spacing 23cm.

[0112] The single plant yield and grain phosphorus content of each tae-mir399 mutant system were investigated and analyzed.

[0113] The single plant yield results are shown in Figure 3 A, it can be seen that compared with wild type Fielder, the single plant yield of all mutant systems did not change significantly.

[0114] The grain phosphorus content was determined, and the total phosphorus content in wheat grain was determined by H2SO4+H2O2 digestion and molybdenum blue colorimetry.

[0115] The results are shown in Figure 3 B, it can be seen that the grain phosphorus content of all mutant systems showed different degrees of significant decrease compared with wild type wheat.

[0116] The above results show that after mutation of tae-mir399, the content of Pi in different leaf positions is significantly reduced, and the content of Pi in wheat grains can be significantly reduced without affecting the yield of single plant. These results show that knocking out tae-mir399 can be used to breed new varieties of wheat with low grain phosphorus content, reduce the depletion of soil phosphorus by harvested wheat grains, and increase the sustainability of phosphorus resource utilization.

[0117] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. The use of miR399, a substance that regulates the expression of the nucleic acid encoding said miR399, or a substance that regulates the activity or content of said miR399 in any of the following: A1) Regulates phosphorus content in plant grains; A2) Prepare plants with low phosphorus content in the grains; A3) Plant breeding; The miR399 is any one or any combination of miR399a, miR399b and miR399c; The miR399a is either a1) or a2) as follows: The nucleotide sequence of the RNA shown in a1) includes SEQ ID No: 5; RNAs that share more than 80% identity with RNAs shown in a2) and a1); The miR399b is as follows (a3) ​​or (a4): The nucleotide sequence of the RNA shown in a3) includes SEQ ID No: 6; RNAs shown in a4) and a3) have more than 80% identity; The miR399c is as follows (a5) or (a6): The nucleotide sequence of the RNA shown in a5) includes SEQ ID No: 7; RNAs shown in a6) and a5) share more than 80% identity.

2. The application according to claim 1, characterized in that: The regulation mentioned is to reduce.

3. The application according to claim 1 or 2, characterized in that: The substance that regulates the expression of the miR399-encoding nucleic acid is any of the following biological materials: B1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the nucleic acid encoding miR399, or inhibit, reduce, or downregulate the activity or content of miR399; B2), expressing the nucleic acid molecule encoding the nucleic acid molecule described in B1); B3), an expression cassette containing the nucleic acid molecule described in B2); B4) a recombinant vector containing the nucleic acid molecule described in B2), or a recombinant vector containing the expression cassette described in B3); B5) Recombinant microorganisms containing the nucleic acid molecules described in B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4); B6) A transgenic plant cell line containing the nucleic acid molecule described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7) Transgenic plant tissue containing the nucleic acid molecules described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8) A transgenic plant organ containing the nucleic acid molecule described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4).

4. A method for reducing the phosphorus content of plant seeds, comprising the following steps: downregulating or weakening or reducing the expression of the nucleic acid encoding miR399 as described in claim 1 in the plant, or downregulating or weakening or reducing the activity or content of miR399 as described in claim 1 in the plant, thereby reducing the phosphorus content of plant seeds.

5. A method for cultivating plants with low seed phosphorus content, comprising the following steps: downregulating or weakening or reducing the expression of the nucleic acid encoding miR399 as described in claim 1 in a recipient plant, or downregulating or weakening or reducing the activity or content of miR399 as described in claim 1 in a recipient plant, to obtain a target plant, namely a plant with low seed phosphorus content.

6. The biomaterial described in claims 3(B1)-B8).

7. The application according to any one of claims 1-3, or the method according to claim 4 or 5, characterized in that: The plant is any one of the following c1) to c5): c1) dicotyledonous plants; c2) monocotyledonous plants; c3) grasses; c4) wheat.