Application of chloride channel protein coding gene GmSALT9 in identifying soybean salt tolerance

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to application of a chloride channel protein coding gene GmSALT9 in identification of soybean salt tolerance. The nucleotide sequence of the chloride ion channel protein coding gene GmSALT9 disclosed by the invention is as shown in SEQ ID NO. 1. According to the scheme, the salt tolerance of the soybean can be judged according to the promoter haplotype of the chloride ion channel protein encoding gene GmSALT9; when the promoter haplotype of the GmSALT9 is a TT type, it is prompted that the salt tolerance of the tested soybeans is high; when the promoter haplotype of the GmSALT9 is an AA type, it is prompted that the detected soybean is sensitive to salt. The invention provides remarkable relevance between the chloride ion channel protein coding gene GmSALT9 and the salt-tolerant character of the soybean, and the chloride ion channel protein coding gene GmSALT9 has important research value and application prospect in improvement of the salt-tolerant character of the soybean and cultivation of a new salt-tolerant soybean variety.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a chloride channel protein coding gene GmSALT9 and application thereof in identifying soybean salt tolerance. BACKGROUND

[0002] Soil salinization is an important environmental factor limiting crop production, which can adversely affect the growth and development of soybeans, and chloride ion toxicity is one of the main stress mechanisms. Identifying soybean salt tolerance is crucial for breeding varieties that adapt to saline soils. Currently, the methods for identifying soybean salt tolerance based on morphological or physiological indicators usually require a long time and are easily affected by environmental conditions, and the efficiency is low. Although some genes related to soybean salt tolerance have been found, the functional mechanism thereof has not been fully elucidated or the specific mechanism thereof in regulating salt tolerance is not fully clear, and it has not been fully applied to salt tolerance identification. SUMMARY

[0003] The purpose of the present application is to solve the above-mentioned problems existing in the prior art, and to find a technical solution for efficiently and accurately identifying soybean salt tolerance. To this end, the present application provides a chloride channel protein coding gene GmSALT9 and application thereof in identifying soybean salt tolerance.

[0004] The present application provides a chloride channel protein coding gene GmSALT9 and application thereof in identifying soybean salt tolerance. GmSALT9 The nucleotide sequence of the chloride channel protein coding gene is shown as SEQ ID NO. 1.

[0005] Preferably, the salt tolerance of soybean is judged according to the promoter haplotype of the chloride channel protein coding gene GmSALT9 ; The promoter haplotype of the chloride channel protein coding gene GmSALT9 includes a TT-type salt-tolerant haplotype promoter sequence with a nucleotide sequence as shown in SEQ ID NO. 2 or an AA-type salt-sensitive haplotype promoter sequence with a nucleotide sequence as shown in SEQ ID NO. 3.

[0006] The present application further provides a SNP molecular marker for identifying the promoter haplotype of the chloride channel protein coding gene GmSALT9 , which is located 858 upstream of the start codon ATG of the promoter of the soybean Glyma.09g157900 gene, and there is a T / A polymorphism.

[0007] The present application further provides a primer pair for identifying the SNP molecular marker according to the above technical solution.

[0008] Preferably, the primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 5.

[0009] The application further provides a kit comprising the primer pair described in the above technical solution.

[0010] The application further provides a method for identifying salt tolerance of soybean, comprising the following steps: Using genomic DNA of the soybean to be tested as a template, performing PCR amplification on the template by using the primer pair with the nucleotide sequences as shown in SEQ ID NO. 4 and SEQ ID NO. 5 to obtain an amplification product; detecting the genotype of the amplification product, and when the amplification product contains the nucleotide sequence as shown in SEQ ID NO. 2, it indicates that the soybean has high salt tolerance; and when the amplification product contains the nucleotide sequence as shown in SEQ ID NO. 3, it indicates that the soybean is sensitive to salt.

[0011] The application further provides application of the SNP molecular marker described in the above technical solution, the primer pair described in the above technical solution or the kit described in the above technical solution in identifying or improving salt tolerance of soybean and / or in soybean assisted breeding.

[0012] Preferably, the soybean assisted breeding comprises screening or cultivating new salt-tolerant soybean varieties.

[0013] The application further provides a method for cultivating salt-tolerant soybean, comprising the following steps: Screening salt-tolerant soybean as a parent for breeding or selecting salt-tolerant soybean in the cultivated offspring by using the SNP molecular marker described in the above technical solution, the primer pair described in the above technical solution or the kit described in the above technical solution.

[0014] Beneficial effects: The application provides a chloride channel protein coding gene GmSALT9 The nucleotide sequence of the chloride channel protein coding gene GmSALT9 is shown in SEQ ID NO. 1. In the solution described in the application, the salt tolerance of soybean can be judged according to the promoter haplotype of the chloride channel protein coding gene GmSALT9 described in the application; when the promoter haplotype of the chloride channel protein coding gene GmSALT9 is the TT type as shown in SEQ ID NO. 2, it indicates that the tested soybean has high salt tolerance; and when the promoter haplotype of the chloride channel protein coding gene GmSALT9 is the AA type as shown in SEQ ID NO. 3, it indicates that the tested soybean is sensitive to salt. GmSALT9The significant correlation between salt tolerance and soybean salt tolerance has important research value and application prospects in improving soybean salt tolerance and breeding new salt-tolerant soybean varieties. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0016] Figure 1 This is a histogram showing the frequency distribution of salt tolerance traits. Figure 2 This is a diagram showing the location results of salt-tolerant sites. Figure 3 for GmSALT9 The effect of promoter SNP mutation on expression is shown in the figure. Figure 4 Before and after salt stress in different haplotype soybean varieties GmSALT9 Graph showing changes in expression levels; Figure 5 For promoter T>A mutation and GmSALT9 The results show the relationship between the expression and the salt resistance of the material. Detailed Implementation

[0017] This invention provides a chloride channel protein encoding gene. GmSALT9 Application in identifying salt tolerance in soybeans, characterized in that the chloride ion channel protein encoding gene... GmSALT9

[0018] As an embodiment, the present application judges the salt tolerance of soybean according to the promoter haplotype of the chloride channel protein coding gene GmSALT9 ; The promoter haplotype of the chloride channel protein coding gene GmSALT9 The promoter haplotype of the chloride channel protein coding gene includes a TT type salt-tolerant haplotype promoter sequence with a nucleotide sequence as shown in SEQ ID NO. 2 or an AA type salt-sensitive haplotype promoter sequence with a nucleotide sequence as shown in SEQ ID NO. 3. The nucleotide sequence shown in SEQ ID NO. 2 of the present application is specifically:

[0019] The nucleotide sequence shown in SEQ ID NO. 3 of the present application is specifically:

[0020] The application further provides a SNP molecular marker for identifying a promoter haplotype of a chloride channel protein coding gene GmSALT9 The SNP molecular marker is located at 858 upstream of a start codon ATG of a promoter of a Glyma.09g157900 gene of soybean, and a T / A polymorphism exists. The Glyma.09g157900 gene of the application is located at chromosome 9 of a soybean genome Wm82.a2.v1; and the SNP molecular marker corresponds to a nucleotide T or A at a site 38117239 of chromosome 9 of the soybean genome Wm82.a2.v1.

[0021] The application further provides a primer pair for identifying the SNP molecular marker.

[0022] As an implementation form, the primer pair of the application comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 5. The nucleotide sequence shown in SEQ ID NO. 4 of the application is specifically 5'-GACGGTGGAGTTGGCCATTA-3'; and the nucleotide sequence shown in SEQ ID NO. 5 of the application is specifically 5'-CCGCCGGTTGGTGTCATCAT-3'.

[0023] The application further provides a kit comprising the primer pair. As an implementation form, the kit of the application further comprises reagents for PCR amplification and / or reagents for cloning and sequencing of a PCR product. As an implementation form, the kit of the application further comprises reagents for agarose acylamide gel electrophoresis detection. As an implementation form, the kit of the application can detect the SNP site.

[0024] The application further provides a method for identifying salt tolerance of soybean, comprising the following steps: PCR amplification is performed on a genomic DNA of the soybean to be tested by using a primer pair with a nucleotide sequence as shown in SEQ ID NO. 4 and SEQ ID NO. 5 as a template to obtain an amplification product; The genotype of the amplification product is detected, and when the amplification product contains a nucleotide sequence as shown in SEQ ID NO. 2, it indicates that the soybean has high salt tolerance; When the amplification product contains a nucleotide sequence as shown in SEQ ID NO. 3, it indicates that the soybean is sensitive to salt.

[0025] As an embodiment, the genomic DNA of the soybean to be detected is extracted from the leaves of the sample to be detected.

[0026] As an embodiment, the total volume of the PCR amplification reaction is 20 μL, including 2 μL of DNA liquid, 10 μL of 2x Rapid Taq Master Mix (Vazyme Biotech Co., Ltd.), 0.5 μL of each of the upstream and downstream primers (10 μM), and 7 μL of deionized water. As an embodiment, the reaction program of the PCR amplification is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing and recombination at 55℃ for 15 s, extension at 72℃ for 30 s, repeating the above steps for 34 cycles; terminal extension at 72℃ for 5 min; and storage at 12℃.

[0027] After obtaining the amplification product, the genotype of the amplification product is detected. When the amplification product contains the nucleotide sequence as shown in SEQ ID NO. 2, it indicates that the soybean has high salt tolerance; when the amplification product contains the nucleotide sequence as shown in SEQ ID NO. 3, it indicates that the soybean is sensitive to salt. As an embodiment, the detection of the genotype of the amplification product includes cloning sequencing and / or agarose acylamide gel electrophoresis detection of the obtained amplification product.

[0028] The application also provides the SNP molecular marker, the primer pair, and the kit, and the application of the above technical solutions in identifying or improving the salt tolerance of soybeans and / or in soybean assisted breeding. As an embodiment, the soybean assisted breeding includes screening or cultivating new soybean varieties with salt tolerance. As an embodiment, the application can determine the salt tolerance of soybeans according to the promoter haplotype of the chloride channel protein coding gene GmSALT9 . When the promoter haplotype of the chloride channel protein coding gene GmSALT9 is the TT type as shown in SEQ ID NO. 2, it indicates that the soybean to be detected has high salt tolerance; when the promoter haplotype of the chloride channel protein coding gene GmSALT9 is the AA type as shown in SEQ ID NO. 3, it indicates that the soybean to be detected is sensitive to salt. As an embodiment, the application provides the significant association between the chloride channel protein coding gene GmSALT9 and the salt tolerance of soybeans, which has important research value and application prospect in improving the salt tolerance of soybeans and cultivating new soybean varieties with salt tolerance.

[0029] The application also provides a method for breeding salt-tolerant soybeans, comprising the following steps: The SNP molecular marker, the primer pair or the kit are used for screening salt-tolerant soybeans as parents for breeding or selecting salt-tolerant soybeans in the offspring.

[0030] In order to further illustrate the application, the chlorion channel protein coding gene provided by the application is described in detail below in combination with the accompanying drawings and examples. GmSALT9 The application is described in detail in the identification of salt-tolerant soybeans, but they cannot be understood as limiting the scope of protection of the application.

[0031] Example 1 Soybean salt tolerance trait association determination and whole genome association analysis 1. Salt tolerance phenotype identification A natural population of 266 soybean cultivars was used as test material, and salt tolerance identification was carried out under a rain-sheltered shed in 2020, 3 biological replicates were set for each material, 10 uniform and full soybean seeds were sown in 8cmx8cmx8cm seedling pots filled with vermiculite, the sowing depth was 2cm, 24 seedling pots were placed in each water tank, and 4.8L water was injected into each water tank after sowing and covering.

[0032] Wait for the seeds to germinate normally, 4 days after sowing, the cotyledons will be fully unfolded and the seedlings will be thinned, 4-6 seedlings will be left in each pot, and 2L water will be poured in each water tank. When the true leaves are fully unfolded, 200mM NaCl treatment is carried out, the second salt treatment is carried out 2 days later, and the salt tolerance grade is investigated after 2 times of salt treatment, and the salt tolerance grade is marked as follows: Grade 1: healthy green leaves, no obvious wilting of leaves; Grade 2: the plant has a slight yellowing of the two true leaves; Grade 3: the plant has a moderate degree of necrosis, and the first set of three leaves is slightly yellow; Grade 4: the plant has a serious degree of necrosis, and more than 30% of the leaves have turned yellow; Grade 5: the plant is dead and wilting.

[0033] Among them, if the salt tolerance grade of the material is 1-2, it is classified as salt-tolerant material; if the salt tolerance grade of the material is 3-5, it is classified as salt-sensitive material.

[0034] 2. Physiological index determination The salt tolerance of different materials was characterized by aboveground dry weight, SPAD value, and aboveground sodium, potassium, and chlorine ion content. The SPAD value and aboveground dry weight of salt-tolerant materials were higher than those of salt-sensitive materials, the aboveground sodium and chlorine ion content of salt-tolerant materials was lower than that of salt-sensitive materials, the aboveground sodium and potassium ion ratio of salt-tolerant materials was lower than that of salt-sensitive materials, and the salt tolerance grade of salt-tolerant materials was lower than that of salt-sensitive materials.

[0035] ① Determination of SPAD value: Aboveground tissues were collected, and dry weight, aboveground sodium, potassium, and chlorine ion content were determined.

[0036] The SPAD value of each variety after salt treatment was determined using a handheld chlorophyll meter SPAD-502 (Konica Minolta, Inc., Osaka, Japan). Each biological replicate contained 5 single plants, and the SPAD value of each single plant was determined 3 times at the same position of the true leaf, with the average value representing the SPAD value of the single plant. The average value of 3 biological replicates of each variety represented the SPAD value of the material.

[0037] After the SPAD value was determined, the aboveground tissues of 5 single plants were cut from each biological replicate and placed in kraft paper bags. Each variety had 3 biological replicates.

[0038] ② Determination of aboveground dry weight: The aboveground tissue samples were continuously dried in a constant temperature oven at 72°C for 72h, and the aboveground dry weight of each material was determined. The average value of 3 biological replicates represented the dry weight of the sample.

[0039] ③ Determination of ion content: The aboveground tissues of each material above the cotyledon node were cut into kraft paper bags and dried at 72°C for 72h. The dry weight of each dried aboveground tissue sample was weighed, and then ground into powder using a plant tissue grinder. 0.1g of powder was placed in a 15mL centrifuge tube, 10mM HAc solution was added, and the ion extraction solution was extracted in a 200r / min 90°C water bath shaker for 3h. The ion extraction solution was filtered through a filter membrane before being detected. The Na + , K + content was determined using M420 (Sherwood) flame photometer, and the Cl⁻ content was determined using M926 (Sherwood) chlorine ion meter. The average value of 3 biological replicates represented the ion content of the sample, with the unit of mg / g. The Na + , K + , Cl - content is represented by Na + , K + , Cl - in the subsequent description.

[0040] Microsoft Office Excel 2019 was used for data processing and plotting. SPSS 4.0 was used for descriptive statistical analysis and significance analysis, and Prism 7.0 and R 4.10 were used for significance analysis and plotting. The descriptive statistical results of salt tolerance traits are shown in Table 1, and the frequency distribution histogram of salt tolerance traits is shown in the figure below. Figure 1 As shown in Table 1 and... Figure 1 The results show that all measured salt tolerance traits conform to a normal distribution. Therefore, K is selected. + / Na + The other 7 traits were then subjected to subsequent association analysis.

[0041] Table 1. Descriptive statistics of salt tolerance traits

[0042] Note: ** indicates P <0.01 significance level.

[0043] 3. SNP genotyping and GWAS analysis DNA was extracted from leaves of 10 plants from each soybean sample. DNA quality was assessed using a Nanodrop ND-200 (ThermoFisher Scientific Inc., Waltham, MA) and 1% agarose gel electrophoresis, and the genomic DNA concentration was adjusted to 50 ng / L. All samples were incubated at 37°C for 20–24 h for whole-genome amplification. The DNA was then fragmented, precipitated, and resuspended in hybridization buffer. The resuspended DNA fragments were loaded onto the "Zhongdouxin No. 1" microarray (SNP microarray detection was outsourced to Beijing Compass Agritechnology Co., Ltd., Beijing, China) and incubated at 48°C for 16–24 h for hybridization. Non-specifically bound DNA was removed by washing, and specific binding sites were retained for single-base extension. After staining, the microarray hybridized with the genomic DNA was scanned using an Illumina iScan Reader, yielding genotypic data containing 266 samples and 159,078 SNPs.

[0044] The original data was quality controlled by Plink 1.90 software, and the filtering parameters were set as maf 0.05, mind 0.1, geno 0.1, allele frequency greater than 0.05, less than 10% of samples and sites missing, and scaffold removed. The genotype data and 7 salt tolerance related traits were filled by TASSEL5.0. A set of genotype data containing 258 samples and 84,839 SNPs and 7 salt tolerance related traits were used to perform whole genome association analysis (GWAS). The MLM model of GAPIT software was used for association analysis. The significant SNP threshold was determined by Bonferroni correction: P≤1 / 84,839=1.18×10 -5 or -log(P)≥4.93.

[0045] The candidate interval was determined according to the physical position of the boundary SNP of the linkage disequilibrium block (LD block), the functional annotation of the candidate gene in the interval was queried in SoyBase (https: / / www.soybase.org / ), and the candidate gene was predicted according to the annotation. The sequence variation of the candidate gene was analyzed combined with the resequencing data of the laboratory, and the candidate gene association analysis was performed combined with the resequencing data and the expression of transcriptome sequencing, and the SNP significantly related to the expression of the candidate gene was found.

[0046] Combined with the filtered high-quality genotype data and 7 soybean seedling salt tolerance trait values, the MLM model with the best fitting result of QQ-plot in GAPIT software was used to perform whole genome association analysis on each trait. Taking 84,839 SNPs as a reference, the significant threshold was determined by 1% Bonferroni correction as 4.93, and the significant SNPs with -log(P)>4.93 were screened. On Chr.09, 28 SNPs significantly related to Na + ( Figure 2 and Na + / K + ( Figure 2 were detected, and 28 significant SNPs were listed in Table 2. It was indicated that there was a new salt tolerance site on Chr.09 which played a role in the grown variety population, and the new salt tolerance site was named as ST9.

[0047] Table 2 SNPs significantly related to salt tolerance traits

[0048] Example 2 Promoter variation and gene expression association analysis 1. Candidate gene promoter analysis The Glyma.09g157900 promoter region sequence was downloaded from the SoyBase (https: / / www.soybase.org / ) database according to the Wm82.a2.v1 reference genome sequence, and the cis-acting elements in the promoter region (38,117,234~38,117,240, TCTCTTA) were predicted online using the Plantcare (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) website. In addition, primers were designed: GmSALT9 -pro-F (5'-3'): GACGGTGGAGTTGGCCATTA (SEQ ID NO. 4); GmSALT9 -pro-R (5'-3'): CCGCCGGTTGGTGTCATCAT (SEQ ID NO. 5).

[0049] The Glyma.09g157900 promoter was amplified. The PCR product was 1406 bp in size. The variations in the promoter of the candidate gene in 266 soybean varieties used for association analysis were determined by Sanger sequencing.

[0050] 2. Transcriptome sequencing analysis The leaf of 26 soybean materials as shown in Table 3 and 605 soybean materials as shown in the article (LI D, WANG Q, TIAN Y, LYV X, ZHANG H, HONG H, GAO H, LI Y F, ZHAO C, WANG J, WANG R, YANG J, LIU B, SCHNABLE PS, SCHNABLE J C, LI Y H, QIU L J, 2024. TWAS facilitates gene-scale trait genetic dissection through gene expression, structural variations, and alternative splicing in soybean. Plant Communications, 5(10): 101010. DOI:10.1016 / j.xplc.2024.101010.) were subjected to transcriptome sequencing analysis, and the expression of GmSALT9 affected by the SNP variation in the promoter was obtained as shown in Figure 3 The specific steps are as follows: Leaf tissue was collected, wrapped in aluminum foil, and flash-frozen in liquid nitrogen for preservation. Five samples constituted one biological replicate. RNA was extracted and quality-checked by Biomarker Technologies Co., Ltd. (Beijing, China). RNA libraries were constructed, and paired-end sequencing (300 bp reads) was performed using the Illumina Hiseq high-throughput sequencing platform. The clean data for each sample reached 6.26 Gb. Clean reads from each sample were aligned with a specified reference genome. Differentially expressed genes (DEGs) were selected based on a Fold Change ≥ 1.5 and a P-value < 0.01.

[0051] 3. Results of Association Analysis Extract Coverage GmSALT9 Forty-two SNPs with maf > 0.05 within the full-length gene and the 2000bp promoter region were analyzed in leaves. GmSALT9 The relationship between expression levels and 42 SNPs.

[0052] Analysis of 631 soybean samples obtained through transcriptome sequencing revealed that only the -858 T>A variant in the promoter region was consistent with... GmSALT9 The FPKM value was significantly correlated, indicating that this variation had an impact. GmSALT9 Key SNPs for expression variation. Among 631 soybean materials, the TT type (n=377) was... GmSALT9 The expression level of this type was significantly higher than that of type AA (n=254).

[0053] Table 3 Information on soybean materials from transcription sequencing

[0054] Example 3 Haplotype Salt Tolerance Verification Using the primer set designed in Example 2 ( GmSALT9 -pro-F and GmSALT9 Four types of TT-type soybeans (19QS101: Jinong 28, 19QS190: Shanning 23, 19QS195: Xingdou 571, 19QS231: Nannong 59) were identified using the -pro-R method; four types of AA-type soybeans (19QS174: Andou 115, 19QS250: Nannong 54, 19QS269: Huaxia 21, 19QS271: Huaxia 25) were also identified. The above eight materials (e.g., ...) were sown according to the method in Example 1. Figure 4 (as shown in b in the image), and then proceed with the subsequent steps. GmSALT9 Expression level detection and salt tolerance phenotype detection.

[0055] 1. Gene expression verification Based on the Wm82.a2.v1 reference genome, a pair of primers were designed on exon 6 of the Glyma.09g157900 gene: Glyma.09g157900-qPCR-F (5'~3'): AAACGATTACCGAACTCGACAG (SEQ ID NO.6) and Glyma.09g157900-qPCR-R (5'~3'): GAAGCTGTCAGCCACGGATT (SEQ ID NO.7).

[0056] Four samples each of the TT type (Jinong 28, Shanning 23, Xingdou 571, Nannong 59) and AA type (Andou 115, Nannong 54, Huaxia 21, Huaxia 25) were selected and subjected to salt stress treatment in the same manner as the salt tolerance phenotype identification section in Example 1. The salt stress before and after salt stress was measured at 0h, 6h, 12h, and 24h. GmSALT9 Expression level, obtained GmSALT9 The expression levels are shown in Table 4 and Figure 4 As shown in 'a'.

[0057] Table 4 GmSALT9 expression level

[0058] 2. Verification of salt tolerance phenotype The salt tolerance level and physiological indicators (Na⁺, K⁺, Cl⁻, SPAD, DW) of the above 8 materials were identified according to the method in Example 1. The results of the salt tolerance indicators of the 8 materials (TT and AA type materials) are shown in Table 5. Figure 5 As shown.

[0059] Table 5 Salt resistance index of TT and AA type materials

[0060] Combining Table 4 and Table 5, and Figure 4 , Figure 5 The results shown indicate that... GmSALT9 TT-type varieties were continuously induced by salt stress, both before and after salt treatment. GmSALT9 The expression of Na+ was consistently higher in the TT-type varieties than in the AA-type varieties. Furthermore, it was found that the salt tolerance of the TT-type varieties was superior to that of the AA-type varieties; the Na+ expression in the aboveground tissues of the four TT-type varieties was significantly higher. + Na + / K + And Cl⁻, and its salt tolerance level is significantly lower than that of the four AA-type varieties, K + There were no significant differences between the two types of varieties for SPAD and DW.

[0061] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Chloride channel protein encoding gene GmSALT9 Its application in identifying the salt tolerance of soybeans is characterized by... The chloride ion channel protein encoding gene GmSALT9 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, According to the chloride ion channel protein encoding gene GmSALT9 Promoter haplotype was used to determine the salt tolerance of soybeans; The GmSALT9 The promoter haplotypes include the TT type salt-tolerant haplotype promoter sequence as shown in SEQ ID NO.2 or the AA type salt-sensitive haplotype promoter sequence as shown in SEQ ID NO.

3.

3. A method for identifying the gene encoding chloride ion channel protein. GmSALT9 The promoter haplotype SNP molecular marker, characterized in that, The SNP molecular marker is located 858 bp upstream of the start codon ATG in the promoter of the soybean Glyma.09g157900 gene, and exhibits T / A polymorphism.

4. Identify the primer pairs of the SNP molecular marker described in claim 3.

5. The primer pair according to claim 4, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

5.

6. A kit comprising the primer pair of claim 4 or 5.

7. A method for identifying the salt tolerance of soybeans, characterized in that, The method includes the following steps: Using the genomic DNA of the soybean to be tested as a template, PCR amplification was performed on the template using primers with nucleotide sequences as shown in SEQ ID NO.4 and SEQ ID NO.5 to obtain the amplification product; The genotype of the amplification product was detected. When the amplification product contained the nucleotide sequence shown in SEQ ID NO.2, it indicated that the soybean had high salt tolerance. When the amplification product contains a nucleotide sequence as shown in SEQ ID NO.3, it indicates that soybeans are sensitive to salt.

8. The use of the SNP molecular marker of claim 3, the primer pair of claim 4 or 5, or the kit of claim 6 in identifying or improving soybean salt tolerance and / or soybean assisted breeding.

9. The application according to claim 8, characterized in that, The soybean assisted breeding includes screening or breeding new salt-tolerant soybean varieties.

10. A method for cultivating salt-tolerant soybeans, characterized in that, The method includes the following steps: Salt-tolerant soybeans can be screened as parents for breeding using the SNP molecular markers described in claim 3, the primer pairs described in claim 4 or 5, or the kit described in claim 6, or salt-tolerant soybeans can be selected from the offspring of the breeding.

Images