Application of SNP (Single Nucleotide Polymorphism) molecular marker located on pig No.18 chromosome and related to backfat thickness

Abstract

The invention discloses application of an SNP molecular marker located on a pig 18 # chromosome and related to backfat thickness, the site of the SNP molecular marker is rs322184970 and corresponds to the 10571465 bp site on the 18 # chromosome of the international pig reference genome 11.1 version, and C gt exists at the site; t mutation. The SNP molecular marker provided by the invention is remarkably related to the backfat thickness character of the pig, the identification of the backfat thickness character of the pig can be realized by detecting the SNP molecular marker, and the dominant allele frequency can be increased generation by generation, the backfat thickness of the pig can be reduced and the lean meat percentage can be indirectly improved by breeding the pig with the genotype of the SNP molecular marker TT. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of SNP molecular markers located on chromosome 18 of pigs that are related to backfat thickness. Background Technology

[0002] Currently, pig breeding focuses primarily on large-weight, lean-type pigs, with the core breeding objective being lean-type breeding pigs suitable for large-weight market weight. Backfat thickness, as a key indicator of lean meat percentage in pigs, plays a crucial guiding role in the selection and retention of large-weight, lean-type pigs. In actual production, individuals with thinner backfat thickness typically exhibit superior carcass quality, higher lean meat percentage, and better economic benefits. For a long time, breeders have focused on reducing backfat thickness and increasing lean meat yield through traditional selection methods. However, backfat thickness is a typical complex quantitative trait, regulated by multiple genes. Furthermore, this trait can only be accurately measured at specific age stages, making early selection impossible, resulting in a long breeding cycle and slow genetic progress. Summary of the Invention

[0003] The purpose of this invention is to provide a SNP molecular marker located on chromosome 18 of pigs that is related to backfat thickness in pigs and its application.

[0004] According to one aspect of the present invention, a SNP molecular marker associated with backfat thickness is provided on chromosome 18 of pigs, at the site rs322184970, corresponding to position 10571465 bp on chromosome 18 of the International Pig Reference Genome 11.1. This site contains a C>T mutation, the nucleotide type of which is C or T, and the genotype of the SNP molecular marker is TT, CT, or TT.

[0005] The SNP molecular marker provided by this invention is significantly correlated with the backfat thickness trait in pigs, mainly manifested in the fact that pigs with the TT genotype have a smaller backfat thickness than pigs with the TC or CC genotypes. Backfat thickness is an important indicator for selecting lean-type pigs for breeding. In actual production, pigs with lower backfat thickness have a higher lean meat percentage at market and better economic benefits. By detecting this SNP molecular marker, specifically by detecting the single nucleotide polymorphism and / or genotype of rs322184970, the backfat thickness trait in pigs can be identified. Furthermore, by selecting pigs with the TT genotype of this SNP molecular marker, the breeding process can be accelerated, achieving genetic improvement in pigs.

[0006] Therefore, the SNP molecular marker located on pig chromosome 18 and associated with backfat thickness provided by this invention can be applied to: (1) Identify the backfat thickness of pigs; (2) Prepare products for identifying the backfat thickness trait of pigs; (3) Pig genetic improvement: Based on the selection of pigs with the SNP molecular marker genotype TT to reduce the backfat thickness of pigs, thus achieving pig genetic improvement; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0007] According to another aspect of the invention, an application is provided for a product for detecting SNP molecular markers located on porcine chromosome 18 that are associated with backfat thickness, the application comprising at least one of the following (1) to (4): (1) Identify the backfat thickness of pigs; (2) Prepare products for identifying the backfat thickness trait of pigs; (3) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype TT to reduce the backfat thickness of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0008] In some embodiments, products for detecting SNP molecular markers on porcine chromosome 18 that are associated with backfat thickness may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers on porcine chromosome 18 that are associated with backfat thickness.

[0009] In some embodiments, the reagents for detecting SNP molecular markers related to backfat thickness located on pig chromosome 18 may include at least one of the following: primers or probes for detecting SNP molecular markers related to backfat thickness located on pig chromosome 18.

[0010] In some embodiments, the primers used to detect SNP molecular markers related to backfat thickness on pig chromosome 18 include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify an amplified fragment containing the single nucleotide polymorphism at position 110 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1. This can be used to identify whether the single nucleotide at position 11 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1 is T or C.

[0011] In some embodiments, the kit for detecting SNP molecular markers associated with backfat thickness located on porcine chromosome 18 may include: primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, dNTPs, DNA polymerase, and Mg2+. 2+Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0012] In some implementations, the pigs are Duroc × Landrace × Large White three-way crossbred pigs, i.e., Duroc × Landrace × Large White three-way crossbred pigs.

[0013] According to another aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular marker rs322184970 located on chromosome 18 of pigs and associated with backfat thickness; (2) Select individuals with the SNP molecular marker genotype TT and eliminate individuals with the genotypes TC and CC. Increase the frequency of the allele T at this locus generation by generation, thereby reducing the backfat thickness of the core breeding pig population.

[0014] By genetically improving the backfat thickness trait of breeding pigs, the genetic advantage of backfat thickness can be efficiently transferred to commercial pig herds, significantly improving the carcass quality and market competitiveness of commercial pigs, and creating greater economic benefits for breeding enterprises.

[0015] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0016] In some implementations, in step (1), the breeding pig is a Duroc-Landrace-Landrace-Landrace-Landrace-Handcross hybrid.

[0017] In some implementations, step (1), determining the genotype of the SNP molecular marker on chromosome 18 of the pig that is associated with backfat thickness, includes the following steps: Whole-genome DNA was extracted from breeding pigs, and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the genotype of the SNP molecular markers related to backfat thickness on chromosome 18 of the pigs was determined based on the sequencing results.

[0018] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a SNP molecular marker located on the nucleotide sequence of pig chromosome 18 that is related to backfat thickness in pigs. The SNP molecular marker is located at rs322184970, and its effect on the backfat thickness trait in pigs has been verified. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the backfat thickness trait in pigs, improve the breeding process of Duroc-Landrace-Large White crossbred pigs, meet the needs of the breeding pig market, increase the price of breeding pigs, reduce breeding costs for enterprises, and improve their core competitiveness. By optimizing the dominant allele of this SNP, the frequency of the dominant allele can be increased generation by generation, thereby reducing the backfat thickness of breeding pigs and indirectly increasing the lean meat percentage, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of breeding pigs.

[0019] (2) This invention provides a primer pair that can be used to identify SNP molecular markers located on chromosome 18 of pigs that affect backfat thickness. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established, enabling rapid and accurate selection of traits and accelerating the breeding process. When applied to the genetic improvement program for backfat thickness in pigs, it can significantly reduce backfat thickness, thereby increasing the profits of breeding enterprises and enhancing their core competitiveness.

[0020] (3) This invention provides a method for genetic improvement of pigs based on SNP molecular markers located on chromosome 18 of pigs that affect backfat thickness. By establishing efficient and accurate molecular marker-assisted breeding technology, the genetic progress of terminal parents such as Duroc, Large White and Landrace pigs in the Duroc, Large White and Landrace commercial pig production system can be accelerated and the generation interval can be shortened. Attached Figure Description

[0021] Figure 1 Genome-wide association study (GWAS) of backfat thickness in Duroc-Landrace-Large White crossbred pigs on chromosome 18; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value; Figure 2 This is a graph showing the phenotypic ratios of backfat thickness in pigs of different genotypes; among them, * express P <0.05, *** express P <0.001. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0023] Example 1: Identification and Verification of SNP Loci Related to Backfat Thickness in Pigs (1) Experimental pig herd The experimental pig population used in this invention consisted of 1496 Duroc-Landrace-Large White crossbred pigs from the breeding pig division of Guangdong Wens Food Group Co., Ltd. The pedigree of the population was recorded in detail. The pigs had free access to feed and water, and the feeding method and rearing conditions were kept consistent throughout the entire process, which is a conventional method.

[0024] (2) Phenotypic measurement The method for measuring backfat thickness is as follows: When the live weight of Duroc-Landrace-Large White crossbred pigs reaches 100±5 kg, the live backfat thickness of the pigs is measured at the 10th to 11th intercostal space in the clockwise direction using an AlokaSSD-500V ultrasound machine (Corometrics Medical Systems, USA).

[0025] (3) Extraction of porcine genomic DNA The tail and ear tissues of the 1496 Duroc-Landrace-Landrace-Large White crossbred piglets were collected and soaked in a 75% ethanol solution, then stored at -20°C for later use.

[0026] Ear or tail tissues from each Duroc-Landrace-Large White crossbred pig were collected to extract whole-genome DNA using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150 V for 25 min, and the DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device. The DNA samples were then sent to Neocate Biotechnology (Shanghai) Co., Ltd. for next-generation sequencing according to the company's standard procedures. The sequencing results were in FADTQ format.

[0027] (4) Pig whole genome genotyping First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate the reads of the FASTQ data onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, the HaplotypeCaller and VariantFiltration functions of GATK v4.0.2.1 software were used to perform genotyping and quality control on the SNPs. Fifth, PLINK software was used to further control the quality of the obtained population genotype data, removing SNPs with an individual detection rate of less than 90%, a family Mendelian error rate of more than 0.1, and a minimum allele frequency of less than 0.05, ultimately obtaining valid genotype data for 38,136,159 SNPs.

[0028] (5) Genome-wide association analysis (GWAS) To eliminate the population stratification effect, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes the similarity of genomes among individuals to correct for the stratification effect. Given the assumption that the number of independent haplotype frames (ISFFs) is substantially the same in pigs and humans, this study, referencing the significance threshold in the human genome, sets the significance threshold for the association between SNPs and backfat thickness traits to 1 × 10⁻⁶. -6 .

[0029] GWAS analysis results are as follows Figure 1 As shown.

[0030] from Figure 1 It is known that in Duroc-Landrace-Landrace-Large White crossbred pigs, there is a locus on chromosome 18 that significantly affects backfat thickness, with the strongest associated SNP being g.10571465C>T ( P = 1.49×10 -8 (The 110th nucleotide in SEQ NO.1 corresponds to the C>T mutation at position 10571465 on chromosome 18 in International Pig Reference Genome Version 11.1, and the SNP site is rs322184970).

[0031] (6) Analyze the association between different genotypes and backfat thickness phenotype to verify the effect of SNP loci on backfat thickness traits in pigs. The results are shown in Table 1. Figure 2 As shown, the SNP site g.10571465 C>T of the molecular marker was significantly correlated with the backfat thickness trait. PThe value <0.001 indicates that this molecular marker significantly affects backfat thickness in pigs. Assisted selection at this SNP locus can reduce backfat thickness in the pig population, thereby accelerating the breeding process of lean-type pigs. Specifically, pigs with the TT genotype have smaller backfat thickness than those with the TC or CC genotypes, indicating that homozygous TT is beneficial for backfat thickness in breeding pigs. Backfat thickness is an important indicator for selecting and retaining lean-type pigs. In actual production, pigs with lower backfat thickness have a higher lean meat percentage at market and better economic benefits. Therefore, TC and CC genotype pigs are not conducive to the breeding goal of large-weight lean-type pigs for market. During the breeding process, it is necessary to gradually eliminate TC and CC genotype pigs and retain TT genotype pigs to increase the frequency of the T allele at this locus through successive generations.

[0032] Table 1. Correlation analysis of SNP site g.10571465 C>T with backfat thickness trait.

[0033] (7) Effect analysis This invention provides a SNP molecular marker that can significantly reduce backfat thickness in pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process for improved backfat thickness in pigs. As shown in Table 1, the frequency of the dominant allele T at the SNP locus g.10571465C>T is 0.517 in the population. Therefore, by using marker-assisted selection to gradually eliminate pigs with genotypes TC and CC within the population, the allele frequency of allele T can be significantly increased, reducing backfat thickness in breeding pigs, indirectly increasing lean meat percentage, accelerating the improvement of lean-type pigs, and thus effectively improving the economic benefits of pig breeding.

[0034] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP loci significantly associated with the backfat thickness trait of Duroc-Landrace-Large White crossbred pigs is a 250 bp nucleotide sequence from chromosome 18, the specific sequence of which is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0035] SEQ ID NO:1 ACGGGAACTCTTGGTCGTATTTTATGGTAGACTTAAAAAGAATACTGTAAAGATGGAGTTCCCGTCGTGGCGCAGTGGTTAACGAATCCGACTAGGAACCATGAGGTTG YGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAACGATCCGGCATTGCCGTGAGCTGTGGTGTAGGTTGCAGGCGGTTCCCGAGTTGCTGTGGCTCTGGTGTAGGCTGGTGGCTACAGCTCCCATTAGACCCCTAGCCT The Y marked in the sequence is the mutation site, which is C or T, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0036] Upstream primer-F: 5'-ACGGAACTCTTGGTCGTAT-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-AGGCTAGGGGTCTAATGGGA-3' (SEQ ID NO:3).

[0037] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of SNP molecular markers related to backfat thickness in pigs. (1) Take piglet tail or ear tissue, extract the whole genome DNA of pigs according to the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0038] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0039] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0040] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were measured in both forward and reverse reactions. Based on the sequencing results, the genotype of the pig SNP site g.10571465 C>T was determined.

[0041] S2. Select pigs with the genotype TT at the SNP locus as parents for breeding, and increase the frequency of the allele T at this locus generation by generation.

[0042] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers located on porcine chromosome 18 that are associated with backfat thickness, characterized in that, The SNP molecular marker site is rs322184970, and the application includes at least one of the following items (1) to (4): (1) Identify the backfat thickness of pigs; (2) Prepare products for identifying the backfat thickness trait of pigs; (3) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype TT to reduce the backfat thickness of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers located on pig chromosome 18 that are related to backfat thickness includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pigs in question are Duroc-Landrace-Large White crossbred pigs.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 18 of pigs that are associated with backfat thickness; (2) Select individuals with the SNP molecular marker genotype TT and eliminate individuals with the genotypes TC and CC; The site of the SNP molecular marker is rs322184970.

7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular marker located on chromosome 18 of pigs that is related to backfat thickness includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplification products were sequenced, and the genotype of the SNP molecular markers related to backfat thickness on pig chromosome 18 was determined based on the sequencing results.

8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pigs in question are Duroc-Landrace-Large White crossbred pigs.

Images