A primer probe combination, kit for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof

Abstract

The application discloses a primer probe combination, a kit and application thereof for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus. The primer probe combination is composed of a first primer probe group for detecting African swine fever virus, a second primer probe group for detecting porcine epidemic diarrhea virus and a third primer probe group for detecting porcine reproductive and respiratory syndrome virus. The primer probe combination for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus has high sensitivity and good specificity, and can be effectively used for detecting African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer-probe combination, kit, and application for the simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus. Background Technology

[0002] African swine fever (ASF) is a highly contagious and deadly disease of pigs caused by the African swine fever virus (ASFV). ASFV is an enveloped, single-molecule, linear, double-stranded DNA virus with a genome length of approximately 170kb–193kb. ASF is characterized by high morbidity and mortality rates, resulting in enormous economic losses. Currently, there is a lack of effective vaccines and specific treatments, making ASF one of the most serious diseases threatening the pig farming industry.

[0003] Diarrhea is a major cause of piglet mortality in intensive pig farms, and porcine epidemic diarrhea (PED), caused by porcine epidemic diarrhea virus (PEDV), is the leading cause. PED is a highly contagious intestinal disease characterized by vomiting, watery diarrhea, and dehydration. It has a rapid onset, spreads quickly, has a high mortality rate, can occur year-round but is more prevalent in winter and spring, and vaccine control is not ideal. Medium and large pigs show mild symptoms but can carry and shed the virus for extended periods; recovered pigs can shed the virus for up to two months.

[0004] Porcine reproductive and respiratory syndrome (PRRS) is a common infectious disease of pigs caused by Porcine reproductive and respiratory syndrome virus (PRRSV). It primarily manifests as reproductive disorders in pregnant sows, such as abortion, stillbirth, and mummified fetuses. Piglets and finishing pigs develop respiratory diseases. The disease has a significant impact on piglets, clinically presenting with pneumonia, slow growth, and increased mortality. Clinically, this disease also presents with cyanosis of the ear skin, hence the name "blue ear disease."

[0005] RT-PCR is widely used for detecting pig-related diseases due to its advantages of speed, high sensitivity, and good specificity compared to other pathogen detection methods. Although there are kits for single detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus, the operation is cumbersome, costly, and has low sensitivity. There is an urgent need to develop a kit that can simultaneously detect African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus. Summary of the Invention

[0006] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a primer-probe combination for the simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus.

[0007] The present invention also proposes a kit having the above-described primer-probe combination.

[0008] This invention also proposes applications of the above-mentioned primer-probe combination and kit.

[0009] The present invention also provides a system for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus.

[0010] According to one aspect of the present invention, a primer-probe combination for simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus is provided, the primer-probe combination comprising a first primer-probe set for detecting African swine fever virus, a second primer-probe set for detecting porcine epidemic diarrhea virus, and a third primer-probe set for detecting porcine reproductive and respiratory syndrome virus.

[0011] The first primer-probe set consists of primer sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 11 and probe sequences as shown in SEQ ID NO: 9;

[0012] The second primer-probe set consists of primer sequences as shown in SEQ ID NO: 12 and SEQ ID NO: 13 and probe sequences as shown in SEQ ID NO: 14;

[0013] The third primer-probe set consists of primer sequences as shown in SEQ ID NO: 33 and SEQ ID NO: 34 and probe sequences as shown in SEQ ID NO: 32.

[0014] In some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a fluorescence quenching group.

[0015] In some embodiments of the present invention, the probe sequences of the first primer-probe set, the second primer-probe set, and the third primer-probe set have different fluorescent groups.

[0016] In some embodiments of the present invention, the fluorescent group includes, but is not limited to, any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, VIC, and TET.

[0017] In some embodiments of the present invention, the fluorescence quenching group includes, but is not limited to, any one of super Quenther1, super Quenther2, Eclipse, BHQ, TAMRA, MGB, and Dabcyl.

[0018] According to a second aspect of the invention, a kit is provided containing the above-described primer-probe combination.

[0019] In some embodiments of the present invention, the kit further includes a real-time PCR reaction solution, which includes at least one of a stabilizer, an enhancer, a PCR amplification buffer, a Taq DNA polymerase, dNTPs, an RT enzyme, and a MgCl2 solution.

[0020] In some embodiments of the present invention, the at least one may include one, two, three, four, five, six, or seven types.

[0021] In some embodiments of the present invention, the PCR amplification buffer comprises 4× PCR buffer.

[0022] In some embodiments of the present invention, the enhancer includes proline. The proline enhancer can effectively improve the detection sensitivity of the PCR reaction.

[0023] In some embodiments of the present invention, the stabilizer includes bovine serum albumin.

[0024] In some embodiments of the present invention, the concentration of proline in the real-time PCR reaction solution is 10-40 mmol / L.

[0025] In some embodiments of the present invention, the concentration of proline in the real-time PCR reaction solution is 18-22 mmol / L.

[0026] In some embodiments of the present invention, the concentration of bovine serum albumin in the real-time PCR reaction solution is 0.05-0.5 mg / mL.

[0027] In some embodiments of the present invention, the concentration of bovine serum albumin in the real-time PCR reaction solution is 0.2-0.4 mg / mL.

[0028] In some embodiments of the present invention, the fluorescence quantitative PCR reaction solution contains proline and bovine serum albumin. By using proline and bovine serum albumin to prepare the reaction system, it can be effectively used to resist interference from physiological saline, heme, purified mucin and anhydrous ethanol, thereby improving the anti-interference effect and sensitivity of the PCR reaction.

[0029] In some embodiments of the present invention, the kit further includes at least one of a positive control and a negative control.

[0030] In some embodiments of the present invention, the positive control includes nucleic acid molecules of African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus; or a vector including the nucleic acid molecules.

[0031] In some embodiments of the present invention, the positive control includes a recombinant vector containing the sequence shown in SEQ ID NO: 39, a recombinant vector containing the sequence shown in SEQ ID NO: 40, a recombinant vector containing the sequence shown in SEQ ID NO: 41, and / or a composition containing the recombinant vector containing the sequence shown in SEQ ID NO: 39, the recombinant vector containing the sequence shown in SEQ ID NO: 40, and the recombinant vector containing the sequence shown in SEQ ID NO: 41.

[0032] In some embodiments of the present invention, the empty vector of the recombinant vector includes the pUC57 plasmid.

[0033] In a third aspect of the invention, the use of the above-described primer-probe combination and kit in the preparation of products for the detection or auxiliary detection of African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus is proposed.

[0034] In some embodiments of the present invention, the product is a reagent kit or a chip.

[0035] In some embodiments of the present invention, the product is used as follows: using the nucleic acid of the pig sample to be tested as a template, PCR amplification is performed using the above-mentioned primer-probe combination or kit to obtain the amplification product; the amplification product is then analyzed.

[0036] In some embodiments of the present invention, the reaction system used for PCR amplification is as follows: PCR buffer with a final concentration of 1×, upstream primer for detecting African swine fever virus with a final concentration of 0.2-0.4 μmol / L, downstream primer for detecting African swine fever virus with a final concentration of 0.2-0.4 μmol / L, probe for detecting African swine fever virus with a final concentration of 0.1-0.3 μmol / L, upstream primer for detecting porcine epidemic diarrhea virus with a final concentration of 0.2-0.4 μmol / L, downstream primer for detecting porcine epidemic diarrhea virus with a final concentration of 0.2-0.4 μmol / L, probe for detecting porcine epidemic diarrhea virus with a final concentration of 0.1-0.3 μmol / L, and downstream primer for detecting porcine epidemic diarrhea virus with a final concentration of 0.2-0.4 μmol / L. The following reagents are required: upstream primer for detecting porcine reproductive and respiratory syndrome virus (PRRSV), downstream primer for detecting PRSV with a final concentration of 0.2-0.4 μmol / L, probe for detecting PRSV with a final concentration of 0.1-0.3 μmol / L, dNTPs with a final concentration of 0.2-0.4 mmol / L, RT enzyme with a final concentration of 3-5 U / μL, Taq enzyme with a final concentration of 0.15-0.5 U / μL, MgCl2 with a final concentration of 10-15 mmol / L, proline with a final concentration of 10-40 mmol / L, bovine serum albumin with a final concentration of 0.05-0.5 mg / mL, and 4-6 µL of nucleic acid from the sample to be tested.

[0037] In some embodiments of the present invention, the concentration of proline is 18-22 mmol / L.

[0038] In some embodiments of the present invention, the concentration of bovine serum albumin is 0.2-0.4 mg / mL.

[0039] In some embodiments of the present invention, the PCR amplification reaction program is as follows: 52-57°C for 12-16 min, 94-96°C for 25-35 s; then enter the cycling stage: 93-96°C for 8-12 s, 58-62°C for 25-35 s, 40-50 cycles, and collect fluorescence data.

[0040] In some embodiments of the present invention, the analysis of the amplification products includes: statistically analyzing the Ct values ​​of the samples and interpreting the results; the interpretation of the results is as follows:

[0041] Positive: If the fluorescent signal of the fluorescent group of the probe used to detect African swine fever virus is detected in the FAM channel of the fluorescence detection channel, and the corresponding detection Ct value is ≤40, then the sample is reported as positive for African swine fever virus.

[0042] If the HEX / VIC channel of the fluorescence detection channel detects a fluorescent signal of the fluorescent group of the probe used to detect porcine epidemic diarrhea virus, and the corresponding detection Ct value is ≤40, then the sample is reported as positive for porcine epidemic diarrhea virus.

[0043] If the fluorescent signal of the fluorescent group of the probe used to detect porcine reproductive and respiratory syndrome virus is detected in the CY5 channel of the fluorescence detection channel, and the corresponding detection Ct value is ≤40, then the sample is reported as positive for porcine reproductive and respiratory syndrome virus.

[0044] Negative: If the fluorescent signal of the fluorophore of the probe used to detect African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus is not detected in the FAM, HEX / VIC and CY5 channels, and no Ct value is detected, the sample is reported as negative for African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus.

[0045] According to a fourth aspect of the present invention, a system for detecting African swine fever virus, porcine epidemic diarrhea virus, and / or porcine reproductive and respiratory syndrome virus is provided, the system comprising:

[0046] The amplification module is used to perform PCR amplification of the genomic nucleic acid of the pig sample to be tested using the above primer-probe combination or kit to obtain amplification products;

[0047] The results evaluation module is used to detect the amplification products and evaluate whether the pig sample to be tested is infected with African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus.

[0048] According to some embodiments of the present invention, the system further includes a nucleic acid template extraction module for extracting genomic nucleic acids from the sample to be tested.

[0049] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the primer-probe combination provided by the present invention for simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus has high sensitivity and good specificity, and can be effectively used for the detection of African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus. Attached Figure Description

[0050] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0051] Figure 1 This is a diagram showing the detection results of African swine fever virus primer-probe set 1 in an embodiment of the present invention;

[0052] Figure 2 This is a diagram showing the detection results of African swine fever virus primer-probe set 2 in an embodiment of the present invention;

[0053] Figure 3 This is a diagram showing the detection results of African swine fever virus primer-probe set 3 in an embodiment of the present invention;

[0054] Figure 4 This is a diagram showing the detection results of African swine fever virus primer and probe set 4 in this embodiment of the invention;

[0055] Figure 5 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 1 in an embodiment of the present invention;

[0056] Figure 6 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 2 in an embodiment of the present invention;

[0057] Figure 7 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 3 in this embodiment of the invention;

[0058] Figure 8 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 4 in this embodiment of the invention;

[0059] Figure 9 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 5 in this embodiment of the invention;

[0060] Figure 10 This is a diagram showing the detection results of porcine epidemic diarrhea virus primer and probe set 6 in this embodiment of the invention;

[0061] Figure 11 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 1 in an embodiment of the present invention;

[0062] Figure 12 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 2 in an embodiment of the present invention;

[0063] Figure 13 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 3 in an embodiment of the present invention;

[0064] Figure 14 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 4 in an embodiment of the present invention;

[0065] Figure 15 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 5 in an embodiment of the present invention;

[0066] Figure 16 This is a diagram showing the detection results of porcine reproductive and respiratory syndrome virus primer and probe set 6 in this embodiment of the invention;

[0067] Figure 17This is a typical result diagram of the combined detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus in an embodiment of the present invention. Detailed Implementation

[0068] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0069] Example 1: Design of primer-probe combination for simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus.

[0070] This embodiment prepared a primer-probe combination for simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus. The specific design and verification process is as follows:

[0071] 1. Primer and probe design

[0072] This invention involves extensive comparative analysis and selection of gene sequences from African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus. Then, using the bioinformatics software Oligo 7.60, suitable primer probes can be designed from the selected conserved gene regions. Through repeated data analysis, multiple primer probe pairs were screened. These multiple pairs were then comprehensively analyzed, ultimately resulting in primer probe sets 1-4 for detecting African swine fever virus, primer probe sets 1-6 for detecting porcine epidemic diarrhea virus, and primer probe sets 1-6 for detecting porcine reproductive and respiratory syndrome virus (sequences shown in Table 1).

[0073] Table 1

[0074]

[0075] 2. Optimization of primer and probe sets

[0076] Using the different groups of primer and probe sets designed in step (1) (primer and probe sets 1-4 for detecting African swine fever virus, primer and probe sets 1-6 for detecting porcine epidemic diarrhea virus, and primer and probe sets 1-6 for detecting porcine reproductive and respiratory syndrome virus), experiments were conducted to screen out the optimal primer and probe sets.

[0077] Synthesis of standard plasmids: Using pUC57 as the cloning vector, recombinant plasmids containing conserved sequences of African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus were synthesized. The plasmids were then artificially synthesized by Sangon Biotech Co., Ltd.

[0078] African swine fever virus target sequence 1941bp:

[0079]

[0080] Porcine epidemic diarrhea virus target sequence 765bp:

[0081] AGTCTTACATGCGAATTGACCCTCTCCCCAGTACTGTTATTGACGTATAAACGAAATATGTCTAACGGTTCTATTCCCGTTGATGAGGTGATTCAACACCTTAGAAACTGGAATTTCACATGGAATATCATACTGACGATACTACTTGTAGTGCTTCAGTATGGCCATTACAAGTACTCTGTGATCTTGTATGGTGTTAAGATGGCTATTCTATGGATACTTTGGCCTCTTGTGTTGGCACTGTCACTCTTTGACGCATGGGCTAGCTTTCAGGTCAACTGGGTCTTTTTCGCTTTCAGCATCCTTATGGCTTGCATCACTCTTATGCTGTGGATAATGTACTTTGTCAATAGCATTCGGTTGTGGCGCAGGACACATTCTTGGTGGTCCTTCAATCCTGAAACAGACGCGCTTCTCACTACTTCTGTGATGGGCCGACAGGTCTGCATTCCAGTGCTTGGAGCACCAACTGGTGTAACGCTAACACTCCTTAGTGGTACATTGCTTGTAGAGGGCTATAAGGTTGCTACTGGCGTACAGGTAAGTCAATTACCTAATTTCGTCACAGTCGCCAAGGCCACTACAACAATTGTCTACGGACGTGTTGGTCGTTCAGTCAATGCTTCATCTGGCACTGGTTGGGCTTTCTATGTACGGTCAAAACACGGCGACTACTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATAGTGAGAAAGTGCTTCATTTAGTCTAAACAGAAACTTTATGGCTTCTGTCAGCT (SEQ ID NO:40).

[0082] Porcine reproductive and respiratory syndrome virus target sequence 231bp:

[0083] TAAGTTACACTGTGGAGTTTAGTTTGCCGACGCATCATACTGTGCGTCTGATCCGCGCCACAGCATCACCCTCAGCATGATGGGCTGGCATTCTTGAGGCACCTCAGTGTTAGAATTGGAAGAATGTGTGGTGAATGGCACTGATTGACATTGTGCCTCTAAGTCACCTATTCAATTAGGGCGACCGTGTGGGGGTGAGATTTAATTGGCGAGAACCATGCGGCCGAAATT (SEQ ID NO:41).

[0084] The preparation steps of the detection template are as follows: (1) The original plasmid (specifically, plasmids containing target sequences of African swine fever virus, porcine epidemic diarrhea virus, or porcine reproductive and respiratory syndrome virus) is about 4µg / tube (dry powder state), add 400µL of 0.01%TE-SDS, shake to mix, and the liquid is used as the original plasmid (concentration is 1×10). -2 Use (µg / µL). (2) Take 10 µL of the original plasmid and add 990 µL of 0.01% TE-SDS, labeling it as 10⁻²; (3) Take 10 µL of plasmid with a concentration of 10⁻² and add 990 µL of 0.01% TE-SDS, labeling it as 10⁻⁴; (4) Take 10 µL of plasmid with a concentration of 10⁻⁴ and add 990 µL of 0.01% TE-SDS, labeling it as 10⁻⁶; (5) Take 100 µL of plasmid with a concentration of 10⁻⁶ and add 900 µL of 0.01% TE-SDS, labeling it as 10⁻⁷; (6) Take 100 µL of plasmid with a concentration of 10⁻⁷ and add 900 µL of 0.01% TE-SDS, labeling it as 10⁻⁸; (7) Take 100 µL of plasmid with a concentration of 10⁻⁸ and add 900 µL of 0.01% TE-SDS, labeling it as 10⁻⁹ (concentration is 1×10⁻⁶). -11 µg / µL).

[0085] Select plasmid templates of 10⁻⁶, 10⁻⁷, and 10⁻⁸ (apply plasmid concentrations of 10⁻⁶ and 10⁻⁷ in 2 replicates each, and plasmid concentration of 10⁻⁸ in 4 replicates each), and use the following reaction system and procedure to detect African swine fever virus.

[0086] Select plasmid templates of 10⁻⁷, 10⁻⁸, and 10⁻⁹ (spot 2 replicates for each of the 10⁻⁷ and 10⁻⁸ plasmid concentrations, and spot 4 replicates for the 10⁻⁹ plasmid concentration), and use the following reaction system and procedure to detect porcine epidemic diarrhea virus.

[0087] Select plasmid templates of 10⁻⁷, 10⁻⁸, and 10⁻⁹ (apply plasmid concentrations of 10⁻⁷ and 10⁻⁸ in 2 replicates each, and plasmid concentration of 10⁻⁹ in 4 replicates each), and use the following reaction system and procedure to detect porcine reproductive and respiratory syndrome virus.

[0088] The reaction systems used for screening primer and probe sets for African swine fever virus are shown in Table 2, the reaction systems used for screening primer and probe sets for porcine epidemic diarrhea virus are shown in Table 3, and the reaction systems used for screening primer and probe sets for porcine reproductive and respiratory syndrome virus are shown in Table 4. The reaction procedures are shown in Table 5.

[0089] Table 2

[0090]

[0091] Table 3

[0092]

[0093] Table 4

[0094]

[0095] Table 5

[0096]

[0097] Table 6

[0098]

[0099] Table 7

[0100]

[0101] Table 8

[0102]

[0103] The screening results of primer and probe sets for detecting African swine fever virus are shown in Table 6 and Figure 1-4 As shown, primer probe sets 2-4 all have good detection effects. From the low concentration sample 10-8, primer probe sets 2-4 can detect all samples. Primer probe set 4 has better linearity and CT value. Therefore, primer probe set 4 was selected for subsequent experiments.

[0104] The screening results of primer and probe sets for detecting porcine epidemic diarrhea virus are shown in Table 7 and... Figure 5-10 As shown, considering the Ct values ​​and detection rates of low-concentration samples (10⁻⁹), only primer-probe set 1 can achieve full detection, and its Ct value is also higher. Therefore, primer-probe set 1 was selected for subsequent experiments.

[0105] The screening results of the primer and probe sets used to detect porcine reproductive and respiratory syndrome virus are shown in Table 8 and... Figure 11-16 As shown, it can be seen that, based on the Ct values ​​and detection rates of low-concentration samples 10-9, only primer probe sets 4-5 can detect all samples. The Ct value of primer probe set 5 is 1.5 Ct higher, so primer probe set 5 is selected.

[0106] 3. Sensitivity Testing

[0107] Preparation of African swine fever virus standard plasmid gradient template: 10⁻⁹ (concentration 1×10⁻⁹) of African swine fever virus standard plasmid was prepared. -11 µg / µL), diluted 4 times at a ratio of 1:3 and named 10⁻⁹-1:3 (i.e., concentration of 0.25 × 10⁻⁶ µg / µL). -11 µg / µL); diluted 8 times at a ratio of 1:7 and named 10⁻⁹⁻¹:7 (i.e., concentration 0.125 × 10⁻⁶ µg / µL); -11 µg / µL).

[0108] Preparation of standard plasmid gradient templates for porcine epidemic diarrhea virus (PEDV): 10⁻⁹ standard plasmids of porcine epidemic diarrhea virus (PEDV) (concentration 1×10⁻⁹) were prepared. -11 (µg / µL), diluted 2 times at a 1:1 ratio and named 10⁻⁹⁻¹:1 (i.e., concentration 0.5 × 10⁻⁶ µg / µL). -11 µg / µL); 10⁻⁹ diluted 4 times at a ratio of 1:3 is named 10⁻⁹-1:3 (i.e., the concentration is 0.25×10⁻⁶ µg / µL); -11 µg / µL).

[0109] Preparation of standard plasmid gradient templates for porcine reproductive and respiratory syndrome virus (PRRSV): 10⁻⁹ PRRSV standard plasmids (concentration 1×10⁻⁹) were prepared. -11 µg / µL), diluted 4 times at a ratio of 1:3 and named 10⁻⁹-1:3 (i.e., concentration of 0.25 × 10⁻⁶ µg / µL). -11 µg / µL); diluted 8 times at a ratio of 1:7 and named 10⁻⁹⁻¹:7 (i.e., concentration 0.125 × 10⁻⁶ µg / µL); -11 µg / µL).

[0110] Using the gradient template described above, the primer and probe set 4 for detecting African swine fever virus, the primer and probe set 1 for detecting porcine epidemic diarrhea virus, and the primer and probe set 5 for detecting porcine reproductive and respiratory syndrome virus were used for sensitivity testing. The reaction system used for detection is shown in Table 9 below, and the reaction procedure is shown in Table 5 above.

[0111] Table 9

[0112]

[0113] Table 10

[0114]

[0115] Table 11

[0116]

[0117] Table 12

[0118]

[0119] The test results are shown in Table 10-12. It can be seen that the detection sensitivity for African swine fever virus is 8.3 × 10⁻⁶. -13 The detection sensitivity for porcine epidemic diarrhea virus (PEDV) is 1.6 × 10 µg / µL. -12 µg / µL, the detection sensitivity for porcine reproductive and respiratory syndrome virus is 8.3×10 -13 µg / µL.

[0120] 4. Specific detection

[0121] Specific detection was performed using primer and probe set 4 for detecting African swine fever virus, primer and probe set 1 for detecting porcine epidemic diarrhea virus, and primer and probe set 5 for detecting porcine reproductive and respiratory syndrome virus. The reaction system used for detection is shown in Table 9, and the reaction procedure is shown in Table 5.

[0122] Sample source: The genome of porcine rotavirus was extracted from pig fecal samples and cDNA was synthesized by reverse transcription using Random Primer as a primer. The genomes of Lawsonia intracellularis, porcine circovirus type 2, and porcine pseudorabies virus samples were extracted and diluted to 40 ng / μL with 1×TE buffer for sample detection.

[0123] Table 13

[0124]

[0125] The results are shown in Table 13. As can be seen from the table, primer probe set 4 for detecting African swine fever virus, primer probe set 1 for detecting porcine epidemic diarrhea virus, and primer probe set 5 for detecting porcine reproductive and respiratory syndrome virus all showed negative results for detecting porcine rotavirus, Lawsonia intracellularis, porcine circovirus type 2, and porcine pseudorabies virus, indicating that the primer probe sets have good specificity.

[0126] Example 2 Selection of stabilizers and reinforcing agents

[0127] This embodiment uses proline as an enhancer and bovine serum albumin as a stabilizer in PCR to improve PCR detection sensitivity, detection rate, and anti-interference capabilities. The specific verification steps are as follows:

[0128] 1. Verification experiment on proline as an enhancer

[0129] Proline was added to the reaction system shown in Table 9 at final concentrations of 0, 10, 20, 40, and 80 mM. Primer probe set 6 was used, and the reaction procedure in Table 3 was followed to verify that proline can effectively increase the sensitivity of PCR detection. The detection template was the African swine fever virus standard plasmid 10⁻⁹⁻¹:7 (i.e., a concentration of 0.125 × 10⁻⁶) prepared in Example 1. -11 µg / µL), porcine epidemic diarrhea virus standard plasmid 10⁻⁹⁻¹:3 (i.e., concentration of 0.25 × 10⁻⁶ µg / µL), -11 µg / µL), porcine reproductive and respiratory syndrome virus standard plasmid 10⁻⁹⁻¹:7 (i.e., concentration of 0.125 × 10⁻⁶ µg / µL), -11 (µg / µL), primers and probes used were primer set 4 for detecting African swine fever virus, primer set 1 for detecting porcine epidemic diarrhea virus, and primer set 5 for detecting porcine reproductive and respiratory syndrome virus. The reaction procedure is shown in Table 5.

[0130] Table 14

[0131]

[0132] The results are shown in Table 14. Proline concentrations ranging from 10 to 40 mM all showed a certain degree of enhancement to the PCR reaction, with 20 mM being the optimal concentration. At this concentration, the detection sensitivity for African swine fever virus was 4.2 × 10⁻⁶. -13 The detection sensitivity for porcine epidemic diarrhea virus (PEDV) is 8.3 × 10 µg / µL. -13 µg / µL, porcine reproductive and respiratory syndrome virus sensitivity 4.2×10 -13 µg / µL.

[0133] 2. Validation experiment of bovine serum albumin as an enhancer

[0134] Bovine serum albumin was added to the reaction system shown in Table 9 at final concentrations of 0.05, 0.25, 0.5, and 1 mg / mL to verify that bovine serum albumin can effectively increase the sensitivity of PCR detection. The detection template used was the African swine fever virus standard plasmid 10⁻⁹⁻¹:7 prepared in Example 1 (i.e., a concentration of 0.125 × 10⁻⁶). -11 µg / µL), porcine epidemic diarrhea virus standard plasmid 10⁻⁹⁻¹:3 (i.e., concentration of 0.25 × 10⁻⁶ µg / µL), -11 µg / µL), porcine reproductive and respiratory syndrome virus standard plasmid 10⁻⁹⁻¹:7 (i.e., concentration of 0.125 × 10⁻⁶ µg / µL), -11(µg / µL), primers and probes used were primer set 4 for detecting African swine fever virus, primer set 1 for detecting porcine epidemic diarrhea virus, and primer set 5 for detecting porcine reproductive and respiratory syndrome virus. The reaction procedure is shown in Table 5.

[0135] Table 15

[0136]

[0137] The test results are shown in Table 15. As can be seen from the table, the concentration range of the stabilizer bovine serum albumin is 0.05-0.5 mg / mL, which can improve the detection effect. The optimal concentration is 0.25 mg / mL.

[0138] 3. Testing the effect of stabilizers and reinforcing agents on anti-interference.

[0139] Proline was added to the reaction system shown in Table 9 at a final concentration of 20 mM and bovine serum albumin at a final concentration of 0.25 mg / mL. Primers and probes used were primer set 4 for detecting African swine fever virus, primer set 1 for detecting porcine epidemic diarrhea virus, and primer set 5 for detecting porcine reproductive and respiratory syndrome virus. The reaction procedure is shown in Table 5.

[0140] The detection template is as follows: First, the standard plasmids 10⁻⁶ for African swine fever virus, 10⁻⁶ for porcine epidemic diarrhea virus, 10⁻⁶ for porcine reproductive and respiratory syndrome virus, and 0.01% TE-SDS are mixed in a ratio of 1:1:1:7 to form a mixed plasmid 10⁻⁷. Then, the interfering substances, physiological saline, heme, purified mucin, and anhydrous ethanol are mixed in a ratio of 1:1:1:1 and then mixed with the mixed plasmid 10⁻⁷ in a volume ratio of 1:1. The final concentrations of physiological saline are 0.9% (v / v), heme is 10 μg / mL, purified mucin is 20 μg / mL, and anhydrous ethanol is 20% (v / v). 10 μL of the mixture is added to the reaction solution and mixed well before being loaded onto the instrument.

[0141] Table 16

[0142]

[0143] The results are shown in Table 16. As can be seen from the table, after adding 20 mM proline and 0.25 mg / mL bovine serum albumin, the amplification of African swine fever virus (ASFV) in the FAM channel, porcine epidemic diarrhea virus (PEDV) in the HEX / VIC channel, and porcine reproductive and respiratory syndrome virus (PRRSV) in the CY5 channel was not inhibited. The virus showed good anti-interference properties against interfering substances such as physiological saline, heme, purified mucin, and anhydrous ethanol.

[0144] Example 3 A kit for detecting African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus

[0145] This example provides a kit for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus, and porcine reproductive and respiratory syndrome virus. The kit contains a primer-probe set 4 for detecting African swine fever virus at a concentration of 50 μM, a primer-probe set 1 for detecting porcine epidemic diarrhea virus at a concentration of 50 μM, a primer-probe set 5 for detecting porcine reproductive and respiratory syndrome virus at a concentration of 50 μM, an internal standard NB primer-probe set at a concentration of 50 μM, 4× PCR buffer, a MgCl2 solution at a concentration of 1 mol / L, dNTPs at a concentration of 25 mmol / L, an RT enzyme at a concentration of 200 U / μL, a Taq enzyme at a concentration of 5 U / μL, proline, 5% bovine serum albumin, a negative control, and a positive control.

[0146] The negative control is water.

[0147] The positive control is the 3 standard plasmids prepared in Example 1.

[0148] The fluorescence PCR reaction system detected by the kit is shown in Table 17 below.

[0149] Table 17

[0150]

[0151] The fluorescence PCR reaction procedure is as shown in Table 5 in Example 1.

[0152] Sample result determination criteria:

[0153] 1. For the measured Ct value of the FAM channel ≤ 40, report as positive for ASFV; for the measured Ct value of the HEX / VIC channel ≤ 40, report as positive for PEDV; for the measured Ct value of the CY5 channel ≤ 40, report as positive for PRRSV;

[0154] 2. For no Ct value measured in the FAM, HEX / VIC, and CY5 channels, and at the same time the Ct value of the ROX channel ≤ 35, report as negative for ASFV, PEDV, and PRRSV;

[0155] 3. When 40 < Ct value ≤ 45 in the FAM, HEX / VIC, and CY5 channels and the Ct value of the ROX channel ≤ 35, it is judged as suspicious, and it is recommended to recheck, with the recheck result as the standard (re-perform nucleic acid extraction and PCR detection);

[0156] 4. If the internal standard Ct value is >35 or not displayed, the test result of the sample is invalid. This may be due to PCR inhibitors. It is recommended to serially dilute the sample and retest or resample and retest.

[0157] The standard plasmids 10⁻⁶ for African swine fever virus, 10⁻⁶ for porcine epidemic diarrhea virus, and 10⁻⁶ for porcine reproductive and respiratory syndrome virus were mixed in a 1:1:1 volume ratio and used as a detection template. The results of the detection using the above kit are as follows: Figure 17 As shown in the figure, it can be seen that three types of viruses can be accurately detected.

[0158] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A kit for simultaneous detection of African swine fever virus, porcine epidemic diarrhea virus, porcine reproductive and respiratory syndrome virus, characterized in that, The kit contains a primer probe combination for simultaneously detecting African swine fever virus, porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and a fluorescent quantitative PCR reaction solution; the primer probe combination is composed of a first primer probe combination for detecting African swine fever virus, a second primer probe combination for detecting porcine epidemic diarrhea virus and a third primer probe combination for detecting porcine reproductive and respiratory syndrome virus; The first primer probe combination is composed of primer sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 11 and a probe sequence as shown in SEQ ID NO: 9; The second primer probe combination is composed of primer sequences as shown in SEQ ID NO: 12 and SEQ ID NO: 13 and a probe sequence as shown in SEQ ID NO: 14; The third primer probe combination is composed of primer sequences as shown in SEQ ID NO: 33 and SEQ ID NO: 34 and a probe sequence as shown in SEQ ID NO: 32; The fluorescent quantitative PCR reaction solution contains a stabilizer, an enhancer; and at least one of a PCR amplification buffer, Taq DNA polymerase, dNTPs, RT enzyme and MgCl2 solution; The enhancer is proline; The stabilizer is bovine serum albumin.

2. The kit of claim 1, wherein The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group.

3. Use of the kit of any one of claims 1-2 in the preparation of a product for detecting or assisting in the detection of African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus.

4. A system for detecting African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus, characterized in that, The system comprises: an amplification module for performing PCR amplification on the genomic nucleic acid of the pig sample to be tested using the kit of any one of claims 1-2 to obtain an amplification product; a result evaluation module for detecting the amplification product and evaluating whether the pig sample to be tested is infected with African swine fever virus, porcine epidemic diarrhea virus and / or porcine reproductive and respiratory syndrome virus.

Images