Application of nystatin in preparation of product for treating LINC00516 high-expression lung adenocarcinoma
By targeting and inhibiting the binding of LINC00516 to CDK1, and using nystatin to block the binding of LINC00516 to CDK1, the non-specificity and drug resistance problems of existing lung cancer treatments have been solved, achieving effective inhibition of lung adenocarcinoma cells and improving treatment efficacy.
Patent Information
- Application Number
- CN202511423706.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2025-12-26
AI Technical Summary
Existing lung cancer treatments such as chemotherapy, radiotherapy, and targeted therapy have non-specific effects and side effects. Furthermore, targeted therapy is only applicable to patients with specific gene mutations, and drug resistance is a common problem, which limits the improvement of treatment efficacy.
By targeting and inhibiting the binding of LINC00516 to CDK1, nystatin blocks the binding of LINC00516 to CDK1, reduces CDK1 activity, and inhibits tumor cell proliferation.
It significantly inhibits the growth of lung adenocarcinoma cells that highly express LINC00516, providing a novel molecular targeted therapy strategy with target specificity and good tumor-suppressing effect, overcoming the limitations of traditional treatments and improving patient prognosis.
Smart Images

Figure BDA0005624028040000021 
Figure HDA0005624028060000011 
Figure HDA0005624028060000012
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of nystatin in preparation of a product for treating lung adenocarcinoma with high expression of LINC00516. BACKGROUND
[0002] Lung cancer is one of the malignant tumors with the highest incidence and mortality worldwide. Although traditional treatment methods (such as chemotherapy, radiotherapy and targeted therapy) can control disease progression to a certain extent, their non-specific effects and possible side effects still have limitations in clinical application. The non-specific effects of chemotherapy and radiotherapy can cause damage to normal tissues and various side effects, while targeted therapy, although improving the efficacy, is only suitable for patients with specific gene mutations, and drug resistance is common. These factors limit the further improvement of the treatment effect of lung cancer to a certain extent. Therefore, exploring the molecular mechanism of lung cancer and finding new therapeutic targets are of great significance for improving the treatment effect and improving the prognosis of patients.
[0003] In recent years, the role of cell cycle regulatory molecules in the occurrence and development of lung cancer has attracted widespread attention. Studies have shown that abnormal expression of key cell cycle proteins (such as CDK1) and their regulatory factors is closely related to tumor proliferation, especially in non-small cell lung cancer (NSCLC), high expression or overactivation of cell cycle molecules can significantly enhance the proliferation ability of tumor cells and promote chemotherapy resistance.
[0004] As a new molecular target, lncRNA shows unique potential in regulating tumor biological behavior. By affecting cell cycle, DNA damage repair and signal pathway activity, lncRNA can enhance or inhibit tumor cell proliferation and drug resistance. More and more studies have shown that specific lncRNA is highly expressed in lung adenocarcinoma and is closely related to the malignant phenotype of tumors, suggesting that its application prospect in lung cancer treatment is very broad.
[0005] Therefore, it is necessary to develop a therapeutic drug for tumors related to specific lncRNA. SUMMARY
[0006] The applicant's previous work found that LINC00516 can directly regulate CDK1, enhance CDK1 activity, promote G2 / M phase cell cycle progression, and thus accelerate lung adenocarcinoma cell proliferation. Regulating LINC00516 or CDK1 activity mediated by LINC00516 provides a new strategy for precise intervention of lung cancer cell cycle abnormalities. The present application proposes that by targeting and inhibiting the combination of LINC00516 and CDK1, effective regulation of lung cancer cell proliferation can be achieved, which exhibits significant therapeutic potential. In order to find long non-coding RNAs (lncRNAs) closely related to the occurrence and development of lung adenocarcinoma as new therapeutic targets, the inventors first performed in-depth mining on the transcriptome data of lung adenocarcinoma (LUAD) in the Cancer Genome Atlas (TCGA) database through bioinformatics methods. By analyzing the differentially expressed profiles of tumor tissues and adjacent normal tissues, a series of candidate lncRNAs that were significantly highly expressed in lung adenocarcinoma were preliminarily screened. Combined with literature research on these candidate lncRNAs and prediction of their potential functions in tumor cell cycle regulation, LINC00516 was finally locked as the key research object, and its expression level in lung adenocarcinoma, clinical significance and biological function were systematically verified through experiments.
[0007] The first aspect of the present application aims to provide the use of a LINC00516 inhibitor in the preparation of a drug for treating lung adenocarcinoma.
[0008] The second aspect of the present application aims to provide a method for inhibiting the combination of LINC00516 and CDK1 in vitro.
[0009] In order to achieve the above-mentioned purposes of the present application, the technical solutions adopted by the present application are as follows:
[0010] The first aspect of the present application provides the use of a LINC00516 inhibitor in the preparation of a drug for treating lung adenocarcinoma.
[0011] LINC00516 (Long Intergenic Non-Protein Coding RNA 516, also known as BMS1P18 / C14orf17) is a long non-coding RNA gene located in the region of human chromosome 14q11.2. The transcript is 725 nt in length, and the sequence is: gccacgtgaaggatgtgtttgcttccccttccaccatgattgtaagtttcctgaggcctccccagccatgtggaactgtgaattaaacttctttcctggagtgtgaaaatgaactaataaactctgtgacctcagagactccctctcagtgaccctgttctcaaatgtatgaagatgggtgctcaaagatctctctctaaacatggaacagggcctgtctgaagacataagtgattaacttctaatctataactaaggtctgagtcctgaagaccttcctctggaggctgagtagttaatctagatgggtccaggtgctgcaggtaaaatacctcttttctgacaagactaggactcttacatagactaccatgaactaaaagaagcacaacattgccagagtaacctgtgatactgtcttcatgcgaacttggtatcctgtttccatcccagccttctataacccagtaacatcttttttgaaaccagtgggtgagaaagacacctggtcaggaacgcggaccacaggacaactcaggctcacccacggcatcagactaaaggcaaacaaggactctgtataaagtaccggtggcatgtgtattagtggagatgcagcctgtgctctgcagacagggagtcacacagacacttttctataatttcttaagtgctttgaatgttcaagtagaaagtctaacattaaatttgattgaacaattgta (SEQ ID NO: 1), containing several exons, and the mature transcript has a poly(A) tail. Although it does not encode a protein, it can be detected in the expression of various tissues, and the expression level is significantly different from that of normal tissues in some lung cancers.
[0012] In some embodiments of the present application, the LINC00516 inhibitor comprises a small molecule drug or a nucleic acid molecule.
[0013] In some embodiments of the present application, the small molecule drug comprises Nystatin.
[0014] Nystatin is a polyene antifungal antibiotic that binds to ergosterol, increasing the permeability of the cell membrane of susceptible fungi. Its molecular formula is C 47 H 75 NO 17 , molecular weight 926.09, and the structural formula is shown in the following formula:
[0015]
[0016] In some embodiments of the present application, the nucleic acid molecule is microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotide.
[0017] In some embodiments of the present application, the sequence of the sgRNA is shown in SEQ ID NO: 2, 3.
[0018] In some embodiments of the present application, the lung adenocarcinoma comprises lung adenocarcinoma with high expression of LINC00516.
[0019] In some embodiments of the present application, the Nystatin comprises a pharmaceutically acceptable salt.
[0020] In some embodiments of the present application, the pharmaceutically acceptable salt comprises an acid addition salt and a base addition salt.
[0021] The "pharmaceutically acceptable acid addition salt" refers to a salt formed with an inorganic acid such as, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and an organic acid such as, but not limited to, acetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, camphoric acid, camphor 10-sulfonic acid, capric acid, hexanoic acid, octanoic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfic acid, ethane 1,2 disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, etc., which retains the biological effectiveness and properties of the free base and is not biologically or otherwise undesirable.
[0022] "Pharmaceutically acceptable base addition salt" refers to those salts which retain the biological effectiveness and properties of the free acids and which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dicyclohexylamine, lysine, arginine, histidine, caffeine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0023] In some embodiments of the present application, the medicament comprises a pharmaceutically acceptable excipient.
[0024] In some embodiments of the present application, the pharmaceutically acceptable excipient comprises at least one of a solvent, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure adjusting agent, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, an aromatic agent, an antiadherent, an integrating agent, a penetration enhancer, a pH adjusting agent, a buffer, a plasticizer, a surfactant, an antifoaming agent, a thickening agent, an inclusion agent, a humectant, an absorbent, a diluent, a flocculating agent and a deflocculating agent, a filter aid, a release retarder, a carrier.
[0025] The above pharmaceutically acceptable excipients are generally recognized as suitable for this use in the art and are non-active ingredients of the medicaments. A compendium of pharmaceutically acceptable excipients can be found in the Handbook of Pharmaceutical Excipients, 2ndEdition, Edited by A. Wade and P. J. Weller; Published by American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994; the Compendium of Chinese Pharmacopoeia-Pharmaceutical Excipients, and the like.
[0026] In some embodiments of the present application, the dosage form of the medicament comprises a gastrointestinal administration dosage form, or a parenteral administration dosage form.
[0027] In some embodiments of the present application, the gastrointestinal administration dosage form comprises at least one of a powder, a tablet, a granule, a capsule, a sustained-release agent, a solution, a dry suspension, an effervescent tablet, an emulsion, a suspension, a syrup, a drop, a chewable tablet;
[0028] In some embodiments of the present application, the non-gastrointestinal administration dosage form comprises at least one of an injection administration dosage form, a respiratory administration dosage form, a skin administration dosage form, a mucosal administration dosage form, a cavity administration dosage form.
[0029] In some embodiments of the present application, the dosage form of the drug is a child-appropriate dosage form or an adult-appropriate dosage form.
[0030] In some embodiments of the present application, the administration subject of the product is a mammal;
[0031] In some embodiments of the present application, the mammal comprises a human.
[0032] In a second aspect of the present application, a method for inhibiting the binding of LINC00516 to CDK1 in vitro is provided, comprising the following steps:
[0033] The cell is treated with nystatin.
[0034] In some embodiments of the present application, the cell comprises lung cancer cells, including but not limited to A549, H1975, H1299, HCC827.
[0035] In some embodiments of the present application, the concentration of nystatin is 40-60 μM, preferably 50 μM.
[0036] The present application has the following beneficial effects:
[0037] The present application first discloses the key role of long non-coding RNA LINC00516 in the abnormal activation of lung adenocarcinoma cell cycle. The results show that LINC00516 significantly enhances the kinase activity of CDK1 and reduces its inhibitory phosphorylation level (Thr14, Tyr15) by directly binding to CDK1, thereby driving lung adenocarcinoma cells to rapidly enter the G2 / M phase and accelerating tumor cell proliferation.
[0038] On this basis, the present application further innovatively proposes to use nystatin as an intervention means to effectively reduce the activity of CDK1 by blocking the binding of LINC00516 to CDK1, thereby inhibiting the proliferation ability of tumor cells. Both in vivo and in vitro experiments have confirmed that nystatin can significantly inhibit the growth of lung adenocarcinoma cells with high expression of LINC00516, thereby providing a new molecular targeted therapy strategy for clinical use.
[0039] Therefore, the application not only illustrates the mechanism of LINC00516 in the occurrence and development of lung adenocarcinoma, but also establishes a set of detection and intervention methods taking LINC00516-CDK interaction as a therapeutic target, thereby providing a new precise treatment scheme for lung cancer patients, especially for the population with high expression of LINC00516. The technology has clear target specificity, good tumor inhibition effect and potential clinical application value, can effectively overcome the limitations of traditional treatment, and improve the prognosis of patients. BRIEF DESCRIPTION OF DRAWINGS
[0040] The application will be further described below in combination with the drawings and examples, in which:
[0041] Figure 1 FIG. 1 is the expression results of LINC00516 in lung adenocarcinoma, in which: A is the LINC00516 FPKM expression level results of lung adenocarcinoma tumor tissues and adjacent normal tissues in the TCGA database; B is the relative expression amount results of LINC00516 in tumor and adjacent normal tissues of 10 lung adenocarcinoma patients detected by qRT-PCR; C is the expression and localization results of LINC00516 in lung adenocarcinoma tumor tissues and adjacent normal tissues detected by RNA in situ hybridization technology (RNAbasescope); D is the Kaplan-Meier survival curve analysis results based on the expression level of LINC00516 in lung adenocarcinoma patients in the TCGA database.
[0042] Figure 2 FIG. 3 is the results of in vivo and in vitro experimental verification of the influence of LINC00516 on the cell proliferation rate, in which: A is the results of colony formation experiment for detecting the colony formation ability of cells after overexpressing LINC00516 in A549 and H1975 cells and knocking down LINC00516 in H1299 and HCC827 cells; B is the results of MTT experiment for detecting the proliferation activity of cells; C is the results of tumor growth, volume and final weight after subcutaneously inoculating H1975 cells overexpressing LINC00516 and H1299 cells knocking down LINC00516 into nude mice.
[0043] Figure 3 FIG. 5 is the results of LINC00516 and CDK1 binding, in which: A is the results of detecting the interaction proteins by SDS-PAGE gel electrophoresis and Coomassie brilliant blue staining using LINC00516 as a probe for RNA pull-down experiment; B is the mass spectrometry analysis results of the protein bands captured in the pull-down experiment; C is the results of Western Blot verifying the binding of LINC00516 sense strand and antisense strand with CDK1; D is the results of RNA immunoprecipitation (RIP) experiment using CDK1 antibody, and the enrichment of LINC00516 is detected by qRT-PCR.
[0044] Figure 4 The results of the influence of LINC00516 overexpression on CDK1 activity, wherein: A is the change in CDK1 enzyme activity detected by in vitro kinase experiment after overexpression or knockdown of LINC00516 in lung adenocarcinoma cells; B is the detection of the total protein of CDK1 and its phosphorylation level at tyrosine 15 (Y15) and threonine 14 (T14) sites after overexpression or knockdown of LINC00516 by Western Blot.
[0045] Figure 5 The treatment effect of nystatin on lung adenocarcinoma, wherein: A is the detection of the proliferation ability of cells after treatment of A549, H1299 and H1975 cells with nystatin (Nystatin) by clonogenic assay; B is the detection of the direct binding of nystatin to LINC00516, CDK1, and the inhibitory effect of nystatin on LINC00516-CDK1 binding by SPR technology; C is the detection of the change in the amount of CDK1 binding to LINC00516 after treatment of cells with nystatin by cross-linking immunoprecipitation (CLIP) experiment; D is the comparison of the change in tumor volume over time between the control group and the nystatin treatment group in the subcutaneous tumor model of nude mice inoculated with H1975-LINC00516 cells. DETAILED DESCRIPTION
[0046] The concept and technical effects of the present application will be described below in conjunction with examples to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only a part of the examples of the present application, but not all examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0047] Example 1 LncRNA target identification
[0048] 1. Experimental method
[0049] Sample preparation: Collect tumor tissue and corresponding normal tissue samples from 10 pairs of lung adenocarcinoma patients to ensure ethical compliance of the samples. Immediately place the collected tissue samples in the RNAlater tissue preservative of Thermo to fix and maintain the integrity of the RNA. Store at 4°C overnight to allow the preservative to fully penetrate the tissue, then transfer to -80°C for long-term storage. Subsequently, paraffin-embedded, after routine dehydration and transparency treatment, immerse in paraffin and completely embed. Then use a microtome to cut the paraffin-embedded tissue into 4-5 μm thick sections and place them on pre-treated glass slides for use.
[0050] RNAbasescope staining: Antibody selection: Select LINCRNA00516 probe (Cat# 717571) with strong specificity (Cat# 323900) to validate its suitability in lung adenocarcinoma tissue.
[0051] Sample pre-treatment: Dry the sections in 60°C oven for 1 hour, then deparaffinize and hydrate. Rinse the sections with distilled water to remove excess moisture. Add hydrogen peroxide treatment to the sample for about ten minutes, rinse once with distilled water. Heat the target retrieval solution and place the sections in the target retrieval solution for about 15 minutes. Rinse and air dry the sections overnight using anhydrous ethanol. The next day, equilibrate the probe at 40°C for 10 minutes before adding to cover the sections, hybridize at 40°C for 2 hours, then wash in lx wash buffer for 2 minutes at room temperature x 2. Perform AMP1-AMP8 amplification in sequence, incubate AMP1 at 40°C for 30 minutes, AMP2 for 30 minutes, AMP3 for 15 minutes, AMP4 for 30 minutes, AMP5 for 30 minutes, AMP6 for 15 minutes; AMP7 at room temperature for 30 minutes (adjustable to affect signal intensity), AMP8 at room temperature for 15 minutes, wash with lx wash buffer for 2 minutes at room temperature x 2 between each step.
[0052] Fast RED chromogenic and counterstaining mounting: Prepare Fast RED working solution (B:A = 1:60, e.g. 2 pL B + 120 pL A for 0.75" x 0.75" hydrophobic circle) and incubate at room temperature for 10 minutes and wash twice with distilled water. Counterstain with 50% Gill’s hematoxylin at room temperature for 2 minutes, rinse with tap water until the slide face is clear, then blue with 0.02% ammonia water for 2-3 times and wash the slide with water for 3-5 times. Dry the slide completely at 60°C for > 15 minutes, then mount with VectaMount and cover the slide with a coverslip; note that the RED substrate is sensitive to alcohol, do not use alcohol for dehydration or reagents containing alcohol throughout the whole procedure.
[0053] Observation and analysis: Brightfield microscopy 20-40x to assess morphology and controls
[0054] Positive control should show red punctate / clumpy signal in the cells, negative control is acceptable with < 1 background dot per 20 cells in 20x field. Score the target probe according to BaseScope 0-4+ semi-quantitative standard: 0 for < 1 dot per 20 cells; 1 for 1 dot per cell; 2 for 2-3 dots per cell with few clusters; 3 for 4-10 dots per cell with < 10% positive cells showing clusters; 4 for > 10 dots per cell with > 10% positive cells showing clusters.
[0055] TCGA database analysis: From TCGA database (https: / / cancergenome.nih.gov / ), download RNA-seq data of lung adenocarcinoma and lung squamous cell carcinoma, and perform differential expression analysis using DESeq2. https: / / portal.gdc.cancer.gov / )Download the transcriptome sequencing data (HTSeq-FPKM) of lung adenocarcinoma (LUAD) project and the corresponding clinical follow-up information. Using bioinformatics analysis tools, compare the expression differences of LINC00516 in tumor samples (n=488) and normal samples (n=58), and perform paired T test analysis on 56 pairs of matched samples. According to the median of LINC00516 expression, the patients are divided into high expression group and low expression group, and the survival analysis is performed by Kaplan-Meier method, and the log-rank test is used to evaluate the difference of overall survival (OS) between the two groups. P value less than 0.05 is considered statistically significant.
[0056] 2、Experimental results
[0057] Through the above experimental steps, the expression of LINC RNA00516 in lung adenocarcinoma patient clinical samples can be effectively evaluated, so as to identify the target related to lung adenocarcinoma.
[0058] Through the analysis of TCGA database, the expression level of LINC00516 in tumor tissue is significantly higher than that in normal tissue adjacent to cancer, and its high expression is closely related to the poor prognosis of patients. On the experimental level, qRT-PCR technology confirms that LINC00516 is indeed highly expressed in clinical tumor samples, and its main enrichment in cancer cells is observed by RNA in situ hybridization technology, which is completely consistent with the analysis results of the database. These data together indicate that LINC00516 is generally abnormally highly expressed in lung adenocarcinoma and is related to the malignant progression of the disease, so it is a very potential drug development target.
[0059] Example 2 Effect of high expression of LINC00516 and knock-out of LINC00516 on cell proliferation ability
[0060] 1、Experimental method
[0061] 1) Construction of LINC00516 overexpression (OE) stable cell line vector
[0062] The full-length sequence of LINC00516 is amplified by polymerase chain reaction (PCR) using human cell cDNA library as template. The amplification product is inserted into the CMV promoter downstream of the lentiviral expression vector pLVX-Puro by enzyme digestion and ligation or recombination cloning method to construct pLVX-LINC00516 overexpression vector. The successfully constructed vector is subjected to Sanger sequencing verification to ensure that the sequence is correct and accurate.
[0063] Lentivirus packaging and infection: pLVX-LINC00516 plasmid or empty vector pLVX-Puro, together with packaging plasmid psPAX2 and envelope plasmid pMD2.G, were co-transfected into HEK293T cells. Virus particles containing supernatant was collected at 48 and 72 hours after transfection. Virus supernatant was filtered and added to logarithmic growth lung adenocarcinoma cells (such as A549, H1975) with Polybrene (8 μg / mL) for infection.
[0064] Screening of stable cell lines: 48 hours after infection, the successfully infected cells were screened using complete culture medium containing puromycin (concentration determined according to the pre-experiment of the cell line) until all uninfected control cells died. The obtained resistant cells were LINC00516 stably overexpressed (LINC00516-OE) or negative control (Vector) cell lines.
[0065] Overexpression verification: The mRNA expression level of LINC00516 in LINC00516-OE cell lines was detected by real-time fluorescent quantitative PCR (qRT-PCR), and it was confirmed that it was significantly higher than that of the Vector group.
[0066] 2) Construction of LINC00516 knockout (KO) stable cell lines
[0067] Vector construction: According to the sequence of LINC00516 gene, two sgRNAs targeting different sites were designed and synthesized.
[0068] LINC00516-sg1: ACCCATATGTGCAGATATAG (SEQ ID NO: 2);
[0069] LINC00516-sg2: GTGGCTCATGTCTTAAATTG (SEQ ID NO: 3).
[0070] The synthesized sgRNA oligonucleotide chain was annealed to form double-stranded DNA, and was cloned into the lentiCRISPRv2 vector (which expresses Cas9 protein and sgRNA at the same time). The control group (Ctrl) used sgRNA which did not target any human genomic sequence.
[0071] Lentivirus packaging and infection: The same lentivirus packaging and infection method as the construction of overexpression cell lines was used to package the constructed lentiCRISPRv2-sg1, lentiCRISPRv2-sg2, and lentiCRISPRv2-Ctrl plasmids into viruses, and to infect target cells (H1299, HCC827).
[0072] Screening stable cell lines: About 72 hours after infection, when the GFP fluorescence is fully expressed, the cells were trypsinized to prepare a single cell suspension. Then, the GFP-positive cell population was screened and collected by Fluorescence-Activated Cell Sorting (FACS). The sorted GFP-positive cells were cultured for expansion, and the stable cell pools of LINC00516 knockout (sg-LINC00516) or control (Ctrl) were obtained.
[0073] Verification of knockout efficiency: The genomic DNA of the stable cells was extracted, the sgRNA target region was amplified by PCR (detection primers: LINC00516-KO-up: TGCTGTTCTCGTGATACTGAGTGAGTTCCCACGAGATCT, SEQ ID NO: 4; LINC00516-KO-down: GACAAGTGAAATTCAGTAGGCAGAATGATAATAAATGTCAT, SEQ ID NO: 5), and Sanger sequencing and TIDE / T7E1 gene editing efficiency analysis were performed to confirm that the target region produced effective Indel mutations. At the same time, the expression level of LINC00516 was detected by qRT-PCR to confirm that it was significantly lower than that of the control group.
[0074] 3) MTT experiment:
[0075] Suitable cell lines (A549, H1975, H1299, HCC827) were cultured in 10% FBS medium to the logarithmic phase, and untreated controls, LINC00516 overexpression and KO treatment groups were constructed according to the experimental design, and cell-free blank wells were set for background subtraction. Cells were seeded in 96-well plates (the seeding density was optimized according to the cell type), incubated for 6-24 hours to adhere / recover, and the volume of each well was consistent with the seeding to facilitate subsequent absorbance comparison.
[0076] After adding MTT reagent to each well, incubate at 37°C until purple crystals are visible (about 5 mg / mL working solution is added to each well with culture medium, and the total incubation time is about 2 hours.
[0077] Discard the supernatant and add the dissolution solution (DMSO) to dissolve the crystal violet completely. Shake gently in the dark until it is completely clear for standby use.
[0078] Use a microplate reader to measure the absorbance at 570-590 nm, and subtract the background at 630-690 nm or blank wells before data processing. Normalize the data of the treatment group relative to the control group to obtain the relative survival / proliferation rate or inhibition rate, which is used to compare the differences between LINC00516 overexpression and KO groups.
[0079] 4) Colony formation assay
[0080] Cells were divided into high LINC00516 expression and LINC00516 knockout, and cells were collected after 48 hours of treatment. The treated cells were seeded in 6-well plates at an appropriate density (e.g., 500-1000 cells / well) and cultured using medium containing 10% fetal bovine serum. The cells were cultured for about 10-14 days until obvious colonies were formed.
[0081] The samples were collected, and the colonies were fixed with 4% paraformaldehyde for 10 minutes at room temperature. Crystal violet staining solution was used for staining, and the staining was performed at room temperature for 30 minutes. Excess dye was removed by washing with PBS, and after drying, the colonies were observed under a microscope and counted.
[0082] 5) Subcutaneous tumor formation experiment in nude mice
[0083] Grouping: LINC00516 overexpression (OE), LINC00516 knockout (KO), n = 5 per group is recommended to ensure statistical efficacy.
[0084] Animals: 5-week-old female BALB / c nude mice or equivalent immunodeficient mice, SPF feeding and adaptation for at least 7 days.
[0085] Cells: H1975 and H1299 cells were selected, and stable OE / KO cell lines were prepared or enriched after transfection / infection, and LINC00516 expression was verified by qPCR before inoculation and ensured to be in the logarithmic growth phase with a survival rate of >95%.
[0086] Suspension: Prepare a single-cell suspension of 5x10 7 cells / mL on ice, mix 1:1 with serum-free medium and Matrigel, 100 μL per mouse (i.e., 5x10 6 cells).
[0087] Inoculation steps:
[0088] Blow the cell suspension well on ice, use an insulin needle or a 27-30G fine needle for subcutaneous injection, the needle tip is inserted about 1 cm subcutaneously, and 100 μL is slowly injected to ensure the formation of a local mass to avoid leakage.
[0089] After inoculation, observe for 5-10 minutes to confirm that there is no leakage and abnormal activity, and return to the cage for regular feeding; if necessary, use isotonic analgesia (follow the IACUC / ethics requirements of the unit).
[0090] Monitoring and endpoints:
[0091] Volume measurement: Measure the long axis L and the short axis W with a vernier caliper 2-3 times a week, and calculate the tumor volume V = 1 / 2 x L x W 2; Body weight and general condition were recorded synchronously.
[0092] Ethical endpoint: single tumor volume > 1000 - 1500 mm 3 , ulcer, significant pain or body weight loss > 15 - 20% should be humanely disposed of (per unit standard).
[0093] Material: at the end of the experiment, the tumor was removed, weighed and photographed.
[0094] 2. Experimental results
[0095] Through in vitro cytological experiments and in vivo animal models, it is confirmed that LINC00516 plays a key role in promoting the proliferation of lung adenocarcinoma cells and tumor growth. The results of in vitro experiments show that overexpression of LINC00516 in lung adenocarcinoma cell lines (A549, H1975) can significantly accelerate the cell proliferation rate and enhance the clonogenic ability; on the contrary, knocking out LINC00516 in cell lines (H1299, HCC827) significantly inhibits cell proliferation and clonogenicity. This pro-cancer function is further verified in the subcutaneous tumor model of nude mice in vivo: tumors overexpressing LINC00516 show faster growth rate and larger final volume and weight, while knocking out LINC00516 significantly inhibits tumor growth. Therefore, the experimental results prove a clear conclusion: LINC00516 drives the tumor growth of lung adenocarcinoma by promoting cell proliferation.
[0096] Example 3 Binding results of LINC00516 and CDK1
[0097] 1. Experimental method
[0098] 1) RNA pull-down
[0099] LINC00516 sense strand:
[0100] GCCACGTGAAGGATGTGTTTGCTTCCCCTTCCACCATGATTGTAAGTTTCCTGAGGCCTCCCCAGCCATGTGGAACTGTGAATTAAACTTCTTTCCTGGAGTGTGAAAATGAACTAATAAACTCTGTGACCTCAGAGACTCCCTCTCAGTGACCCTGTTCTCAAATGTATGAAGATGGGTGCTCAAAGATCTCTCTCTAAACATGGAACAGGGCCTGTCTGAAGACATAAGTGATTAACTTCTAATCTATAACTAAGGTCTGAGTCCTGAAGACCTTCCTCTGGAGGCTGAGTAGTTAATCTAGATGGGTCCAGGTGCTGCAGGTAAAATACCTCTTTTCTGACAAGACTAGGACTCTTACATAGACTACCATGAACTAAAAGAAGCACAACATTGCCAGAGTAACCTGTGATACTGTCTTCATGCGAACTTGGTATCCTGTTTCCATCCCAGCCTTCTATAACCCAGTAACATCTTTTTTGAAACCAGTGGGTGAGAAAGACACCTGGTCAGGAACGCGGACCACAGGACAACTCAGGCTCACCCACGGCATCAGACTAAAGGCAAACAAGGACTCTGTATAAAGTACCGGTGGCATGTGTATTAGTGGAGATGCAGCCTGTGCTCTGCAGACAGGGAGTCACACAGACACTTTTCTATAATTTCTTAAGTGCTTTGAATGTTCAAGTAGAAAGTCTAACATTAAATTTGATTGAACAATTGTA (SEQ ID NO: 1).
[0101] LINC00516 antisense strand:
[0102] TACAATTGTTCAATCAAATTTAATGTTAGACTTTCTACTTGAACATTCAAAGCACTTAAGAAATTATAGAAAAGTGTCTGTGTGACTCCCTGTCTGCAGAGCACAGGCTGCATCTCCACTAATACACATGCCACCGGTACTTTATACAGAGTCCTTGTTTGCCTTTAGTCTGATGCCGTGGGTGAGCCTGAGTTGTCCTGTGGTCCGCGTTCCTGACCAGGTGTCTTTCTCACCCACTGGTTTCAAAAAAGATGTTACTGGGTTATAGAAGGCTGGGATGGAAACAGGATACCAAGTTCGCATGAAGACAGTATCACAGGTTACTCTGGCAATGTTGTGCTTCTTTTAGTTCATGGTAGTCTATGTAAGAGTCCTAGTCTTGTCAGAAAAGAGGTATTTTACCTGCAGCACCTGGACCCATCTAGATTAACTACTCAGCCTCCAGAGGAAGGTCTTCAGGACTCAGACCTTAGTTATAGATTAGAAGTTAATCACTTATGTCTTCAGACAGGCCCTGTTCCATGTTTAGAGAGAGATCTTTGAGCACCCATCTTCATACATTTGAGAACAGGGTCACTGAGAGGGAGTCTCTGAGGTCACAGAGTTTATTAGTTCATTTTCACACTCCAGGAAAGAAGTTTAATTCACAGTTCCACATGGCTGGGGAGGCCTCAGGAAACTTACAATCATGGTGGAAGGGGAAGCAAACACATCCTTCACGTGGC (SEQ ID NO: 6).
[0103] In vitro transcribed or synthesized biotin-labeled LINC00516 sense / antisense RNA was denatured at 90°C for 2 min, renatured on ice and folded in structure buffer to obtain the correct secondary structure.
[0104] RNase / protease inhibitor-containing cell lysis buffer was prepared and biotinylated RNA was added for overnight incubation at 4°C to form RNA-protein complexes.
[0105] Streptavidin magnetic beads / agarose beads were prewashed and blocked, and the incubation mixture was added to the beads for further rotation at 4°C to capture the complexes.
[0106] Wash away non-specific binding with low salt / high salt binding buffer sequentially, retain beads and discard supernatant.
[0107] Load onto SDS sample buffer after boiling elution or trypsin digestion for Western blot or mass spectrometry identification, set beads-only and antisense RNA controls.
[0108] 2) RIP (RNA immunoprecipitation)
[0109] Collect cells and optionally cross-link with formaldehyde to stabilize protein-RNA complexes in vivo, then prepare nuclear or whole cell lysate and keep on ice in RIP buffer. Add CDKI antibody (Wuhan Three Yike Proteintech, Cat# 67575-1-Ig) to lysate and incubate for 2h-overnight to form immune complexes, while setting IgG negative control and input sample.
[0110] Continue incubation with Protein A / G magnetic beads for 1h and collect beads, wash 3 times with RIP buffer to remove non-specific binding materials.
[0111] Add cross-linking / proteinase K digestion, purify immunoprecipitated RNA and perform qRT-PCR to determine LINC00516 enrichment, results expressed as RIP / Input% or relative IgG enrichment.
[0112] 3) Biacore (SPR)
[0113] Start instrument with HBS-EP-like running buffer and activate CM5 chip surface, couple ligand with EDC / NHS chemistry, immobilize at 5-20 μg / mL in NaOAc buffer at appropriate pH to reference and experimental channels, reach target RU level. Inject analyte at multiple gradient concentrations, set binding and dissociation phases (120s binding / 300s dissociation), reference channel and blank buffer background. Optimize regeneration conditions (mild acid / base or high salt / detergent) to restore baseline after each cycle, avoid surface damage and maintain constant binding capacity. Global fit with 1:1 binding model or appropriate model to obtain kinetic / equilibrium parameters, report RU-concentration dependent curves and residuals.
[0114] 2, Experimental results
[0115] This embodiment proves, through a series of experiments, that there is a direct and highly specific physical interaction between LINC00516 and CDK1 protein. First, by RNA pull-down experiment combined with mass spectrometry analysis technology, CDK1 is identified as a potential binding protein of LINC00516. In order to verify the authenticity of this finding in cells, further RNA immunoprecipitation (RIP) experiment confirms that, in the endogenous environment of lung adenocarcinoma cells, CDK1 antibody can indeed specifically enrich LINC00516 molecules. Finally, in order to clarify the directness of the action of the two and quantify the binding capacity, the surface plasmon resonance (Biacore) technology analysis results show that the purified LINC00516 can directly bind to CDK1 in vitro, and has an affinity as high as nanomolar level (KD = 1.23 x 10 -8 M). This series of evidence points to a clear conclusion: LINC00516 is a direct binding partner of CDK1 protein.
[0116] Example 4 LINC00516 overexpression enhances CDK1 activity
[0117] 1. Experimental method
[0118] 1) CDK1 enzyme activity detection
[0119] Lysis solution composition: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 10% glycerol, plus protease and phosphatase inhibitors.
[0120] Experimental operation: add cells to lysis solution, incubate on ice for 20 min; centrifuge at 12,000 g, 4°C for 10 min, collect the supernatant;
[0121] Quantify by BCA method, and unify the total protein concentration of each sample to 1 μg / μL.
[0122] Reaction system (50 μL per well) Reaction buffer: make up the total volume; ATP: final concentration 100 μM; MgCl2: final concentration 10 mM; substrate: Histone H1 1 μg / well; sample: equal amount of cell lysis total protein (5 / well), or equal amount of immunoprecipitation eluate.
[0123] Control settings:
[0124] Blank control: no sample, no substrate;
[0125] Negative control: no ATP or add CDK1 inhibitor RO-3306;
[0126] Positive control: recombinant CDK1 / Cyclin B protein;
[0127] Experimental groups: vector control cells, LINC00516 overexpression cells (A549, H1975), LINC00516 knockout cells (H1299, HCC827; two independent sgRNAs).
[0128] Reaction and termination:
[0129] Reaction conditions: incubate at 37°C for 30 min
[0130] Termination method:
[0131] Colorimetric / chemiluminescence / fluorescence method: add color developing or terminating liquid, read after 30 min reaction at room temperature;
[0132] ADP method: add "conversion-luminescence" reagent, read after 30 min incubation at room temperature.
[0133] 2) Western Blot detection of CDK1 T14 / Y15 phosphorylation
[0134] Antibody materials:
[0135] Primary antibody (4°C overnight): anti-CDK1 (Wuhan Three Yings Proteintech, item number 67575-1-Ig) 1:1000; anti-CDK1-T14 (Abeam, AB58509) 1:1000; anti-CDK1-Y15 (Abeam, AB47594) 1:1000; reference antibody (GAPDH) (Abeam, AB9485) 1:5000.
[0136] Secondary antibody: HRP-labeled secondary antibody, 1:5000, 1 h at room temperature.
[0137] Data analysis
[0138] ImageJ measures gray value, performs normalization calculation: pT14 / Actin, pY15 / Actin, Total CDK1 / Actin; calculate pT14 / Total CDK1 and pY15 / Total CDK1 ratio; at least 3 independent repeated experiments, the results are mean ± SD;
[0139] Statistical analysis: one-way ANOVA, significance threshold p<0.05
[0140] 2, experimental results
[0141] This embodiment discloses the key biological function of the physical interaction between LINC00516 and CDK1, i.e., LINC00516 is a key positive regulator of the kinase activity of CDK1 and plays a role through a specific molecular mechanism. The experimental results clearly show that the overexpression of LINC00516 can directly and significantly enhance the in vitro kinase activity of CDK1, while the knockout of LINC00516 leads to a significant decrease in its activity. From the mechanism of action, the Western Blot analysis results further clarify that the high expression of LINC00516 can significantly reduce the phosphorylation modification level of two key inhibitory phosphorylation sites, threonine 14 (Thr14) and tyrosine 15 (Tyr15), on the CDK1 protein. In view of the dephosphorylation of these two sites as the molecular switch for the transition of CDK1 from an inactive state to an active state, this result strongly proves that LINC00516 activates the kinase function of CDK1 by relieving the inhibitory phosphorylation of CDK1, and ultimately promotes the progression of the cell cycle.
[0142] Example 5 Therapeutic effect of nystatin on lung adenocarcinoma
[0143] 1. Experimental method
[0144] Cloning formation experiment: lung adenocarcinoma cells such as A549, H1299 and H1975 were inoculated in 6-well plates at an appropriate density and divided into a DMSO control group and a Dirithromycin treatment group. After drug treatment, the cells were continuously cultured for about 10-14 days until visible cell clones were formed. After fixation with paraformaldehyde and staining with crystal violet, the cloning formation of each group was observed and photographed.
[0145] Surface plasmon resonance (SPR) analysis: to explore the mechanism of action of Dirithromycin, Biacore instrument was used for molecular interaction analysis. The direct binding ability of Dirithromycin at different concentrations to LINC00516 and CDK1 was detected. In addition, a competition binding experiment was also conducted, i.e., different concentrations of Dirithromycin were added on the basis of the pre-binding of LINC00516 and CDK1, to detect the destruction ability of Dirithromycin to the LINC00516-CDK1 complex.
[0146] CLIP experiment to detect the binding of LINC00516 and CDK1.
[0147] 1. Purpose of the experiment
[0148] The direct binding relationship between LINC00516 and CDK1 protein was verified by ultraviolet cross-linking-immunoprecipitation-RT-qPCR / sequencing.
[0149] 2. Materials and reagents
[0150] Cells: LINC00516 overexpression, knockout or control cell lines (e.g. A549, H1975);
[0151] UV cross-linking device (254 nm, ~0.15-0.3 J / cm 2 );
[0152] Lysis buffer: 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 1 mM EGTA, 10% glycerol, plus protease / nuclease inhibitors;
[0153] Antibody: Anti-CDK1;
[0154] Protein A / G magnetic beads;
[0155] Proteinase K, DNase I, RNase T1 (optional for background reduction);
[0156] RNA extraction reagent (Trizol or equivalent);
[0157] Reverse transcription kit, qPCR primers (for LINC00516);
[0158] 3). Experimental steps
[0159] (1) UV cross-linking
[0160] Log phase cells were collected, washed with PBS; placed on ice, irradiated with 254 nm UV, energy ~0.15-0.3 J / cm 2 ; immediately lysed: add pre-cooled lysis buffer, incubate on ice for 20 min; 12,000 g, 4°C centrifuge for 10 min, collect supernatant.
[0161] (2) Immunoprecipitation
[0162] Take an equal amount of total protein (1-2 mg); add anti-CDK1 (2-5 μg), rotate and incubate overnight at 4°C; add pre-washed magnetic beads, rotate and incubate for 1-2 h; magnet stand adsorption, discard supernatant; wash 3-5 times with high-salt buffer (300-500 mM NaCl) to remove non-specific binding.
[0163] (3) RNA recovery
[0164] Add proteinase K, 55°C for 30 min to degrade protein and release RNA; Trizol extract immunoprecipitated RNA; reverse transcribed into cDNA; qPCR to detect LINC00516 abundance.
[0165] 4). Control settings
[0166] IgG negative control: replace specific antibody with isotype IgG under the same condition; input control: total RNA before immunoprecipitation; biological repeats: ≥3 times.
[0167] 5) Data analysis
[0168] qPCR method: calculate the enrichment fold of immunoprecipitation group (IP) relative to input (ΔCt method);
[0169] Comparison with IgG control: significantly higher than IgG indicates specific binding;
[0170] Nude mice subcutaneous tumorigenesis experiment
[0171] Grouping: H1975 cells overexpressing LINC00516 (OE) were injected into two groups of mice (n=5) respectively.
[0172] Animals: 5-week-old female BALB / c nude mice or equivalent immune-deficient mice, SPF feeding and adaptation for at least 7 days.
[0173] Cells: select H1975-LINC00516 overexpression cells.
[0174] Suspension: prepare single cell suspension on ice at 5×107 cells / mL, mix serum-free medium and Matrigel 1:1, 100 μL (i.e. 5×10 6 cells) per mouse.
[0175] Inoculation steps:
[0176] Blow the cell suspension well on ice, use insulin needle or 27-30G fine needle for subcutaneous injection, the needle tip is about 1 cm along the subcutaneous injection, slowly push 100 μL to ensure the formation of local mass and avoid leakage.
[0177] After inoculation, observe for 5-10 minutes to confirm no leakage and abnormal activity, and return to the cage for normal feeding; if necessary, use isotonic analgesia (follow the IACUC / ethics requirements of the unit).
[0178] Dosing:
[0179] Subcutaneous injection, dosing at 20, 23, 26 and 30 days after tumor injection, each time the concentration is 50 μM. The control group is given the same amount of DMSO.
[0180] Monitoring and endpoints:
[0181] Volume measurement: measure the long axis L and short axis W with vernier caliper 2-3 times a week, calculate the tumor volume V=1 / 2*L*W 2 ; record body weight and general condition simultaneously.
[0182] Ethical endpoint: single tumor volume > 1000-1500 mm 3 When ulcer, significant pain or weight loss > 15-20% should be humanely disposed of (according to the standard of the unit).
[0183] Sampling: at the end of the experiment, the tumor was removed, weighed and photographed.
[0184] 2. Experimental results
[0185] The results of Example 5 show that nystatin can significantly inhibit the progression of lung adenocarcinoma in vitro and in vivo by specifically disrupting the interaction between LINC00516 and CDK1. Molecular mechanism studies show that nystatin can effectively inhibit the binding of the two, in vitro, CLIP experiments show that nystatin treatment significantly reduces the binding of CDK1 and LINC00516 in cells, and through cloning experiments, nystatin can also significantly inhibit the clonogenic ability of various lung adenocarcinoma cell lines. In vivo animal models, nystatin treatment can effectively delay and inhibit the growth of LINC00516 high expression tumor xenografts. The above experimental results prove that targeting the binding of LINC00516 and CDK1 can inhibit the growth of lung adenocarcinoma in vitro and in vivo.
[0186] The embodiments of the application are described in detail above with reference to the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.
Claims
1. Use of a LINC00516 inhibitor in the preparation of a medicament for treating lung cancer. The LINC00516 inhibitor comprises a small molecule drug or a nucleic acid molecule. The small molecule drug comprises nystatin.
2. The use of claim 1, wherein: The nucleic acid molecule comprises microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotide.
3. The use of claim 2, wherein: The sequence of the sgRNA is shown in SEQ ID NO: 2, 3.
4. The use of claim 1, wherein: The lung adenocarcinoma comprises lung cancer with high expression of LINC00516.
5. The use of claim 1, wherein: The nystatin comprises a pharmaceutically acceptable salt.
6. The use of claim 1, wherein: The medicament comprises a pharmaceutically acceptable excipient.
7. The use of claim 6, wherein: The pharmaceutically acceptable excipient comprises at least one of a solvent, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, an aromatic agent, an anti-adhesion agent, an integrating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, an antifoaming agent, a thickening agent, a complexing agent, a humectant, an absorbent, a diluent, a flocculating agent and a deflocculating agent, a filter aid, a release retarder, a carrier.
8. The use of claim 7, wherein: The dosage form of the medicament comprises a gastrointestinal administration dosage form or a non-gastrointestinal administration dosage form.
9. The use of claim 8, wherein: The administration subject of the medicament is a mammal; Preferably, the mammal comprises a human.
10. A method for inhibiting the binding of LINC00516 to CDK1 in vitro, comprising the following steps: Treating cells with nystatin.