Drug-loaded micelles capable of effectively crossing the blood-brain barrier, and preparation method and application thereof

By regulating vesicle transport proteins through drug-loaded micelles composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex, the problem of lysosomal degradation of nanocarriers in the blood-brain barrier was solved, achieving efficient drug delivery and treatment at brain tumor sites.

CN121197436BActive Publication Date: 2026-05-19HUBEI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUBEI UNIV
Filing Date
2025-10-20
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing nanocarriers are prone to lysosomal degradation when crossing the blood-brain barrier, resulting in low crossing efficiency and difficulty in effectively delivering drugs to brain tumor sites.

Method used

Using drug-loaded micelles composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex, the transport pathway of nanocarriers in brain microvascular endothelial cells is altered by regulating vesicle transport proteins, reducing lysosomal degradation, increasing circulatory transport, and combining targeted delivery of therapeutic agents.

Benefits of technology

This technology enables highly efficient accumulation of drug-loaded micelles at brain tumor sites, improves blood-brain barrier penetration, enhances drug delivery, and facilitates synergistic chemotherapy and gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a drug-loaded micelle capable of effectively crossing the blood-brain barrier, which is an amphiphilic conjugate composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex, wherein the reduction-sensitive paclitaxel prodrug is used as a hydrophobic part, and the nucleic acid complex is used as a hydrophilic part, and the drug-loaded micelle is self-assembled in an aqueous environment; the reduction-sensitive paclitaxel prodrug is formed by the reaction of paclitaxel and a disulfide bond-containing linker; and the nucleic acid complex is formed by connecting an antisense oligonucleotide and an interfering RNA through a DNA bridge. The drug-loaded micelle exhibits superior blood-brain barrier penetration, effectively realizes enrichment in brain tumors, solves the problem of low blood-brain barrier penetration efficiency of existing nano-carriers, and provides an effective basis for brain drug delivery and brain diseases such as brain tumor imaging and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a drug-loaded micelle that can effectively cross the blood-brain barrier, its preparation method, and its application. Background Technology

[0002] Achieving efficient drug delivery to the brain is crucial for advancing neuroscience research and improving the management of neurological diseases. However, the restrictive properties of the blood-brain barrier (BBB) ​​pose a significant challenge to the effective and adequate delivery of therapeutic agents to the central nervous system. The BBB is a dynamic interface between the circulatory system and the central nervous system, composed of tightly connected brain microvascular endothelial cells (BMECs), pericytes, and astrocytes, which collectively regulate the transport of substances into and out of the brain. It has been reported that approximately 98% of small-molecule drugs and most large-molecule drugs cannot effectively penetrate the BBB, thus hindering the achievement of therapeutic concentrations at the tumor site. Therefore, there is an urgent need to develop innovative drug delivery systems capable of effectively crossing the BBB and delivering therapeutic agents to the brain.

[0003] Currently, the main strategy for enabling drug nanocarriers to cross the blood-brain barrier (BBB) ​​is receptor-mediated transcytosis (RMT). This process mainly involves three consecutive steps: (1) ligands on the nanocarrier recognize and bind to receptors on the luminal (blood) side of the BBB endothelial cells, and are subsequently endocytosed into the cells; (2) vesicle-mediated transport of the nanocarrier within the cells; and (3) exocytosis of the nanocarrier from the basal (brain) side of the BBB endothelial cells into the brain parenchyma.

[0004] The transport of nanocarriers within blood-brain barrier endothelial cells (BMECs) is closely related to the efficiency of transcytosis across the blood-brain barrier. Intracellular transport of nanocarriers involves a complex series of subcellular vesicles, including early endosomes, circulating endosomes, late endosomes, and lysosomes. After endocytosis into BMECs, most nanocarriers are initially transported to early endosomes, where they are subsequently sorted into different intracellular transport pathways. Most reported nanocarriers undergo the lysosomal pathway, i.e., transported from early endosomes to late endosomes, and then to lysosomes. Due to the presence of various hydrolytic enzymes within lysosomes and their maintenance of a unique acidic microenvironment, these nanocarriers are easily trapped and degraded in this environment, with very little escaping from lysosomes. This, in turn, inhibits exocytosis into the brain parenchyma, reducing their efficiency in crossing the blood-brain barrier. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a drug-loaded micelle that can effectively cross the blood-brain barrier, which addresses the shortcomings of the prior art. It solves the problem that existing nanocarriers are easily degraded and damaged in lysosomes during the process of crossing the blood-brain barrier through receptor-mediated transcytosis, and achieves efficient enrichment at the tumor site.

[0006] The technical solution adopted by the present invention to solve the above-mentioned problems is as follows:

[0007] A drug-loaded micelle that effectively crosses the blood-brain barrier is an amphiphilic conjugate composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex. The reduction-sensitive paclitaxel prodrug serves as the hydrophobic portion, while the nucleic acid complex serves as the hydrophilic portion. The micelles self-assemble in an aqueous environment to form the drug-loaded micelles. The reduction-sensitive paclitaxel prodrug is formed by the reaction of paclitaxel (a typical representative of antitumor drugs) and a disulfide-containing linker. The nucleic acid complex is formed by linking antisense oligonucleotides and interfering RNA with DNA bridges.

[0008] According to the above scheme, the antisense oligonucleotide is a nucleic acid that targets survivin protein; the interfering RNA is a nucleic acid that targets Rab7 protein; and the DNA bridge is a nucleic acid that can achieve base complementary pairing with the antisense oligonucleotide and the interfering RNA.

[0009] According to the above scheme, the molar ratio between the nucleic acid complex and the reduction-sensitive paclitaxel prodrug is 1:(50-100); the reduction-sensitive paclitaxel prodrug is prepared by paclitaxel and a disulfide-containing linker at a mass ratio of 1:(0.5-1).

[0010] According to the above scheme, the chemical structural formula of the linker containing disulfide bonds is: The disulfide-bonded linker can be obtained by the following preparation method: 3,3'-dithiodipropionic acid and acetic anhydride are mixed evenly in toluene and reacted for 2-4 hours to obtain an anhydride containing disulfide bonds; the anhydride containing disulfide bonds is dissolved in anhydrous dichloromethane, 4-bromomethylbenzyl alcohol and the catalyst 4-dimethylaminopyridine (DMAP) are added, and after reacting for 12-16 hours, the mixture is separated by silica gel column chromatography to obtain the disulfide-bonded linker.

[0011] Furthermore, in the above-mentioned method for preparing the disulfide-containing linker, the concentration of 3,3'-dithiodipropionic acid added to toluene is 7-10 mg / mL, and the mass ratio between 3,3'-dithiodipropionic acid and acetic anhydride is 1:(3-5); the concentration ranges of the disulfide-containing anhydride and 4-bromomethylbenzyl alcohol added to anhydrous dichloromethane are 15-25 mg / mL and 20-30 mg / mL, respectively, and the mass ratio between 4-bromomethylbenzyl alcohol and DMAP is 1:(0.04-0.08).

[0012] This invention also provides a method for preparing the above-mentioned drug-loaded micelles that effectively cross the blood-brain barrier, comprising the following steps:

[0013] (1) Paclitaxel (PTX), a linker containing disulfide bonds, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), and 4-dimethylaminopyridine (DMAP) were mixed in anhydrous dichloromethane, shaken until homogeneous, and reacted at 25-35°C for 16-30 hours. The mixture was purified by silica gel column chromatography and dried to obtain a reduction-sensitive paclitaxel prodrug, abbreviated as Pro-PTX powder.

[0014] (2) Mix DNA bridge, antisense oligonucleotide (ASO), and interfering RNA (double-stranded interfering RNA of Rab7 protein) in PBS buffer, and react at 37°C with shaking for 5-7 hours. Obtain nucleic acid complex solution through base complementary pairing, abbreviated as ASO-RNA solution;

[0015] (3) Dissolve Pro-PTX in DMSO, then add ASO-RNA solution, react at 50-60℃ for 12-16 hours, centrifuge to obtain amphiphilic conjugate precipitate; the amphiphilic conjugate precipitate self-assembles in an aqueous environment to obtain drug-loaded micelles that can effectively cross the blood-brain barrier, abbreviated as PTX-ASO-RNA.

[0016] According to the above scheme, in step (1), the concentration of the antitumor drug paclitaxel in anhydrous dichloromethane is 2-4 mg / mL; the mass ratio of the antitumor drug paclitaxel, the disulfide-containing linker, EDC, and DMAP is 1:(0.5-1):(0.3-0.5):(0.1-0.3). Additionally, silica gel column chromatography is performed using a mobile phase of petroleum ether / ethyl acetate (preferably 5:1, v / v) to purify the crude product.

[0017] According to the above scheme, in step (2), the concentration of DNA bridge added to PBS is 10-15 μM; the molar ratio between DNA bridge, antisense oligonucleotide, and interfering RNA in PBS buffer is 1:(1-3):(1-3).

[0018] According to the above scheme, in step (3), the concentration of Pro-PTX in DMSO is 0.5-1.5mM; the molar ratio of Pro-PTX to ASO-RNA is (50-100):1.

[0019] The drug-loaded micelles that effectively cross the blood-brain barrier described in this invention can be used as brain fluorescence imaging agents or brain tumor therapeutic agents. Specifically, the drug-loaded micelles are injected intravenously into the body or brain. Because the drug-loaded micelles contain fluorophores, they can be imaged using an in vivo imaging system to determine their distribution in the body; they can also be used to achieve synergistic chemotherapy and gene therapy for tumors.

[0020] The drug-loaded micelles of this invention, which effectively cross the blood-brain barrier, serve as a nanocarrier capable of delivering the chemotherapeutic drug paclitaxel and genetic material (specifically, antisense oligodeoxynucleotides and interfering RNA) to the blood-brain barrier for the treatment of brain tumors. A reduction-responsive paclitaxel prodrug, as the hydrophobic component, is covalently linked to a nucleic acid complex, as the hydrophilic component, to generate an amphiphilic conjugate, which self-assembles into the drug-loaded micelles of this invention in an aqueous environment. The nucleic acid complex consists of antisense oligodeoxynucleotides and interfering RNA double strands (i.e., siRNA double strands), specifically targeting survivin and Rab7 proteins, respectively. These drug-loaded micelles can be efficiently internalized by recognizing scavenger receptors (SRs) highly expressed on the surface of brain microvascular endothelial cells. After internalization, the siRNA double strands are released from the drug-loaded micelles in the cytoplasm by the ribonuclease Dicer, and Rab7 protein expression is inhibited via the classical RNA interference (RNAi) pathway, thereby reducing lysosome formation. The reduction in lysosomes decreases the transport of the drug-loaded micelles through lysosomal degradation. When the drug-loaded micelles of this invention are subsequently applied, they are more easily transported via the circulatory pathway, thereby improving the penetration efficiency of the blood-brain barrier and promoting the effective delivery of therapeutic agents to the brain parenchyma. This invention selected glioblastoma (a malignant brain tumor) as a model for evaluating drug delivery efficacy and treatment outcomes, demonstrating that after crossing the blood-brain barrier, the drug-loaded micelles specifically target scavenger receptors highly expressed on glioma cells, thereby enhancing their accumulation at the tumor site. Subsequently, the increased glutathione levels within tumor cells triggered the release of two model therapeutic agents—paclitaxel and antisense oligonucleotides. The downregulation of survivin expression by the antisense oligonucleotides synergistically with paclitaxel, effectively inhibiting tumor growth.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] First, the drug-loaded micelles of the present invention are composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex, exhibiting superior blood-brain barrier permeability and achieving effective enrichment in brain tumors. This solves the problem of low blood-brain barrier penetration efficiency of existing nanocarriers and provides a valid basis for brain drug delivery and brain disease imaging and treatment such as brain tumors.

[0023] Second, existing reports rarely consider the impact of nanocarrier transport behavior within brain endothelial cells on crossing the blood-brain barrier. The drug-loaded micelles described in this invention regulate the transport pathway of nanocarriers within brain microvascular endothelial cells by modulating vesicle transport proteins. This solves the problem that existing nanocarriers, during receptor-mediated transcytosis to cross the blood-brain barrier, are easily degraded and damaged in lysosomes due to lysosomal degradation. This achieves highly efficient accumulation of drug-loaded micelles as nanocarriers at tumor sites and yields good therapeutic effects.

[0024] Third, the technical concept of the drug-loaded micelles described in this invention is different from that of existing nanocarriers. It innovatively integrates the regulation of intracellular transport (nucleic acid complex) and the therapeutic means (paclitaxel prodrug) into the same carrier. The intracellular transport of the nanocarrier is changed from the lysosomal pathway to the circulatory pathway, reducing its degradation risk. At the same time, the therapeutic agent is delivered to the brain tumor site, realizing the synergistic treatment of gene and chemotherapy. Attached Figure Description

[0025] Figure 1 Transmission electron microscopy image of the drug-loaded micelles prepared in Example 1;

[0026] Figure 2 The images show confocal laser scanning microscopy images of different vesicles co-localizing with Cy5-PTX-ASO-RNA (red) in bEnd.3 cells of the experimental and control groups in Example 2; where A represents early endosomes, B represents lysosomes, and C represents circulating endosomes. In images A, B, and C, the left side represents the control group and the right side represents the experimental group.

[0027] Figure 3 This is a graph showing the crossing efficiency of the experimental and control groups in an in vitro blood-brain barrier model in Example 3.

[0028] Figure 4 These are in vivo imaging images of the experimental and control groups in the orthotopic glioma model in Example 4;

[0029] Figure 5 The image shows the therapeutic effects of drug-loaded micelles on glioma in each group of Example 5. Detailed Implementation

[0030] To better understand the present invention, the following description, in conjunction with embodiments, accompanying drawings, and applications, further clarifies the content of the present invention, but the present invention is not limited to the embodiments described below.

[0031] In the following examples, the sequence of the antisense oligonucleotide is 5'-T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*TTTCCCAGCCTTCCAGCTCCTTGCGTTACGATCCGTTACGCACC-3', where T* represents phosphate thioester modification;

[0032] The DNA bridge sequence is 5'-GAACTTCAGGGTCAGCTTGCCGGTGCGTAACGGATCGTAACG-3'; the siRNA sequence is 5'-GGCAAGCTGACCCTGAAGTTCUGCUGUGUUCUGGUGUUUGAU-3', and the complementary strand is AUCAAACACCAGAACACAGCA, together forming the interfering RNA (i.e., the siRNA double strand).

[0033] In the following examples, the disulfide-bonded linker was obtained by the following preparation method: 3,3'-dithiodipropionic acid (840 mg) and acetic anhydride (3 mL, 3240 mg) were mixed in toluene (100 mL), shaken thoroughly, and reacted for 2–4 hours to obtain the disulfide-bonded anhydride, i.e. ;

[0034] Then, the disulfide-bonded acid anhydride (608 mg) was dissolved in anhydrous dichloromethane (30 mL), and 4-bromomethylbenzyl alcohol (800 mg) and DMAP (49 mg) were added. The reaction was carried out for 12–16 hours, and then the crude product was purified by silica gel column chromatography using petroleum ether / ethyl acetate (preferably 5:1, v / v) as the mobile phase to obtain the disulfide-bonded linker. The specific reaction equation is as follows:

[0035]

[0036] Example 1

[0037] A method for preparing drug-loaded micelles that can effectively cross the blood-brain barrier, comprising the following specific steps:

[0038] (1) Mix antisense oligonucleotide ASO (3 μL, 50 μM), DNA bridge (3 μL, 50 μM) and siRNA double strand (3 μL, 50 μM) in PBS buffer (pH=7.4, 3 μL), shake at 37 ℃ for 5 h to obtain nucleic acid complex ASO-RNA aqueous solution;

[0039] (2) PTX (30 mg), disulfide linker (21 mg), EDC (12 mg) and DMAP (6 mg) were added to 10 mL of anhydrous DCM and stirred at room temperature for 24 hours to obtain crude product. The crude product was purified by silica gel column chromatography using a mixture of petroleum ether and ethyl acetate at a volume ratio of 5:1 as the mobile phase. After drying, Pro-PTX powder was obtained.

[0040] (3) Disperse Pro-PTX powder in DMSO to prepare Pro-PTX solution; then take Pro-PTX solution (1mM, 12 μL) and add it to ASO-RNA aqueous solution (12.5 μM, 12 μL), react at 55 ℃ for 12 hours, remove unreacted Pro-PTX by ultrafiltration tube, and centrifuge to obtain amphiphilic conjugate precipitate; disperse the amphiphilic conjugate precipitate in water to obtain drug-loaded micelles (PTX-ASO-RNA) that can effectively cross the blood-brain barrier.

[0041] like Figure 1 As shown, the drug-loaded micelles prepared in Example 1 are spherical with a particle size mainly concentrated in the range of 50-70 nm, about 60 nm, and are used in subsequent Examples 2-5.

[0042] Furthermore, the Cy5-labeled PTX-ASO-RNA (i.e., Cy5-PTX-ASO-RNA) involved in subsequent Examples 2-5 differs from that in Example 1 in that Cy5-ASO is used instead of ASO in the preparation method. This Cy5-PTX-ASO-RNA was also applied in subsequent Examples 2-4, mainly to facilitate fluorescence observation.

[0043] Example 2: Regulation of drug-loaded micelles in the transport pathway within brain microvascular endothelial cells

[0044] Mouse-derived brain microvascular endothelial cells (bEnd.3) were cultured at 1.0 × 10⁶ cells per dish. 6 Cells were seeded at a density of 100 μL in confocal microplates and incubated for 24 hours with 1 mL of culture medium. After adhesion, drug-loaded micelles of PTX-ASO-RNA (0.3 μM) were added to each plate. After 24 hours, the culture medium was replaced with fresh medium and Cy5-PTX-ASO-RNA (0.15 μM) was added. After 6 hours, the cells were washed three times with PBS, and this group was used as the experimental group. The difference between the control and experimental groups was that Cy5-PTX-ASO-RNA (0.15 μM) was added during the above process, but drug-loaded micelles of PTX-ASO-RNA (0.3 μM) were not added. All other procedures were the same as those for the experimental group.

[0045] Both groups of cells were labeled with anti-EEA1, a marker of early endosomes, using the EEA1 protein, and then further labeled with Cy3-anti-EEA1 antibody to stain for anti-EEA1, thus completing the staining of early endosomes. Cell nuclei were stained with Hoechst 3334 (5 μg / mL, 10 min), and cells were imaged using a laser confocal microscope. Results are as follows: Figure 2 As shown in Figure A, the early endosomes of the experimental group cells pre-cultured with PTX-ASO-RNA exhibited stronger green fluorescence and increased numbers, indicating enhanced co-localization of Cy5-PTX-ASO-RNA with early endosomes. Subsequently, the early endosomes were sorted and entered different endosome environments.

[0046] Meanwhile, lysosomes in both the experimental and control groups were labeled with a lysosomal green fluorescent probe (Lyso-TrackerGreen). The results are as follows: Figure 2 As shown in Figure B, the green fluorescence of lysosomes in the experimental group cells after pre-culturing with PTX-ASO-RNA was weakened and their number was significantly reduced, indicating a decrease in the co-localization of Cy5-PTX-ASO-RNA with lysosomes.

[0047] Accordingly, cells in both the experimental and control groups were labeled with Cy3-anti-VAMP-3 antibody to visualize circulating nuclear endosomes. The results are as follows: Figure 2 As shown in Figure C, the green fluorescence of circulating endosomes in the experimental group cells after pre-culturing with PTX-ASO-RNA was enhanced, and their numbers were significantly increased, indicating improved co-localization of Cy5-PTX-ASO-RNA with circulating endosomes.

[0048] These results indicate that drug-loaded confined PTX-ASO-RNA pre-culture modulates the intracellular transport pathway of Cy5-PTX-ASO-RNA by reducing the number of lysosomes and increasing the number of circulating endosomes, with the circulating pathway being superior to the lysosomal degradation pathway.

[0049] Comparative Example 1

[0050] Select a non-functional interfering RNA strand (nRNA, i.e., non-specific siRNA double-stranded double-stranded), link it with ASO via a DNA bridge to prepare a nucleic acid complex ASO-nRNA, and then react it with Pro-PTX to obtain the drug-loaded micelles of Comparative Example 1, abbreviated as PTX-ASO-nRNA.

[0051] The nonspecific siRNA double strand includes the sequence of the nonspecific siRNA and its complementary strand. The sequence of the nonspecific siRNA is: 5'-GGCAAGCTGACCCTGAAGTTCAUGAUGAUCAUCAUUACCAGG-3', and the complementary strand is CUGGUAAUGAUGAUCAUCAU.

[0052] Comparative Example 2

[0053] Select a non-specific ASO (i.e., nASO, a non-specific DNA sequence), ligate it with double-stranded siRNA via a DNA bridge to prepare the nucleic acid complex nASO-RNA, and then react it with Pro-PTX to obtain the drug-loaded micelles of Comparative Example 2, abbreviated as PTX-nASO-RNA. The sequence of the non-specific DNA is as follows: 5'-T* ...

[0054] Example 3: Drug-loaded micelles can cross the in vitro blood-brain barrier model

[0055] 1) An in vitro blood-brain model was constructed using 12-well Transwell chambers, with the upper chamber having a diameter of 12 mm and a pore size of 0.4 μm. hCMEC / D3 cells were cultured at a density of 5.0 × 10⁶ cells per well. 5 Cells were seeded at a density of 1000 mcg in the upper chamber. 0.5 ml of culture medium was added to the upper chamber, and 1 ml to the lower chamber. Cell growth was observed daily using a microscope. Once a dense monolayer of cells was observed to have formed, the permeability was measured using FITC-labeled dextran of different molecular weights (4 kDa, 10 kDa, 70 kDa) to verify the successful construction of the in vitro blood-brain barrier model. When the surface permeability coefficient (Papp) reached 10... -6 The achievement of speeds on the order of cm / s confirms the successful construction of the in vitro blood-brain barrier model. Furthermore, immunofluorescence staining of the upper chamber cell monolayer of Transwell cells with claudin-5 directly revealed the formation of claudin-5 between cells, further demonstrating the successful construction of the in vitro blood-brain barrier model and paving the way for subsequent permeability experiments.

[0056] 2) To evaluate the efficiency of drug-loaded micelles in crossing the blood-brain barrier (BBB), U87MG cells (human glioblastoma cells) were seeded into the lower chamber of an in vitro blood-brain barrier model. Subsequently, bEnd.3 cells were co-cultured with drug-loaded micelles of PTX-ASO-RNA (prepared in Example 1) for 24 hours, followed by incubation in the upper chamber with Cy5-labeled PTX-ASO-RNA (Cy5-PTX-ASO-RNA) for 12 hours. After this incubation period, U87MG cells were collected from the lower chamber for flow cytometry analysis. This was the experimental group.

[0057] Two control groups were also set up. The first control group consisted of bEnd.3 cells that were not co-cultured with PTX-ASO-RNA but were treated with Cy5-PTX-ASO-RNA for 12 hours. The second control group consisted of bEnd.3 cells that were pre-co-cultured with PTX-ASO-nRNA (prepared in Comparative Example 1) for 24 hours and then treated with Cy5-PTX-ASO-nRNA for 12 hours.

[0058] The results are as follows Figure 3 As shown in Figure 3, when bEnd.3 cells were not pre-cultured with PTX-ASO-RNA but only Cy5-PTX-ASO-RNA was added, a fluorescent signal of Cy5-PTX-ASO-RNA was detected in U87MG cells located in the lower chamber (Figure 3). This indicates that Cy5-PTX-ASO-RNA can cross the blood-brain barrier and reach U87MG cells. This phenomenon may be attributed to the fact that Cy5-PTX-ASO-RNA can specifically target and recognize BMECs by binding to scavenger receptors on the cell surface, thereby crossing the blood-brain barrier through receptor-mediated endocytosis (RMT). In addition, Cy5-PTX-ASO-RNA can also be effectively internalized by tumor cells by interacting with scavenger receptors highly expressed on the surface of tumor cells. In contrast, co-pre-culturing with PTX-ASO-RNA resulted in a significantly higher fluorescence intensity in U87MG cells than the group not pre-cultured with PTX-ASO-RNA. Figure 3This suggests that PTX-ASO-RNA pre-culture may enhance the permeability of drug-loaded micelles across the blood-brain barrier by altering intracellular transport pathways within brain microvascular endothelial cells (BMECs). Furthermore, the intracellular fluorescence intensity observed in U87MG cells pre-cultured with PTX-ASO-RNA was comparable to that in the unpre-cultured group. Both groups exhibited lower fluorescence intensity levels than the PTX-ASO-RNA pre-cultured group. This observed difference can be attributed to the role of siRNA. Following pre-culture of BMECs with PTX-ASO-RNA, siRNA was released from PTX-ASO-RNA and subsequently inhibited Rab7 protein expression in BMECs, thereby reducing lysosomal formation. The subsequently introduced Cy5-PTX-ASO-RNA was preferentially transported via a reabsorption pathway rather than a lysosomal degradation pathway, thus increasing the likelihood of these drug-loaded micelles crossing the blood-brain barrier and reaching U87MG cells. Conversely, due to the lack of functional siRNA in PTX-ASO-nRNA, BMECs did not modulate the intracellular transport pathway of drug-loaded micelles after pre-incubation with PTX-ASO-nRNA. Therefore, the Cy5-PTX-ASO-nRNA added in subsequent steps is primarily transported via lysosomal degradation, leading to significant degradation of Cy5-PTX-ASO-nRNA and ultimately reducing its blood-brain barrier permeability.

[0059] Example 4: Drug-loaded micelles can cross the blood-brain barrier in an orthotopic glioma model mouse.

[0060] 1) Healthy nude mice weighing approximately 20 grams were selected to construct an orthotopic glioma model. The mice were anesthetized with chloral hydrate (5%) solution and then fixed on a stereotaxic apparatus. Glioma cells (U87-Luc, 5.0 × 10⁻⁶ cells) transfected with luciferase were then introduced. 5 The cells were injected into the right striatum of nude mice. Subsequently, the growth of intracranial glioblastomas in the mice was monitored every two days using biofluorescence imaging. Seven days after inoculation, the next imaging experiment was performed.

[0061] 2) To investigate whether introducing siRNA to regulate intracellular transport pathways could improve the efficiency of drug-loaded micelles crossing the blood-brain barrier in vivo, drug-loaded micelles PTX-ASO-RNA (prepared in Example 1) were first administered to tumor-bearing mice via tail vein injection. Twenty-four hours after the initial injection, the mice received a second tail vein injection of Cy5-PTX-ASO-RNA. This was the experimental group.

[0062] Two control groups were set up. The first control group consisted of mice that received only a single injection of Cy5-PTX-ASO-RNA. The second control group consisted of mice that received an injection of PTX-ASO-nRNA (prepared in Comparative Example 1) within 24 hours, followed by an injection of Cy5-labeled PTX-ASO-nRNA (i.e., Cy5-PTX-ASO-nRNA).

[0063] The results are as follows Figure 4 As shown, compared to the two control groups (i.e., the untreated group and the treated group), the experimental group receiving PTX-ASO-RNA pretreatment exhibited significantly stronger fluorescence signals in the tumor region at different time points. This indicates that PTX-ASO-RNA pretreatment promotes more efficient penetration of subsequently administered Cy5-PTX-ASO-RNA across the blood-brain barrier, thereby increasing its accumulation at the brain tumor site. This phenomenon can be attributed to the regulatory role of siRNA in PTX-ASO-RNA, which affects the intracellular transport pathway of Cy5-PTX-ASO-RNA subsequently injected into BMECs. This regulation promotes preferential transport of drug-loaded micelles via the recycling pathway, thereby reducing their degradation in lysosomes. Therefore, this enhances their transport across the blood-brain barrier and increases their accumulation at the tumor site. Furthermore, the accumulation levels in the brain were similar in the two control groups. This result can be attributed to the absence of functional siRNA in PTX-ASO-nRNA, which does not alter the intracellular transport pathway of Cy5-PTX-ASO-nRNA injected in subsequent steps, and therefore does not affect its blood-brain barrier permeability.

[0064] Example 5: Drug-loaded micelles can provide effective chemotherapy and gene synergistic therapy for brain tumors.

[0065] 1) First, select healthy nude mice weighing approximately 20g and inject them intraperitoneally with 5% chloral hydrate to induce anesthesia and coma. Then, fix the mice on a brain localization device and inject 5.0 × 10⁻⁶ chloral hydrate into the right striatum of their brains. 5 Glioma cells (U87MG-Luc) transfected with luciferase. Seven days after cell inoculation, mice were treated with medication to treat brain tumors.

[0066] 2) The drug-loaded micelles tested included PTX-ASO-RNA (prepared in Example 1), PTX-ASO-nRNA (prepared in Comparative Example 1), and PTX-nASO-RNA (prepared in Comparative Example 2), with PBS used as a blank control group. Seven days after inoculation, these drug-loaded micelles were administered via tail vein, followed by a second injection 24 hours later. Tumor size in mice was assessed every other day using bioluminescence imaging, and tumor growth curves were subsequently plotted.

[0067] The results are as follows Figure 5 As shown, mice receiving PBS showed the strongest bioluminescent signal in their brains, indicating accelerated tumor growth. In contrast, mice receiving PTX-ASO-RNA injections showed relatively weaker bioluminescent signals than those receiving PTX-ASO-nRNA injections, suggesting that PTX-ASO-RNA more effectively inhibited tumor growth. This result can be attributed to the regulatory effect of PTX-ASO-RNA on the blood-brain barrier transport pathway during the initial injection, allowing PTX-ASO-RNA to cross the blood-brain barrier more effectively in subsequent injections. Therefore, PTX-ASO-RNA can effectively accumulate in the brain tumor region, thereby maximizing its tumor-inhibiting efficacy. Furthermore, the bioluminescent signal in the brains of mice in the PTX-nASO-RNA group was stronger than that in the PTX-ASO-RNA group, indicating that the combination of PTX-mediated chemotherapy and ASO-mediated gene therapy significantly improved the therapeutic effect.

[0068] Example 6

[0069] A method for preparing drug-loaded micelles that can effectively cross the blood-brain barrier, comprising the following specific steps:

[0070] (1) Mix antisense oligonucleotide ASO (3 μL, 50 μM), DNA bridge (3 μL, 50 μM) and siRNA double strand (3 μL, 50 μM) in PBS buffer (pH=7.4, 3 μL), shake at 37 ℃ for 7 h to obtain nucleic acid complex ASO-RNA aqueous solution;

[0071] (2) PTX (20 mg), disulfide linker (14 mg), EDC (6 mg) and DMAP (2 mg) were added to 10 mL of anhydrous DCM and stirred at room temperature for 30 hours. The mixture was purified by silica gel column chromatography using a mixture of petroleum ether and ethyl acetate at a volume ratio of 4:1 as the mobile phase. After drying, Pro-PTX powder was obtained.

[0072] (3) After dispersing Pro-PTX powder in DMSO, a Pro-PTX solution was prepared. Then, the Pro-PTX solution (1.25 mM, 12 μL) was added to ASO-RNA aqueous solution (12.5 μM, 12 μL). The reaction was carried out at 55 °C for 16 hours. Unreacted Pro-PTX was removed by ultrafiltration tube and centrifugation was performed to obtain an amphiphilic conjugate precipitate. The amphiphilic conjugate precipitate was dispersed in water to obtain drug-loaded micelles that can effectively cross the blood-brain barrier.

[0073] Example 7

[0074] A method for preparing drug-loaded micelles that can effectively cross the blood-brain barrier, comprising the following specific steps:

[0075] (1) Mix antisense oligonucleotide ASO (3 μL, 50 μM), DNA bridge (3 μL, 50 μM) and siRNA double strand (3 μL, 50 μM) in PBS buffer (pH=7.4, 3 μL), shake at 37 ℃ for 6 h to obtain nucleic acid complex ASO-RNA aqueous solution;

[0076] (2) PTX (40 mg), disulfide linker (40 mg), EDC (20 mg) and DMAP (12 mg) were added to 10 mL of anhydrous DCM and stirred at room temperature for 16 hours. The mixture was purified by silica gel column chromatography using a mixture of petroleum ether and ethyl acetate at a volume ratio of 6:1 as the mobile phase. After drying, Pro-PTX powder was obtained.

[0077] (3) After dispersing Pro-PTX powder in DMSO, a Pro-PTX solution was prepared. Then, the Pro-PTX solution (0.8 mM, 12 μL) was added to ASO-RNA aqueous solution (12.5 μM, 12 μL). The reaction was carried out at 55 °C for 14 hours. Unreacted Pro-PTX was removed by ultrafiltration tube and centrifugation was performed to obtain an amphiphilic conjugate precipitate. The amphiphilic conjugate precipitate was dispersed in water to obtain drug-loaded micelles that can effectively cross the blood-brain barrier.

[0078] In summary, the drug-loaded micelles described in this invention exhibit superior blood-brain barrier penetration, achieving effective enrichment in brain tumors and solving the problem of low blood-brain barrier penetration efficiency of existing nanocarriers. This provides a valid basis for brain drug delivery and imaging and treatment of brain diseases such as brain tumors. Furthermore, the drug-loaded micelles of this invention innovatively integrate the regulation of intracellular transport and therapeutic mechanisms into the same carrier. The intracellular transport of the nanocarrier shifts from the lysosomal pathway to the circulating pathway, reducing the risk of degradation, while simultaneously delivering therapeutic agents to the brain tumor site, achieving synergistic gene and chemotherapy therapy. This innovative method of this invention also provides a new perspective for the development of other delivery systems in the field of neuroscience and offers ideas for the treatment of various brain-related diseases.

[0079] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the inventive concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A drug-loaded micelle that effectively crosses the blood-brain barrier, characterized in that, It is an amphiphilic conjugate composed of a reduction-sensitive antitumor drug prodrug and a nucleic acid complex. The reduction-sensitive antitumor drug prodrug serves as the hydrophobic portion, and the nucleic acid complex serves as the hydrophilic portion. It self-assembles in an aqueous environment to form drug-loaded micelles. The reduction-sensitive antitumor drug prodrug is formed by the reaction of an antitumor drug with a disulfide-containing linker. The nucleic acid complex is formed by linking an antisense oligonucleotide and interfering RNA via a DNA bridge. The antisense oligonucleotide is a nucleic acid targeting survivin protein; the interfering RNA is a nucleic acid targeting Rab7 protein; and the DNA bridge is a nucleic acid capable of base-complementary pairing with both the antisense oligonucleotide and the interfering RNA. The sequence of the antisense oligonucleotide is 5'-T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*TTTCCCAGCCTTCCAGCTCCTTGCGTTACGATCCGTTACGCACC-3', where T* indicates phosphate thioester modification; the interfering RNA consists of siRNA and complementary strand, the siRNA sequence is 5'-GGCAAGCTGACCCTGAAGTTCUGCUGUGUUCUGGUGUUUGAU-3', and the complementary strand sequence is AUCAAACACCAGAACACAGCA; the DNA bridge sequence is 5'-GAACTTCAGGGTCAGCTTGCCGGTGCGTAACGGATCGTAACG-3'.

2. The drug-loaded micelles that effectively cross the blood-brain barrier according to claim 1, characterized in that, The reduction-sensitive antitumor drug prodrug is prepared by reacting an antitumor drug with a disulfide-containing linker at a mass ratio of 1:(0.5-1); wherein the chemical structural formula of the disulfide-containing linker is: .

3. The drug-loaded micelles that effectively cross the blood-brain barrier according to claim 1, characterized in that, The molar ratio between the nucleic acid complex and the reduction-sensitive antitumor drug prodrug is 1:(50-100).

4. The method for preparing drug-loaded micelles that effectively cross the blood-brain barrier as described in claim 1, characterized in that, The main steps include: (1) 3,3'-dithiodipropionic acid and acetic anhydride are mixed evenly in toluene and reacted to obtain an anhydride containing disulfide bonds; the anhydride containing disulfide bonds is dissolved in anhydrous dichloromethane, and 4-bromomethylbenzyl alcohol and DMAP are added and reacted to obtain a linker containing disulfide bonds. (2) After the antitumor drug, the disulfide-containing linker, EDC and DMAP are mixed and reacted evenly in anhydrous dichloromethane, a reduction-sensitive antitumor drug prodrug, abbreviated as Pro-PTX powder, is obtained. (3) Mix the DNA bridge, antisense oligonucleotide and interfering RNA evenly in the buffer solution to obtain a nucleic acid complex solution, abbreviated as ASO-RNA solution; (4) Dissolve Pro-PTX in DMSO, add ASO-RNA solution to react and obtain an amphiphilic conjugate precipitate; the amphiphilic conjugate precipitate self-assembles in an aqueous environment to obtain drug-loaded micelles that can effectively cross the blood-brain barrier.

5. The method for preparing drug-loaded micelles that effectively cross the blood-brain barrier according to claim 4, characterized in that, In step (1), the concentration of 3,3'-dithiodipropionic acid added to toluene is 7-10 mg / mL, and the mass ratio between 3,3'-dithiodipropionic acid and acetic anhydride is 1:(3-5); the concentration ranges of the disulfide-containing anhydride and 4-bromomethylbenzyl alcohol added to anhydrous dichloromethane are 15-25 mg / mL and 20-30 mg / mL, respectively, and the mass ratio between 4-bromomethylbenzyl alcohol and DMAP is 1:(0.04-0.08).

6. The method for preparing drug-loaded micelles that effectively cross the blood-brain barrier according to claim 4, characterized in that, In step (2), the concentration of the antitumor drug in anhydrous dichloromethane is 2-4 mg / mL; the mass ratio of the antitumor drug, the disulfide-containing linker, EDC, and DMAP is 1:(0.5-1):(0.3-0.5):(0.1-0.3).

7. The method for preparing drug-loaded micelles that effectively cross the blood-brain barrier according to claim 4, characterized in that, In step (3), the concentration of the DNA bridge added to the buffer is 10-15 μM; the molar ratio between the DNA bridge, antisense oligonucleotide, and interfering RNA is 1:(1-3):(1-3).

8. The method for preparing drug-loaded micelles that effectively cross the blood-brain barrier according to claim 4, characterized in that, In step (4), the concentration of Pro-PTX in DMSO is 0.5-1.5 mM; the molar ratio between Pro-PTX and ASO-RNA is (50-100):

1.

9. The use of the drug-loaded micelles according to claim 1 in the preparation of brain tumor therapeutic agents.