Method for improving photosynthetic efficiency of synechocystis

By overexpressing the sll5097 gene in Synechocystis PCC 6803, the problem of improving photosynthetic efficiency and growth phenotype of cyanobacteria was solved, and significant improvements were achieved in growth rate, chlorophyll production and oxygen release activity, thus optimizing photosynthetic efficiency and growth performance.

CN121204084APending Publication Date: 2025-12-26CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410815702.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-24
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the photosynthetic efficiency and growth phenotype of cyanobacteria, especially the photosynthetic carbon and nitrogen fixation and growth performance of Synechocystis 6803.

Method used

By overexpressing the sll5097 gene in Synechocystis PCC 6803, the sll5097 gene was integrated into the host cell genome using gene editing technology or expressed by plasmid transformation. The p0168 plasmid vector and the Pcpc560 strong promoter were preferred for regulation.

Benefits of technology

It significantly improved the growth rate, chlorophyll production, and oxygen release activity of Synechocystis, resulting in faster growth, better physiological phenotype, and optimized photosynthetic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0004907538510000011
    Figure HDA0004907538510000011
Patent Text Reader

Abstract

The invention discloses a method for improving the photosynthetic efficiency of blue-green algae. The method comprises the following steps: enabling the blue-green algae to over-express an sll5097 gene with the GenBank number of BAD01867.1; the synechocystis overexpression sll5097 gene can grow faster, and the physiological phenotype is better.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to a method for improving the photosynthetic efficiency and growth phenotype of cyanobacteria, and more particularly to a method for improving the photosynthetic carbon and nitrogen fixation and growth phenotype of Synechocystis 6803. Background Technology

[0002] Cyanobacteria are an ancient group of Gram-negative prokaryotes capable of aerobic photosynthesis. They are considered producers of oxygen (O2) in Earth's atmosphere and ancestors of plant chloroplasts. Cyanobacteria can efficiently (3-9%) capture solar energy to power their highly efficient photoautotrophic metabolism, converting large amounts of inorganic carbon (CO2, NaHCO3, and Na2CO3) and nitrogen (N2, NH4) into nitrogen. + NO2 - NO3 - (or urea) is fixed into a huge biomass, thus supporting most of the food chain.

[0003] Among all cyanobacteria, *Synechocystis* sp. PCC 6803 is one of the most extensively studied species. Since its initial isolation from a freshwater lake in 1968, its entire genome, including four endogenous plasmids, has been fully sequenced, with functional annotations completed for over 3,000 genes to date. *Synechocystis* sp. PCC 6803 exhibits diverse carbon metabolism, enabling it to grow under photoautotrophic, mixed trophic, or heterotrophic conditions. Furthermore, the biochemical similarity between plant chloroplasts and *Synechocystis* sp. PCC 6803 makes it an ideal system for studying the molecular mechanisms of stress responses and adaptations in higher plants. More importantly, *Synechocystis* sp. PCC 6803 possesses the ability to spontaneously transform; exogenous DNA molecules introduced into the cell through spontaneous transformation can integrate into the genome via bihomological recombination or replicate independently on suitable plasmids. Therefore, *Synechocystis* is widely used in the biotechnology field to construct engineered strains for the production of various industrially relevant chemical products. Currently, metabolic engineering of cyanobacteria has successfully enabled the large-scale production of compounds such as ethanol, butanol, lactic acid, ethylene, and terpenes. However, the biosynthesis and accumulation of other metabolites, including biopharmaceutical proteins, isoprene pathway enzymes, plant essential oils, and potential biofuels, require further research and breakthroughs. Overall, advancements in cyanobacterial cell factories have opened up new possibilities for the sustainable production of various valuable compounds.

[0004] In recent years, research and development in the field of cyanobacteria biotechnology has made significant progress and attracted widespread attention. Cyanobacteria, acting as both photocatalysts and cellular processors, exhibit highly efficient photosynthesis, converting inorganic carbon into a range of valuable biological products. With the development of light-driven synthesis platforms and regulatory tools, and a deeper understanding of metabolic mechanisms such as photosynthetic carbon fixation and central metabolism, the formation of various highly efficient cell factories in the synthesis of biofuel products and bio-based chemicals will be further promoted. The application of cyanobacterial cell factories and light-driven synthetic biology will, to some extent, mitigate the adverse effects of carbon dioxide (CO2) on ecosystems, providing impetus for green biomanufacturing and sustainable economic development. Summary of the Invention

[0005] In our research on the photosynthetic mechanism of cyanobacteria, we found that the sll5097 gene has a significant impact on the photosynthetic efficiency and growth phenotype of Synechocystis. Overexpression of this gene can significantly improve the growth rate, chlorophyll production, and oxygen release activity of cyanobacteria. Based on the above research results, this invention provides the following technical solution.

[0006] The first aspect of the present invention provides the application of the sll5097 gene in improving the photosynthetic efficiency of cyanobacteria and / or improving the growth phenotype of cyanobacteria.

[0007] As a specific application, a method is provided to improve the photosynthetic efficiency and growth phenotype of cyanobacteria, including the following steps: overexpressing the sll5097 gene in cyanobacteria.

[0008] sll5097 is located on the pSYSM plasmid of Synechocystis sp. PCC 6803 and is highly similar to the Synechocystis6714Sly4000560 protein. The expression level of sll5097 is upregulated in the heat-response protein mutants Δsll1130 and Δssl2245 compared to the wild type.

[0009] Preferably, the cyanobacterium is Synechocystis sp. PCC 6803.

[0010] In one embodiment, the sll5097 gene is derived from Synechocystis sp. PCC 6803, GenBank accession number BAD01867.1.

[0011] The above overexpression can be achieved by: transforming a recombinant plasmid containing the sll5097 gene into a host cell; or integrating the sll5097 gene into the host cell genome using gene editing technology.

[0012] Preferably, the overexpression is carried out by plasmid transformation, including the following steps: subcloning the sll5097 gene into a plasmid vector suitable for expression in cyanobacteria such as Synechocystis to form a recombinant plasmid, and transforming the recombinant plasmid into the host cells of cyanobacteria such as Synechocystis by natural transformation, heat shock, chemical transformation or electrotransformation.

[0013] The aforementioned overexpression can also be implemented using gene editing technology to integrate single or multiple copies of the sll5097 gene into the host cell genome. The gene editing technology can be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0014] Preferably, the plasmid vector of the recombinant plasmid is a plasmid vector suitable for expressing exogenous genes in cyanobacteria, such as p0168, pLS103, pBAS series, pCB4, pPRS-1, etc., preferably p0168, and the sll5097 gene is placed under the regulation of the Pcpc560 strong promoter.

[0015] Furthermore, the recombinant plasmid also carries the chloramphenicol resistance gene (Cm) sequence.

[0016] For example, the recombinant plasmid is constructed through the following steps: amplifying the CDS region sequence fragment of the sll5097 gene with homologous arm sequences from the genomic DNA of wild-type Synechocystis PCC 6803, or artificially synthesizing the CDS region sequence fragment of the sll5097 gene; simultaneously amplifying the overexpression vector p0168-Pcpc560 with the strong promoter Pcpc560, which carries the chloramphenicol resistance gene sequence; ligating the two fragments into a recombinant vector using homologous recombinase, transforming it into Escherichia coli DH5α for amplification, screening positive clones for sequencing, thereby obtaining the overexpression vector plasmid of the Synechocystis sll5097 gene, named p0168-Cm-Pcpc560-sll5097-0168.

[0017] A second aspect of the present invention provides a recombinant plasmid containing the sll5097 gene for overexpressing the sll5097 gene in cyanobacteria, the nucleotide sequence of which is SEQ ID NO:10.

[0018] A third aspect of the present invention provides a *Syntrophus cytogenes* engineered bacterium, which is constructed according to the method described above, for example, a transformant containing the recombinant plasmid SEQ ID NO:10 described above.

[0019] A fourth aspect of the present invention provides the application of the above-mentioned engineered strain of Synechocystis in the fermentation production of ethanol, butanol, lactic acid, ethylene or terpene compounds.

[0020] Experimental results showed that overexpression of the sll5097 gene in Synechocystis PCC 6803 could improve the growth rate, chlorophyll production and oxygen release activity of Synechocystis, resulting in a Synechocystis PCC 6803 strain with faster growth and better physiological phenotype. Attached Figure Description

[0021] Figure 1 The plasmid structure of the sll5097 gene overexpression vector p0168-Cm-Pcpc560-sll5097-0168 is shown.

[0022] Figure 2 The image shows a gel electrophoresis photograph of the PCR positive identification map of the sll5097 overexpressing line sll5097OE9.

[0023] Figure 3 The expression levels of the sll5097 gene were detected in the wild-type (WT) and three sll5097 overexpression lines: sll5097OE3, sll5097OE7, and sll5097OE9.

[0024] Figure 4 The images show a comparison of plate growth phenotypes of wild-type (WT) and three sll5097 gene overexpression lines, sll5097OE3, sll5097OE7 and sll5097OE9, under different culture conditions: pH 8.0, HC (High CO2), LC (Low CO2), NL (Normallight) and HL (High light).

[0025] Figure 5 The bar charts and growth phenotype comparisons of chlorophyll content between wild-type (WT) and sll5097 overexpression line sll5097OE9 under HC (High CO2) and LC (Low CO2) treatments are shown.

[0026] Figure 6 The bar chart shows the comparison of oxygen evolution activity (oxygen release) between wild-type (WT) and sll5097 gene overexpression line sll5097OE9 under HC (High CO2) and LC (Low CO2) treatment conditions.

[0027] Figure 7 This study compares the transient increase in chlorophyll fluorescence after light-off treatment in the wild-type (WT) and sll5097 overexpressing line sll5097OE9 under HC (High CO2) and LC (Low CO2) treatments. The top figure shows the chlorophyll fluorescence changes from light on to light off under HC and LC treatments, respectively; the bottom figure shows the instantaneous increase in chlorophyll fluorescence after light-off treatment under HC and LC treatments, respectively. Detailed Implementation

[0029] The research content of this invention is to optimize the photosynthetic efficiency of Synechocystis PCC 6803 by modifying the genome of Synechocystis PCC 6803, overexpressing the sll5097 gene, and obtaining a Synechocystis PCC 6803 strain with faster growth and better physiological phenotype.

[0030] To this end, we analyzed and screened genes and proteins that may affect the photosynthetic efficiency and growth phenotype of cyanobacteria, especially Synechocystis. We found that the sll5097 gene can promote the photosynthesis of Synechocystis PCC 6803. Overexpression of the sll5097 gene in wild-type Synechocystis PCC 6803 resulted in recombinant strains of Synechocystis with improved growth rate, chlorophyll production, and oxygen release activity. This provides a genetic strategy for creating engineered cyanobacterial bacteria with optimized photosynthetic efficiency and / or growth phenotype.

[0031] As used herein, the terms “(growth rate, chlorophyll production, oxygen release activity) increase,” “enhancement,” or “enhancement” can mean an increase of at least 10% compared to a reference level (e.g., wild-type cyanobacteria such as Synechocystis PCC 6803 / starting strain), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0032] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0033] In this article, the terms "recombinant bacteria (strain)" and "(genetically) engineered bacteria (strain)" have the same meaning, referring to strains that have been genetically modified to improve the growth traits / phenotype of wild-type cyanobacteria such as Synechocystis PCC 6803 or the starting strain.

[0034] To achieve overexpression of the sll5097 gene in host cyanobacterial cells, the sll5097 gene can be artificially synthesized, such as the sll5097 gene derived from Synechocystis PCC 6803 (GenBank ID: BAD01867.1). This gene can be used as a foreign gene to construct a gene expression cassette or expression construct. The expression cassette / expression construct can then be operatively linked to a plasmid vector suitable for expression in cyanobacterial cells through subcloning to obtain a recombinant plasmid. The recombinant plasmid can then be transformed into host cells to obtain transformants, i.e., genetically engineered cyanobacterial strains or recombinant bacteria, which serve as a cyanobacterial development platform.

[0035] As used herein, the term "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express the target gene sll5097. Typically, it includes the following elements: a promoter such as the Pcpc560 strong promoter, a sll5097 gene sequence fragment, and a terminator; additionally, it may optionally include signal peptide coding sequences, etc.; these elements are operatively linked.

[0036] As used herein, an "expression construct" or "expression building block" refers to a recombinant DNA molecule containing one or more intended sll5097 gene sequences, which may contain one or more gene expression cassettes. The "construct" is typically contained within an expression vector (plasmid vector).

[0037] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0038] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of a target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.

[0039] In some embodiments, the sll5097 gene expression construct, or "nucleic acid construct," is a plasmid vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The sll5097 gene of this invention can be cloned into many types of vectors, as long as they can express the sll5097 gene in cyanobacteria such as Synechocystis PCC 6803, such as plasmids, phage particles, phage derivatives, animal viruses, and granules. Cloning vectors can be used to provide the sll5097 gene sequence of this invention. Expression vectors can be provided to cells in the form of bacterial or viral vectors. Expression of the polynucleotides of this invention is typically achieved by operably linking the polynucleotides of this invention to a promoter and incorporating the construct into the expression vector. This vector is suitable for replicating and integrating into cyanobacteria such as Synechocystis PCC 6803 cells. Typical expression vectors contain expression control sequences that can be used to regulate the expression of the desired nucleic acid sequence.

[0040] Gene knock-in vectors can be used to integrate the polynucleotide sequences described herein into regions of interest in the genome. Typically, gene knock-in vectors contain, in addition to the polynucleotide sequences described herein, 5' and 3' homologous arms required for genomic homologous recombination. In some embodiments, the nucleic acid constructs described herein contain 5' homologous arms, the polynucleotide sequences described herein, and 3' homologous arms. When using gene knock-in vectors, CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequences into the sites of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion site by designing guide RNAs targeting the target gene, resulting in increased homologous recombination efficiency in the modified region, thus homologously recombinating the target fragment contained in the gene knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0041] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the strong promoter Pcpc560 for cyanobacteria; the lac or trp promoter for Escherichia coli; the PL promoter for λ phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Furthermore, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or chloramphenicol resistance, tetracycline or ampicillin resistance for cyanobacteria.

[0042] When the polynucleotides of this invention are expressed in cyanobacteria such as Synechocystis PCC 6803, the insertion of an enhancer sequence into the vector will enhance transcription. Enhancers are cis-acting factors of DNA, typically approximately 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polytumor enhancer located late on the replication origin side, and adenovirus enhancers.

[0043] The experimental results in the examples, using wild-type and sll5097 gene overexpression lines under different culture conditions (HC (High CO2), LC (Low CO2), NL (Normal light), and HL (High light), demonstrated that the invention achieved unexpected results and provided a new genetic strategy for optimizing cyanobacterial strains and promoting the application of cyanobacteria in industrial fuel or chemical production.

[0044] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0045] Example

[0046] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage.

[0047] In the above embodiments, unless otherwise specified, the reaction temperature or operating temperature generally refers to room temperature (15-30°C).

[0048] Materials and methods

[0049] The molecular biology experiments in this article, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were based on Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments when necessary.

[0050] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0051] In this embodiment, primer synthesis was commissioned to Platinum Biotech (Shanghai) Co., Ltd., and gene sequencing was commissioned to Qingke Biotechnology (Shanghai) Co., Ltd.

[0052] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium with an additional 20 g / L agar powder.)

[0053] Escherichia coli DH5α competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0054] 2×Taq PCR MasterMix was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and the agarose gel DNA recovery kit was purchased from Shanghai Baisai Biotechnology Co., Ltd.

[0055] The homologous recombinase ClonExpress II One Step Cloning Kit and the high-fidelity enzyme phanta Max Super-Fidelity DNA Polymerase were both purchased from the commercially available Novizan products of Shanghai Jiangchu Biotechnology Development Center.

[0056] BG-11 medium: (Solid medium with an additional 20 g / L agar powder.)

[0057]

[0058]

[0059] The PCR primers used in the examples are listed in Table 1.

[0060] Table 1. Primers used in the construction examples for recombinant plasmids

[0061] Name of PCR primer Primer sequence (5'-3') Sequence number sll5097-same F (F1) AAGTAGGAGATTAATTCAATGACGGCTCAAAAT 1 sll5097-same R (R1) GACAATCCAAACACCGGTTCATTCAAAATCTCC 2 sll5097-middle F (F2) TAGAGGTCGGAGGGCTTCAG 3 p0168-F (F3) GTTGGACAGTACTCCTTTGGAAATG 4 p0168-R (R3) TTGGGTCCCAAGTTTGTGCT 5 Name of qPCR primer Primer sequence sll5097-qF (F4) GCGTTTAGGGAGTTCCGTTTAG 6 sll5097-qR (R4) TACTTCGTGGAGGCAATTGC 7 rnpB-qF (F5) AGTTAGGGAGGGAGTTGCGGATT 8 rnpB-qR (R5) CCTTGGGGAGTTATCTATCTGGGAA 9

[0062] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0063] It should be noted that, for the sake of convenience, in the embodiments, the plasmid number and the corresponding strain number may sometimes share the same number. This is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.

[0064] Example 1: Construction of sll5097 gene overexpression vector

[0065] The sll5097 gene used is derived from wild-type Synechocystis PCC 6803. An overexpression vector of the Pcpc560 strong promoter was constructed using homologous recombination technology, including the following steps.

[0066] Using primers F1 and R1 (listed in Primer Table 1) as upstream and downstream primers, respectively, the CDS region sequence fragment of the sll5097 gene with homologous arm sequences was amplified from the genomic DNA of wild-type Synechocystis PCC 6803. Simultaneously, the overexpression vector p0168-Pcpc560, containing the strong promoter Pcpc560 and carrying the chloramphenicol resistance gene sequence, was amplified in reverse. The two fragments were ligated into a recombinant vector using homologous recombinase, transformed into E. coli DH5α for amplification, and positive clones were screened and sequenced to obtain the overexpression vector plasmid of the Synechocystis sll5097 gene, named p0168-Cm-Pcpc560-sll5097-0168. Its structural diagram is shown below. Figure 1 As shown.

[0067] The PCR amplification system consisted of: 2 μL wild-type Synechocystis PCC 6803 genomic DNA, 2 μL each of F / R primers (10 μM), 25 μL 2×phanta Max Buffer, 1 μL dNTP Mix, 1 μL phanta Max Super-Fidelity DNA Polymerase (Novizan), and 17 μL ddH2O, for a total volume of 50 μL.

[0068] The amplification reaction program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, 60℃ for 15 sec / kb, 72℃ for 2 min, for a total of 35 cycles; extension at 72℃ for 5 min.

[0069] Example 2: Transformation, screening, and identification of sll5097 gene overexpression lines

[0070] 1. Transformation and screening of sll5097 gene overexpression lines

[0071] Wild-type Synechocystis PCC 6803 was cultured in BG-11 liquid medium until OD2000. 730 =0.5, the culture conditions were a 30℃ light incubator and an illumination of 80 μmol photon·m -2 ·s -1 Take 1 mL of culture medium, centrifuge at 5000 g for 5 min at room temperature, and discard the supernatant. Wash once with fresh BG-11 liquid medium, centrifuge again, remove the culture medium, and resuspend the cyanobacterial cell precipitate in 300 μL of BG-11 liquid medium. Take 150 μL of the resuspended precipitate and add 1 μg of the sll5097 gene overexpression vector p0168-Cm-Pcpc560-sll5097-0168 constructed in Example 1. Gently mix, wrap with aluminum foil, and place in a cyanobacterial incubator for 2 h. Unwrap the foil and place under light for 4–5 h, gently mixing during this period. Then, spread the mixture onto a BG-11 solid culture plate containing 10 μg / mL chloramphenicol and invert it in a light incubator for culture. After single colonies grew on the plate, a single colony was picked and streaked onto BG-11 solid medium containing chloramphenicol. Then, a small amount of single colony was picked for preliminary PCR identification of the overexpression line. The small amount of single colony was used as the PCR template. The primers for identifying the overexpression line were F3 and R1. The enzyme was 2×Hieff PCRMaster Mix (Yeasen). The reaction program was as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 sec, 60℃ for 30 sec / kb, 72℃ for 2 min, for a total of 30 cycles; extension at 72℃ for 5 min. Figure 2 The image shown is an agarose gel electrophoresis image of the sll5097 gene overexpression line sll5097OE9. Cyanobacteria that were identified as positive transgenic lines were transferred to BG-11 liquid medium containing chloramphenicol and cultured. After three generations, genomic DNA was extracted, and PCR was performed for positive identification and sequencing. RNA was also extracted for qPCR experiments to detect gene expression levels (see [link to article]). Figure 3 ).

[0072] 2. Identification of sll5097 gene overexpression lines

[0073] Genomic DNA extraction: Take 2 mL of wild-type and overexpression cyanobacteria cultured for 5 days into centrifuge tubes, centrifuge at 5000 rpm for 10 min, and discard the supernatant; add 400 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 10). 8.0), mix well, transfer to a new EP tube; add an equal volume of Tris-HCl saturated phenol (absorb the lower layer), add an appropriate amount of steel powder; vortex vigorously several times (10 seconds each time), place on ice for 10 min; centrifuge at 12000 rpm for 5 min, collect the supernatant; add an equal volume of chloroform / isoamyl alcohol in a fume hood, mix well, centrifuge at 12000 rpm for 5 min, collect the supernatant; add 2 volumes of anhydrous ethanol and 1 / 10 volume of sodium acetate (pH 5.2), mix well, place on ice for 30 min, centrifuge at 12000 rpm for 15 min, discard the supernatant; add 1 mL of 70% ethanol, centrifuge at 12000 rpm for 5 min, discard the supernatant; let stand for 2 min; add an appropriate amount of sterile water to dissolve, and the resulting DNA solution can be stored at -20℃.

[0074] PCR positive identification: The extracted DNA was used as a template, and the overexpression identification primers were F3 and R3. The reaction program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, 60℃ for 15 sec / kb, 72℃ for 2 min, for a total of 35 cycles; extension at 72℃ for 5 min. Figure 2 Electrophoretic images of PCR amplification fragments from the sll5097 OE9 strain, which overexpresses the sll5097 gene, are shown. The detected overexpression PCR products were sent to the company for sequencing.

[0075] RNA extraction: collecting OD 730Centrifuge 25 mL of cyanobacterial culture medium (1.5 g / mL) at 5000 g for 2 min, discard the supernatant, resuspend in 1 mL of ddH2O, transfer to a 2 mL tube, centrifuge again, aspirate the supernatant, cap and place in liquid nitrogen; remove the sample, add an equal volume of glass microspheres and a large steel ball, and place in liquid nitrogen again; pre-cool the fragmentation plate in liquid nitrogen, and fragment the sample twice using a fragmenter at 55 Hz for 60 s, then quickly place the sample in liquid nitrogen; immediately add 1 mL of ddH2O to the sample. Mix RNAiso, vortex to mix, and aspirate 1000 μL of the supernatant into a new EP tube. Incubate at room temperature for 5 min, then centrifuge at 12000 rpm and 4°C for 5 min. Aspirate 800 μL of the supernatant into a new tube, add 1 / 5 volume of chloroform, vortex to mix for 15 s, incubate at room temperature for 5 min, then centrifuge at 12000 rpm and 4°C for 10 min. Aspirate 300 μL of the supernatant into a new tube, add an equal volume of isopropanol, vortex to mix, incubate at room temperature for 20 min, then centrifuge at 12000 rpm and 4°C for 10 min. Discard the supernatant, add 1 mL of 75% ethanol, mix gently, centrifuge again for 5 min, aspirate the supernatant, and centrifuge for 2 min. Aspirate the liquid with a fine pipette tip, open the cap and place on ice for 1 min, then add 50 μL of RNase-free water.

[0076] Gene expression level detection: using III. The RNA was synthesized into cDNA using the 1st Strand cDNA Synthesis SuperMix for qPCR reverse transcription kit (Yeasen). Using the obtained cDNA as a template and the *Synapticus rnpB* gene as an internal reference gene, the expression level of the *sll5097* gene was analyzed. Following the Hieff... The reaction was prepared according to the instructions of Universal BlueqPCR SYBR Master Mix, and qRT-PCR was performed using a Bio-Rad quantitative PCR instrument. Reaction system: Each PCR consisted of 10 μL of 2×SYBR Green Master Mix, 10 nM F / R primers (F4 / R4 and F5 / R5), 0.4 μL of cDNA template (diluted 1:10), for a total volume of 20 μL. Each sample was replicated in triplicate. Reaction program: 40 cycles of pre-denaturation at 95℃ for 2 min, 95℃ for 10 s, 55℃ for 30 s, and 72℃ for 30 s; followed by an additional cycle: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 5 min, and 95℃ for 10 s. The expression levels of the sll5097 gene in the wild-type and three overexpression lines sll5097OE3, sll5097OE7, and sll5097OE9 are shown in the table below. Figure 3 .

[0077] Example 3: Plate phenotypic results of various lines under different treatments

[0078] Wild-type Synechocystis PCC6803 and three sll5097 overexpression lines were cultured to the logarithmic growth phase, and the samples were diluted to OD values ​​using BG-11 liquid medium. 730 For concentrations of 0.1, 0.01, and 0.001, take 3 μL and drop it into a non-resistance BG-11 solid culture dish, place it in a cyanobacteria incubator, and perform HC+NL (HC: high concentration of CO2, with added saturated NaHCO3; NL: 80 μmol photon·m -2 ·s -1 ), LC+NL (LC: low concentration CO2, under air conditions), HC+HL (high concentration CO2; high light intensity: 200 μmol photon·m -2 ·s -1 Phenotypic images were taken after 5 days of treatment with LC+HL (low CO2 concentration; high light intensity). Results are as follows: Figure 4 Under four treatment conditions, the three sll5097 gene overexpression lines sll5097OE3, sll5097OE7 and sll5097OE9 grew faster than WT, with the sll5097OE9 phenotype being more pronounced under LC conditions.

[0079] Example 4: Determination of chlorophyll content in various strains

[0080] Collect 1 mL of culture into a sterile EP tube, centrifuge at 12000 rpm for 5 min, and carefully discard the supernatant. Resuspend the cells in 1 mL of methanol. Then cover the tube with aluminum foil and incubate overnight at 4°C. After extracting the pigments, centrifuge the mixture at 12000 rpm for 5 min, and the supernatant is the sample to be tested. Chlorophyll a (Chl a) was determined according to the Lichtenthaler method. Chla was extracted with methanol, and its absorbance at 665 nm and 652 nm was measured to determine its chlorophyll content. The calculation formula is: Chl a (mg / L) = 16.72 × A 665 -9.16×A 652 .

[0081] Chlorophyll content measurements of various strains revealed that under HC culture, the chlorophyll content of the sll5097OE9 strain was slightly higher than that under WT culture; under LC culture, the chlorophyll content of the sll5097OE9 strain was 15% higher than that under WT (see...). Figure 5 The growth status of each strain after the same culture time is as follows: Figure 5 The sll5097OE9 strain is greener, indicating a significant improvement in its growth phenotype.

[0082] Example 5: Analysis of oxygen-evolving activity of various strains

[0083] Using H₂O as an electron donor and 10 mM NaHCO₃ as a carbon assimilation substrate, under 30°C circulating water bath conditions, a Clark-type oxygen electrode (Hansatech, UK) was used to conduct experiments under illumination of 150 μmol photons·m⁻¹. -2 ·s -1 Under conditions of continuous stirring, the logarithmic growth phase (OD) was measured. 730 =0.5) HC (4% CO2) and LC (air) conditions were used to measure the oxygen release activity of WT and overexpression strains of cyanobacteria.

[0084] OD was measured using a Clark-type oxygen electrode. 730 Oxygen release activity was measured in wild-type cells with a value of approximately 0.5 and in the sll5097 overexpression line sll5097OE9. Results are shown below. Figure 6 It was found that under HC conditions, the photosynthetic oxygen release rate of OE9 was 21% higher than that under WT conditions, and its oxygen release activity was significantly enhanced. Under LC conditions, the photosynthetic oxygen release rate of sll5097OE9 was 27% higher than that under WT conditions, and its oxygen release activity was significantly enhanced.

[0085] Example 6: Analysis of the transient increase in chlorophyll fluorescence after the light is turned off

[0086] The transient increase in chlorophyll fluorescence in wild-type and sll5097OE9 after the light was turned off was measured using the following method.

[0087] Chlorophyll fluorescence parameters were measured using a modulated (PAM 101) chlorophyll fluorometer (manufactured by Walz GmbH, Germany) with a 101-ED equipped with emission and detection devices. Two mL of logarithmic-phase wild-type and sll5097OE9 cells were collected, and the initial fluorescence F0 was obtained by turning on the detection light. After 40 seconds of illumination, the instantaneous rise curve of chlorophyll fluorescence was recorded after the light was turned off.

[0088] Studies have shown that the transient increase in chlorophyll fluorescence after illumination is due to the reduction of plastoquinone (PQ) by electrons from photoreducing agents accumulated during illumination, which can reflect the cyclic electron transfer around the PSI mediated by the NDH complex. Figure 7 As shown, compared with WT, the instantaneous increase in chlorophyll fluorescence after the light is turned off in sll5097OE9 is increased to some extent.

[0089] The above experimental results show that overexpression of the sll5097 gene can improve the growth rate, chlorophyll production and oxygen release activity of Synechocystis, and significantly improve photosynthetic efficiency and growth phenotype.

[0090] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

Claims

1. A method for improving the photosynthetic efficiency of cyanobacteria, characterized in that, Inducing overexpression of the sll5097 gene in cyanobacteria.

2. The method as described in claim 1, characterized in that, The cyanobacteria in question is Synechocystis.

3. The method as described in claim 1, characterized in that, The cyanobacterium in question is Synechocystis sp. PCC 6803.

4. The method as described in claim 1, characterized in that, The sll5097 gene is derived from Synechocystis sp. PCC 6803, GenBank accession number BAD01867.

1.

5. The method as described in claim 1, characterized in that, The overexpression is achieved by: transforming a recombinant plasmid containing the sll5097 gene into a host cell; or by integrating the sll5097 gene into the host cell genome using gene editing technology.

6. The method as described in claim 5, characterized in that, The recombinant plasmid vector is a plasmid vector suitable for expressing exogenous genes in cyanobacteria, preferably p0168, and the sll5097 gene is placed under the regulation of the Pcpc560 strong promoter.

7. The method as described in claim 5, characterized in that, The transformation is achieved by converting recombinant plasmids into host cells through methods such as natural transformation, heat shock, chemical transformation, or electroconversion. The gene editing technology is selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system or CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

8. A recombinant plasmid, characterized in that, It contains the sll5097 gene, whose nucleotide sequence is SEQ ID NO:

10.

9. A type of engineered *Syntrophus* bacterium, characterized in that, The transformant is constructed according to the method of claim 3, for example, containing the recombinant plasmid as described in claim 8.

10. The use of the engineered strain of Synechocystis as described in claim 9 in the fermentation production of ethanol, butanol, lactic acid, ethylene or terpene compounds.