Application of rapeseed submergence tolerance gene BnC07ABF3 in improving plant submergence tolerance

By cloning and overexpressing the rapeseed waterlogging tolerance gene BnC07ABF3, and using the pCAMBIA1301 vector and Agrobacterium GV3101 for genetic transformation, the problem of rapeseed waterlogging damage was solved, the waterlogging tolerance and breeding efficiency of rapeseed were improved, and the gap in gene resources in related fields was filled.

CN121204142BActive Publication Date: 2026-03-27OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively verify the function of the rapeseed stress-resistance gene DUF1645 in rapeseed itself, and cannot directly prove its practical value for rapeseed stress-resistance breeding. Furthermore, waterlogging damage poses a serious threat to rapeseed yield and regional industrial stability.

Method used

By cloning and overexpressing the rapeseed waterlogging tolerance gene BnC07ABF3, and using the pCAMBIA1301 overexpression vector and Agrobacterium GV3101 for genetic transformation, the waterlogging tolerance of rapeseed was improved.

Benefits of technology

It significantly improved the waterlogging tolerance of rapeseed, reduced yield loss caused by waterlogging, shortened the breeding cycle, and provided stability and broad genetic resource support for the rapeseed industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204142B_ABST
    Figure CN121204142B_ABST
Patent Text Reader

Abstract

The application discloses application of a rapeseed waterlogging tolerance gene BnC07ABF3 in improving plant waterlogging tolerance, and a nucleotide sequence of the gene BnC07ABF3 is shown as SEQ ID NO. 1. In the technical scheme, the upstream regulation gene BnC07ABF3 is obtained through yeast one-hybrid and EMSA experiment verification of a rapeseed BnLPP1A gene promoter core cis-element, then it is verified through experiments that the waterlogging tolerance of a rapeseed strain into which the BnC07ABF3 gene is transferred is significantly improved, the rapeseed strain can directly cope with the waterlogging damage problem caused by high soil water content during the growth period of the rapeseed in the Yangtze River Basin, and effectively alleviates the yield loss caused by waterlogging damage, thereby providing a feasible molecular improvement path for guaranteeing rapeseed yield stability and solving the waterlogging damage predicament of regional rapeseed industry.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of plant genetic engineering, and particularly relates to application of a rapeseed (Brassica napus L.) salt-tolerant gene BnC07ABF3 in improving plant salt tolerance. BACKGROUND

[0002] Rapeseed (Brassica napus L.) belongs to the Brassica genus of the Brassicaceae family, and is one of the four major oil crops (soybean, sunflower, rapeseed, peanut) in the world, and is an important source of edible vegetable oil and feed protein. The planting range is widely distributed in Asia, Europe and America. According to the statistics of the United Nations Food and Agriculture Organization in 2020, the global rapeseed planting area is about 35.5 million hectares, and the total rapeseed yield is about 72.38 million tons. Among them, the planting area in Asia is the largest, about 15.38 million hectares. China is a major rapeseed producing country. In 2020, the rapeseed sowing area was about 6.77 million hectares, and the total yield was 14.05 million tons. The yield and sowing area account for about 20% of the global total, ranking second only to Canada. At the same time, China is also the largest rapeseed reserve country and consumer in the world. The rapeseed industry is of great significance to guarantee the safety of China's edible oil supply, which provides an important industrial basis for the research and application of rapeseed salt-tolerant genes.

[0003] Rape as one of the most important sources of vegetable oil in China, plays an important role in the security of the national edible oil supply. In China, winter rape is mainly planted in the Yangtze River Basin, such as Sichuan, Hubei, Hunan and other regions, basically in the rice-oil rotation area. According to relevant research, serious waterlogging can reduce the yield of rape by 17.0-42.4%, especially with the continuous promotion of mechanical direct seeding of rape, the situation of waterlogging damage to rape at the germination stage is more common. Waterlogging not only restricts the yield increase of rape, but also threatens the stability of the regional rape industry, so further exploring the morphological structure changes and physiological and biochemical changes of rape under waterlogging stress has become an important prerequisite for mining waterlogging tolerance genes and improving the waterlogging tolerance of rape. Chinese patent (CN103160516A) discloses a rape stress-resistant gene and its application. A Brassica napus stress-resistant gene DUF1645, the nucleotide sequence of the gene is shown as SEQ ID NO: 1, by overexpressing the rape stress-resistant gene DUF1645 in Arabidopsis, it is found that the gene can significantly enhance the drought resistance and waterlogging tolerance of plants, the plant growth is normal within 15 days of drought stress or within 10 days of waterlogging stress, and the yield and quality are basically not affected, which provides guarantee for improving the yield of crops under drought and waterlogging stress, so the application has good application prospect in crop stress-resistant breeding. The application only verifies the function of "enhancing drought resistance, waterlogging tolerance and not affecting yield and quality" by overexpressing DUF1645 gene in Arabidopsis, and does not provide functional verification data of the gene in rape itself, so it cannot directly prove the actual value of the gene to rape stress-resistant breeding.

[0004] In view of the serious threat of waterlogging to rape production in the Yangtze River Basin of China and the key role of rape industry in the national edible oil safety, screening of waterlogging-tolerant materials with excellent agronomic traits, mining of quantitative trait loci and genes controlling waterlogging tolerance traits, and analysis of waterlogging regulation mechanism can provide theoretical basis and technical guidance for breeding of waterlogging-tolerant rape varieties. SUMMARY

[0005] The main purpose of the present application is to provide the application of rape waterlogging-tolerant gene BnC07ABF3 in improving the waterlogging tolerance of plants, and to provide a gene BnC07ABF3 with waterlogging regulation function, and to obtain transgenic rape by overexpressing the gene, and to improve the waterlogging tolerance of rape.

[0006] In order to achieve the above purpose, the application of rape waterlogging-tolerant gene BnC07ABF3 in improving the waterlogging tolerance of plants is proposed, and the nucleotide sequence of the gene BnC07ABF3 is shown as SEQ ID NO. 1.

[0007] Preferably, the protein encoded by the gene BnC07ABF3 comprises any one of the following amino acid sequences:

[0008] (1) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2;

[0009] (2) an amino acid sequence having 95-100% homology with the amino acid sequence defined by SEQ ID NO. 2, and encoding a protein of the same function;

[0010] (3) an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO. 2 by addition, deletion or substitution of one or more amino acids, and having equivalent activity.

[0011] Preferably, the application is to obtain a transgenic plant by overexpressing the gene BnC07ABF3, and to improve the plant's tolerance to waterlogging.

[0012] Preferably, the survival rate of the transgenic plant is higher than that of the wild type after waterlogging treatment.

[0013] Preferably, the plant is a Brassica plant.

[0014] Preferably, the Brassica plant is Brassica napus.

[0015] The present application also provides an overexpression vector containing the gene BnC07ABF3 as described above, wherein the nucleotide sequence of the gene BnC07ABF3 is shown in SEQ ID NO. 1.

[0016] Preferably, the original vector of the overexpression vector is pCAMBIA1301.

[0017] The present application also provides an application of the overexpression vector as described above in improving the plant's tolerance to waterlogging in breeding.

[0018] The present application also provides a transformant containing the overexpression vector as described above, wherein the host bacteria of the transformant is Agrobacterium GV3101.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] (1) In the technical solution provided by the present application, the upstream regulatory gene BnC07ABF3 is obtained by yeast one-hybrid and EMSA experiments using the Brassica napus BnLPP1A gene promoter core cis-element, and then it is verified by experiments that the waterlogging tolerance of the Brassica napus strain into which the BnC07ABF3 gene is transferred is significantly improved, which can directly deal with the waterlogging damage problem caused by high soil water content during the growth period of the Brassica napus in the Yangtze River Basin, effectively alleviate the yield loss caused by waterlogging damage, and provide a feasible molecular improvement path for stabilizing the yield of Brassica napus and solving the waterlogging problem of the regional Brassica napus industry.

[0021] (2) The BnC07ABF3 gene provided by the application has significant application advantages and wide resource potential. The molecular weight of the BnC07ABF3 gene is 1233 bp, and the encoded protein contains 410 amino acids, which facilitates genetic transformation operation, can greatly shorten the cultivation period of the rapeseed salt-tolerant variety, and improves the breeding efficiency; at the same time, as a new salt-tolerant gene cloned from rapeseed, it not only provides key gene resources for genetic improvement of rapeseed salt tolerance, but also can be applied to the cultivation of other salt-tolerant crops and plant new varieties (lines), fills the gap of high-quality salt-tolerant gene resources in the related field, provides important gene support for multi-species stress-resistant breeding research, and promotes the development of the whole stress-resistant crop breeding technology. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description only some embodiments of the application, and for those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0023] Figure 1 It is the electrophoresis map of the amplification product of the BnC07ABF3 gene of the application; M: 2K Plus II DNA Ladder; blank control; P empty vector; + is the PCR product of BnC07ABF3 gene.

[0024] Figure 2 It is the PCR identification result diagram of the introduced pCAMBIA1301-BnC07ABF3 plasmid of the application; M: 2K Plus II DNA Ladder; blank control; P empty vector; + is the bacterial liquid PCR of single clone shaking bacteria.

[0025] Figure 3 It is the growth state diagram of the T3 generation strain of rapeseed transformed with BnC07ABF3 gene under artificial simulated waterlogging stress; the left is wild type rapeseed, and the right is transgenic rapeseed.

[0026] The implementation of the application, the functional characteristics and the advantages will be further described with reference to the embodiments and the accompanying drawings. DETAILED DESCRIPTION

[0027] In order to make the purposes, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be clearly and completely described below. The specific conditions not noted in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not noted by the manufacturers are all the conventional products which can be obtained by the market purchase. In addition, the technical solutions among the various embodiments can be combined with each other, but it should be considered that the combination of the technical solutions does not exist and is not within the protection scope of the present application when the combination of the technical solutions appears to be contradictory or unachievable on the basis that the combination of the technical solutions can be realized by the ordinary skilled in the art. Based on the embodiments in the present application, all the other embodiments obtained by the ordinary skilled in the art without the premise of the creative labor are within the protection scope of the present application.

[0028] The technical solutions of the present application will be further described in detail below in combination with the specific embodiments and the drawings. It should be understood that the following embodiments are only used to explain the present application and are not used to limit the present application.

[0029] Embodiment 1 Cloning of the Brassica napus Submergence Tolerance Gene BnC07ABF3

[0030] The upstream regulatory gene BnC07ABF3 of the BnLPP1A gene promoter core cis-element is obtained by yeast one-hybrid and EMSA verification. The total RNA is extracted by using the plant total RNA small amount extraction kit (Quangongjin, ER501) with ZS9 as the material, the cDNA first strand is synthesized by using the cDNA kit (AT311) reverse transcription, the gene fragment is amplified, and the PCR reaction system is as follows: Green Taq Mix 10 μL, upstream primer (5'-ATGGGGTCTCGGATGAACTTT-3') 0.5 μL, 10 μM downstream primer (5'-CTACCAAGGACCCGTCGATG-3') 0.5 μL, cDNA 1 μL, ddH2O 8 μL, and the total volume is 20 μL.

[0031] The amplification procedure is as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 58 ℃ annealing for 15 s, 72 ℃ extension for 1 min, a total of 35 cycles; and finally 72 ℃ extension for 5 min. The PCR product is recovered by using the gel recovery kit (Omega, D2500), then the recovered product is connected with the pCE3 Blunt Vector carrier to obtain the recombinant plasmid pCE3 Blunt Vector-BnC07ABF3, the E. coli competent cells are transformed, the colonies are selected for PCR amplification, and the agarose gel electrophoresis detection is carried out (the results are as shown in Figure 1After sequencing, the nucleotide sequence of the BnC07ABF3 gene is shown in SEQ ID NO.1, with a molecular weight of 1233 bp, and the amino acid sequence it encodes is shown in SEQ ID NO.2.

[0032] Example 2 Construction of expression vector for rapeseed waterlogging tolerance gene BnC07ABF3

[0033] Based on the target fragment and the pCAMBIA1301 vector, suitable homologous recombination primers were designed (F: 5'–ggatcttccagagatgtcgacATGGGGTCTCGGATGAACTTT–3'; R: 5'–ctgccgttcgacgatctgcagCTACCAAGGACCCGTCGATG–3'). Using ZS9 cDNA as a template, GreenTaq Mix was used for amplification. The PCR products were separated and recovered by agarose gel electrophoresis, and the homologous recombination fragment of the BnC07ABF3 gene was extracted.

[0034] DNA from the plant overexpression vector pCAMBIA1301-35S-NOS was extracted using an Omega plasmid extraction kit (catalog number: D6943). The extracted plasmid was double-digested with Bam HI and Kpn I restriction enzymes. The digestion system consisted of 2 µL Bam HI, 2 µL Kpn I, 4 µL 10×Fly Cut Buffer, 2 µL plasmid, and ddH2O to a total volume of 40 µL. The digestion was carried out at 37 °C for 2 h, and the target fragment was recovered and purified.

[0035] Next, the purified and recovered vector and target fragment were ligated using the ClonExpress II One Step Cloning Kit (Novizan, C112). The ligation system consisted of vector pCAMBIA1301-35S-NOS, target fragment 3.5 µL, 5×CE II Buffer 4 µL, Exnase II 2 µL, and ddH2O to a total volume of 20 µL. The mixture was incubated at 37°C for 30 min and then immediately transferred to ice for cooling. The obtained recombinant plasmid pCAMBIA1301-BnC07ABF3 was detected by electrophoresis using the upstream primer of the BnC07ABF3 gene and the downstream sequencing primer of the vector (F: 5'–ATGGGGTCTCGGATGAACTTT–3'; R: 5'–CTACCAAGGACCCGTCGATGTC–3'). The ligated recombinant plasmid pCAMBIA1301-BnC07ABF3 was transformed into E. coli DH5α competent cells. Colonies were selected for PCR amplification, and the target band was detected by agarose gel electrophoresis before being expanded into culture.

[0036] Example 3 Agrobacterium-mediated transformation and culture method of Brassica napus

[0037] The sterilized and disinfected ZS9 was placed in a germination box for germination. During the seed germination, the BnC07ABF3 gene overexpression vector pCAMBIA1301 constructed in Example 2 was transformed into Agrobacterium GV3101 (the identification results are shown in Table 1 Figure 2 ), and an Agrobacterium infiltration solution was prepared. After the seedlings of ZS9 germinated into hypocotyls of appropriate length, the hypocotyls were cut and co-incubated with the DNA liquid resuspended Agrobacterium solution. After the incubation, the hypocotyls were transferred to a callus induction medium containing 50 mg / L Kan, and cultured at 25°C with 16h light / 8h dark for 2-3 weeks to obtain resistant callus. The resistant callus was transferred to a differentiation medium containing 50 mg / L Kan and cultured under the same conditions for 3-4 weeks to induce adventitious buds. When the adventitious buds grew to 2-3 cm, they were cut and inoculated into a rooting medium containing 30 mg / L Kan and cultured under the same conditions for 2-3 weeks to obtain T0 generation transgenic positive plants. After the plants matured, they were self-pollinated in a bag, and the seeds were harvested individually. The harvested Brassica napus seeds were treated at low temperature of 4°C, disinfected, and then sown on 1 / 2MS solid medium containing antibiotic Kan (50 μg / ml) to screen positive seedlings. The positive seedlings were transplanted into a culture medium (vermiculite: nutrient soil at a volume ratio of 1:1) for planting. After the seedlings grew, the plant leaves were cut to extract DNA, and PCR detection was performed using the upstream and downstream primers of the BnC07ABF3 gene in Example 1 for verification. The T3 generation Brassica napus line containing the BnC07ABF3 gene was obtained by continuous self-pollination in a bag, individual seed harvesting, antibiotic Kan screening, and target gene PCR detection.

[0038] Example 4 Identification of BnC07ABF3 gene tolerance

[0039] Healthy and full T3 generation homozygous transgenic Brassica napus seeds and non-transformed wild-type Brassica napus seeds were selected for germination on moist filter paper. After the radicles grew to about 1-2 mm, 30 seeds with uniform germination were selected and placed in a waterlogged anaerobic environment for 12 hours, and the control group was not treated. After the treatment, the seeds were placed on moist filter paper again for growth. After 3 days, the rooting of the Brassica napus in the experimental group and the control group was observed. The results showed that the wild-type Brassica napus did not root and germinate after waterlogging treatment, while the transgenic Brassica napus rooted and germinated normally (the growth of the seedlings is shown in Figure 2). Figure 3The survival rate of the transgenic rape seedlings after waterlogging was 90% higher than that of the wild type rape seedlings, thus proving that overexpression of the BnC07ABF3 gene can improve the waterlogging tolerance of rape.

[0040] The above merely illustrates the preferred embodiments of the present application, and does not limit the patent scope of the present application. The present application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the patent protection scope of the present application.

Claims

1. The application of overexpressing the Brassica napus waterlogging tolerance gene BnC07ABF3 in improving the waterlogging tolerance of Brassica napus, characterized in that, The nucleotide sequence of the gene BnC07ABF3 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The protein encoded by the gene BnC07ABF3 is a protein consisting of the amino acid sequence shown as SEQ ID NO.

2.

3. Use according to claim 1, characterized in that, The application is to obtain transgenic rapeseed by overexpressing the gene BnC07ABF3, and to improve the waterlogging tolerance of the rapeseed.

4. Use according to claim 3, characterized in that, After the waterlogging treatment, the survival rate of the transgenic rapeseed is higher than that of the wild type.

5. The use of overexpression vector in breeding of oilseed rape with increased tolerance to waterlogging, characterized in that, The overexpression vector contains the gene BnC07ABF3 shown in claim 1, and the nucleotide sequence of the gene BnC07ABF3 is shown as SEQ ID NO. 1.

Citation Information

Patent Citations

  • Rape stress resistance gene and application

    CN103160516A

  • Application of broccoli sprout transcription factor BoABF in promotion of GABA enrichment

    CN118109481A

  • Application of brassica napus BnC05ERF378 gene in improving waterlogging resistance of plants

    CN120700036A