Application of ARNTL2 in diagnosis and treatment of pancreatic cancer
By detecting and inhibiting ARNTL2 expression, and utilizing ARNTL2 as a diagnostic biomarker and therapeutic target for pancreatic cancer, the problems of difficult early diagnosis and high metastasis rate of pancreatic cancer have been solved, achieving accurate diagnosis and efficient treatment, and improving patients' survival rate and quality of life.
Patent Information
- Application Number
- CN202511279125.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2025-12-26
AI Technical Summary
Early diagnosis of pancreatic cancer is difficult and it is highly malignant. Current research has not yet fully revealed the role of ARNTL2 in pancreatic cancer metastasis, and there is a lack of effective diagnostic and therapeutic targets.
By detecting the expression level of ARNTL2, a diagnostic kit for pancreatic cancer was prepared using ARNTL2 as a diagnostic marker. Therapeutic drugs were also prepared by inhibiting ARNTL2 expression through shRNA or recombinant expression vectors, which can target and downregulate ARNTL2 expression in pancreatic cancer cells.
It significantly inhibits the proliferation and migration of pancreatic cancer cells, promotes tumor cell death, improves diagnostic accuracy and treatment efficacy, reduces treatment costs, reduces toxic side effects, and improves patient survival rate and quality of life.
Smart Images

Figure CN121204239A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection and treatment technology, and relates to the application of ARNTL2 as a biomarker for pancreatic cancer, specifically the application of ARNTL2 in the preparation of diagnostic reagents or kits for pancreatic cancer and therapeutic drug compositions. Background Technology
[0002] Pancreatic cancer is a highly malignant digestive system tumor with an increasing incidence rate and an extremely low five-year survival rate. This is mainly due to the difficulty in early diagnosis, its high degree of malignancy, and its tendency to metastasize to distant sites. Statistics show that approximately 80% of pancreatic cancer patients have already developed metastases at the time of diagnosis, which is a major cause of treatment failure and patient death. Therefore, in-depth research into the molecular mechanisms of pancreatic cancer metastasis and the search for new therapeutic targets are crucial for improving patient survival rates.
[0003] Currently, research on pancreatic cancer metastasis mainly focuses on EMT (epithelial-mesenchymal transition), the tumor microenvironment, and the interaction between cancer cells and stromal cells. Despite some progress, many key molecular mechanisms remain unclear. Among these, ARNTL2, as a member of the circadian rhythm gene family, is receiving increasing attention for its role in tumorigenesis and development. A growing body of research indicates that circadian rhythm dysregulation is closely related to the occurrence, development, and metastasis of various tumors. However, the specific function of ARNTL2 in pancreatic cancer and its mechanism of action in tumor metastasis still lack systematic and in-depth research. Summary of the Invention
[0004] This invention is based on the above research and aims to provide a biomarker for the diagnosis of pancreatic cancer, as well as to provide a new use for ARNTL2, namely, its application in the preparation of pancreatic cancer diagnostic kits or therapeutic drug compositions.
[0005] This invention analyzes the expression and survival of ARNTL2 in pancreatic cancer cell lines, revealing its high specificity in pancreatic cancer. Next, it investigates the inhibition of ARNTL2 expression in pancreatic cancer cells and examines their proliferation and cell death capabilities, analyzing the value of ARNTL2 in the precise diagnosis and treatment of pancreatic cancer. Results show that downregulating ARNTL2 inhibits the proliferation and migration of pancreatic cancer cells and promotes their death; conversely, overexpressing ARNTL2 in wild-type cells promotes proliferation and migration while reducing apoptosis. This provides a potential target for clinical treatment of pancreatic cancer and offers a molecular basis for effective diagnosis, treatment, and prognostic assessment.
[0006] Specifically, the present invention provides the following technical solution:
[0007] A first aspect of the invention provides the application of ARNTL2 as a diagnostic biomarker. Specifically, it provides the application of reagents for detecting ARNTL2 in the preparation of products for the diagnosis or auxiliary diagnosis of pancreatic cancer.
[0008] Preferably, the reagent for detecting ARNTL2 is a reagent for detecting the expression level of ARNTL2 in biological samples at the gene level; the kit contains such a reagent for detecting the expression level of ARNTL2 in biological samples, such as PCR detection reagent, probe detection reagent or high-throughput sequencing reagent.
[0009] Further preferred, the reagent for detecting ARNTL2 expression in biological samples includes PCR primers with detection specificity for the ARNTL2 gene. The PCR primers with detection specificity for the ARNTL2 gene are shown in SEQ ID NO. 1-6.
[0010] In a second aspect, the present invention provides a product comprising the aforementioned substance for detecting ARNTL2, the product having the following use: pancreatic cancer diagnosis or auxiliary diagnosis.
[0011] The product is preferably a kit for detection at the gene level, comprising a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NO. 1–2, SEQ ID NO. 3–4, and SEQ ID NO. 5–6.
[0012] ARNTL2-F1:GTGGGAAGTAATTATAGACC (SEQ ID NO.1);
[0013] ARNTL2-R1: CTGACTTAGAAACGAAGAG (SEQ ID NO. 2);
[0014] ARNTL2_F2: TTCCTGTGGATTTGAGAGTG (SEQ ID NO.3);
[0015] ARNTL2_R2: CTGGCCCATAGTAGACATTC (SEQ ID NO.4);
[0016] ARNTL2_F3: AAGAAGGCATGGAGATGAAG (SEQ ID NO.5);
[0017] ARNTL2_R3: CACTTGATCTGAAGCACAAC (SEQ ID NO. 6).
[0018] Furthermore, the biological sample is selected from either tumor tissue obtained by puncture or circulating tumor cells collected from the patient's blood. Early diagnosis and prognostic assessment are achieved by collecting and detecting the level of ARNTL2 in tumor tissue or cells.
[0019] A third aspect of the invention provides the application of ARNTL2 as a therapeutic target. Specifically, it provides the application of inhibiting or silencing ARNTL2 in the preparation of drugs for treating pancreatic cancer.
[0020] Preferably, the substance that inhibits or silences ARNTL2 is an shRNA that inhibits ARNTL2 expression, or a recombinant expression vector or transgenic cell line containing the shRNA. This invention provides three shRNAs, the sequences of which are as follows, with the first two being preferred for their superior inhibitory effect.
[0021] shARNTL2-1: GGATTTCGATGCCCTATGT (SEQ ID NO.7);
[0022] shARNTL2-2: GGAAGATTACAGCCATATA (SEQ ID NO.8);
[0023] shARNTL2-3:TATGCGTCTTGTAAGCGAATA (SEQ ID NO. 9).
[0024] In a fourth aspect, the present invention provides a pharmaceutical composition for treating pancreatic cancer, comprising an active component and a pharmaceutically acceptable carrier, said active component comprising an shRNA that inhibits ARNTL2 expression or a recombinant expression vector or transgenic cell line containing said shRNA, said shRNA having a sequence as shown in any one of SEQ ID NO. 7-8.
[0025] A fifth aspect of the present invention provides a product comprising at least one of the second, third, and fourth aspects. The product has at least one function of (1)-(3):
[0026] (1) Diagnosis and / or prevention of pancreatic cancer;
[0027] (2) Inhibits the proliferation and migration of pancreatic cancer cells;
[0028] (3) Promotes the death of pancreatic cancer cells.
[0029] This invention focuses on ARNTL2, aiming to elucidate its crucial role in pancreatic cancer metastasis and explore its potential applications as a diagnostic biomarker or a potential therapeutic target. By revealing the role of ARNTL2 in regulating pancreatic cancer metastasis, it is hoped that this research will provide new theoretical basis and strategies for the precision treatment of pancreatic cancer.
[0030] This invention discloses for the first time the application of ARNTL2 in the diagnosis of pancreatic cancer. By analyzing the relationship between ARNTL2 and the disease progression stage, it can be seen that ARNTL2 can be used as a diagnostic marker for pancreatic cancer.
[0031] This invention discloses for the first time the application of inhibiting ARNTL2 in the prevention and treatment of pancreatic cancer. By targeting and downregulating the expression of ARNTL2 in pancreatic cancer, the proliferation and migration of pancreatic cancer cells can be inhibited, and tumor cell death can be promoted, ultimately improving or treating pancreatic cancer.
[0032] This invention also provides shRNA targeting ARNTL2 and recombinant expression vectors or transgenic cell lines containing it. These are constructed by constructing lentiviruses that target and interfere with novel ARNTL2 and transfecting them into pancreatic cancer cells. It has been demonstrated that lentiviruses carrying specific interfering sequences can stably knock down ARNTL2 expression in pancreatic cancer cells, inhibit the proliferation of pancreatic cancer cells, and promote tumor cell death, ultimately improving or treating pancreatic cancer.
[0033] In terms of detection technology, ARNTL2 detection is essentially a quantitative PCR assay based on the gene expression status of blood cells. It features simple operation, high sensitivity, good specificity, and high repeatability, and is increasingly being used in clinical laboratory testing. The basic detection method used in this invention is real-time quantitative PCR, which has high sensitivity and accuracy, is widely used in clinical practice, and is a very mature experimental technique.
[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0035] 1. Technical Effects
[0036] The lentiviral vector constructed in this invention can efficiently and specifically inhibit the expression of ARNTL2 in pancreatic cancer cells. This demonstrates the technical advantages of this invention.
[0037] 1) Highly effective inhibition of gene expression: In pancreatic cancer cell lines (SW1990 and BxPC-3), gene silencing using the lentiviral vector of the present invention significantly downregulated the mRNA and protein expression levels of ARNTL2, with an inhibition efficiency of over 85%, indicating that the vector of the present invention has a strong intervention capability at the molecular level.
[0038] 2) Significantly inhibits malignant behavior of tumor cells:
[0039] 2-1) Inhibition of cell proliferation: In CCK-8 cell proliferation experiments, the proliferation capacity of pancreatic cancer cells infected with the lentiviral vector of this invention was significantly reduced. Compared with the control group, cell viability decreased by 60% within 96 hours after infection.
[0040] 2-2) Reduction of migration and invasion capabilities: In the scratch assay and Transwell invasion assay, inhibiting ARNTL2 reduced the migration rate and the number of invasive pancreatic cancer cells by 70% and 75%, respectively. This directly demonstrates the key role of this invention in blocking the metastatic chain of pancreatic cancer.
[0041] 2. Economic effects
[0042] This invention provides a technological foundation for the development of novel targeted therapies for pancreatic cancer and has enormous economic potential.
[0043] 1) Reduced treatment costs: Compared with traditional chemotherapy, the gene therapy strategy of this invention has higher specificity and is expected to reduce toxic side effects during treatment, thereby reducing additional medical costs caused by complications.
[0044] 2) Improve treatment efficiency: This invention can be used as part of a combination therapy, working synergistically with existing chemotherapy or radiotherapy regimens, which is expected to improve overall efficacy, shorten the treatment cycle, and further save medical resources.
[0045] 3) Market expansion: With the advent of the era of precision medicine, the ARNTL2 targeted therapy strategy provided by this invention fills the market gap and can be developed into a commercial gene therapy drug in the future, bringing considerable economic returns.
[0046] 3. Social Impact: The application of this invention will have a profound social impact:
[0047] 1) Improve patient prognosis: Pancreatic cancer has a very poor prognosis due to its high metastasis rate. This invention can block tumor metastasis by effectively inhibiting ARNTL2, which is expected to significantly improve the survival rate of pancreatic cancer patients and bring them new hope.
[0048] 2) Improve quality of life: More specific treatments will reduce the serious adverse reactions of traditional therapies, alleviate patients' suffering, and improve their quality of life.
[0049] 3) Promoting academic progress: This invention not only provides specific treatment techniques, but also provides an important research tool for in-depth research on the molecular mechanisms of ARNTL2 in the occurrence and development of pancreatic cancer, thereby promoting academic development in the field of pancreatic cancer. Attached Figure Description
[0050] Figure 1 The results of the bioinformatics analysis showed that ARNTL2 expression was increased in the KRAS.G12D-MUT group compared with the KRAS.G12D-WT group.
[0051] Figure 2The results of qPCR detection of ARNTL2 in the KRAS.G12D-MUT and KRAS.G12D-WT cell lines are shown in comparison.
[0052] Figure 3 The results of Western blot analysis of ARNTL2 in the KRAS.G12D-MUT and KRAS.G12D-WT cell lines are shown in comparison.
[0053] Figure 4 The knockdown effects of different shRNAs in the SW1990 cell line were compared.
[0054] Figure 5 The results of CCK8 detection before and after knockdown are shown.
[0055] Figure 6 The results of the apoptosis experiment before and after knockdown are shown.
[0056] Figure 7 The results of the cell scratch assay before and after knockdown are shown.
[0057] Figure 8 The results of transwell experiments before and after knockdown are shown.
[0058] Figure 9 The results of qPCR detection after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown.
[0059] Figure 10 The results of Western blot analysis after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown.
[0060] Figure 11 The results of CCK8 assay after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown.
[0061] Figure 12 The results of apoptosis assays after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown.
[0062] Figure 13 The results of the scratch assay after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown.
[0063] Figure 14 The results of transwell assays after overexpression of ARNTL2 in the KRAS.G12D-WT cell line are shown. Detailed Implementation
[0064] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.
[0065] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.
[0066] Example 1: ARNTL2 is highly expressed in pancreatic cancer cell lines
[0067] (1) Bioinformatics analysis
[0068] ARNTL2 expression in KRAS.G12D-WT and KRAS.G12D-MUT cell lines was analyzed using R and the ggplot2 library. The results showed that ARNTL2 expression was significantly higher in the KRAS.G12D-MUT group compared to the KRAS.G12D-WT group. Figure 1 ).
[0069] (2) qPCR analysis
[0070] KRAS.G12D-MUT cell lines (SW1990, PANC-1, MIA-PACA-2, ASPC-1, Capan-1)
[0071] For the KRAS.G12D-WT cell line (BxPC-3), total RNA was first extracted, and then 1 μg of total RNA was taken into a 0.2 mL PCR tube according to the reverse transcription kit. Random primers and specific primers were mixed 1:1, and the concentration was calculated based on the detection value of the UV spectrophotometer.
[0072] After reverse transcription is complete, add 140 μl of nuclear free water (1:8 dilution of the reverse transcription system) to the reverse transcription system, vortex to mix, and briefly centrifuge.
[0073] Primer adjustment: Centrifuge the primers at 8000 rpm for 1 min, add water to 10 uM, and pre-test the primers with qPCR. Determine the primer specificity based on the amplification curve and melting curve.
[0074] Prepare the reaction system according to Table 1 below:
[0075] Table 1 Summary of Reaction Systems
[0076]
[0077] Take a 96-well PCR plate, aliquot 18ul of mix into each well, add 2ul of diluted cDNA, seal the plate tightly with a sealing membrane, and centrifuge in a microplate centrifuge for 1min.
[0078] Based on the primers shown in Table 2 and the reaction procedures shown in Table 3, qPCR detection was performed against three different targets. The results showed that, compared with BxPC-3, ARNTL2 expression was upregulated in SW1990, PANC-1, MIA-PACA-2, ASPC-1, and Capan-1. Figure 2 ).
[0079] Table 2 qPCR primer sequences
[0080]
[0081] Table 3 Reaction Procedure
[0082]
[0083] Further testing or manipulation was performed on the SW1990 and BxPC-3 cell lines, such as knockdown in the SW1990 cell line and overexpression in the BxPC-3 cell line.
[0084] (3) WB detection
[0085] Cell lysis: Collect SW1990 or BxPC-3 cells by centrifugation, gently vortex to mix or tap the bottom of the tube to lyse the cells.
[0086] Disperse the cells as much as possible. Add lysis buffer at a ratio of 150-250 μL of lysis buffer per well in a 6-well plate. Gently tap the bottom of the tube to fully lyse the cells. There should be no obvious cell pellet after full lysis. If the cell volume is large, it is necessary to aliquot into 500,000-1,000,000 cells / tube before lysis.
[0087] Prepare the separating gel, stacking gel, protein loading buffer, 5×SDS-PAGE electrophoresis buffer, 10× transfer buffer, 10×TBST buffer, and 5% BSA blocking buffer according to standard methods.
[0088] Experimental steps:
[0089] (1) Electrophoresis
[0090] 1) Place the prepared loading buffer in a dry bath at 98-100℃ and boil it 3 times, 5 min each time, and centrifuge at 12000 rpm for 5 min.
[0091] 2) Prepare separating and stacking gels of appropriate concentrations according to 4.1 and 4.2. After the gels have completely solidified, gently remove the comb to prepare the electrophoresis apparatus. Clean the sample loading wells with electrophoresis buffer and load the prepared samples from left to right. Generally, the sample is loaded on the left and right sides of the gel by the marker.
[0092] 3) Adjust the electrophoresis voltage to 80V and start electrophoresis. When the sample reaches the interface between the separating gel and the stacking gel, adjust the voltage to 120V and stop electrophoresis when the indicator just runs out of the bottom of the gel well.
[0093] (2) Transfer-wet transfer
[0094] 1) Preparation of the transfer apparatus: After electrophoresis, turn off the power, rinse the gel with purified water, and pour the buffer solution into two small trays. Use one tray to soak a sponge, and the other to use as the operating area. Note: PVDF membranes need to be activated with methanol for 10 minutes. PVDF contamination should be avoided throughout the process.
[0095] 2) Transfer: Starting from the positive electrode (white side down), layer the membrane from bottom to top: one layer of sponge, two layers of filter paper, one layer of PVDF membrane, one layer of gel, one layer of filter paper, and one layer of sponge. Secure the transfer equipment. Run the transfer at a constant voltage of 80V for 90-120 minutes at an ice-water mixture temperature. The transfer solution should fill the entire transfer tank. Click "Run" to begin the transfer. (Note: For first-time use, the membrane should be cut to 8.5cm x 6.5cm, and the filter paper to 9cm x 8cm.)
[0096] (3) Ponceau S staining
[0097] 1) After the transfer is complete, remove the PVDF membrane, place it in a clean container, pour in a small amount of Ponceau S to stain it, and observe whether there are bands of different sizes on the membrane;
[0098] 2) Discard the Ponceau Red and wash the PVDF membrane with sterile deionized water. Do not rinse directly. Pour the water slowly from one side and shake constantly to remove the Ponceau Red adhering to the surface until no obvious red color is visible.
[0099] (4) Closed
[0100] Pour 15-20 ml of 5% BSA blocking solution into each container and incubate for 1-2 hours.
[0101] (5) Primary antibody incubation
[0102] 1) Discard the blocking solution, add a small amount of 1*TBST elution buffer and wash for 2 minutes, then discard the elution buffer;
[0103] 2) Prepare primary antibody with 5% BSA (the ratio should be prepared according to the antibody instructions). Generally, 3-5 ml of primary antibody dilution solution is needed for one cassette. Note that the antibody should cover the entire PVDF membrane.
[0104] 3) Incubate at 4℃ on a shaker for more than 2 hours or overnight;
[0105] 4) Recover the primary antibody dilution solution (store at 4℃ for 3 days), pour in about 20 ml of 1×TBST, and wash 3 times, 15 min each time.
[0106] (6) Secondary antibody incubation
[0107] 1) Prepare secondary antibody with 5% BSA and incubate at room temperature for 1-2 hours;
[0108] 2) Discard the secondary antibody, place the membrane in the elution box, pour in about 20 ml of 1×TBST*TBST, and wash 3 times, 15 min each time.
[0109] (7) Result detection
[0110] Prepare the luminescent solution and transfer the membrane into the chemiluminescence analyzer. Add luminescent solution until the PVDF membrane is completely filled, start data acquisition, and save the original image and exposure image simultaneously. Analyze the images using ImageJ software.
[0111] The results are as follows Figure 3 The results showed that ARNTL2 expression was upregulated in SW1990 compared to BxPC-3, consistent with the qPCR detection results.
[0112] Example 2: Knockdown of ARNTL2 inhibits the proliferation and migration of pancreatic cancer cells and promotes apoptosis.
[0113] To further clarify the function and mechanism of ARNTL2 in the progression of pancreatic cancer, three RNAi target sequences were designed based on the mRNA sequence of the human ARNTL2 gene. Primers were designed for the three RNAi target sequences, and three pairs of double-stranded oligonucleotide sequences containing each RNAi target sequence were synthesized.
[0114] The synthesized three pairs of double-stranded oligonucleotide sequences were annealed to form three shRNAs containing RNAi target sequences:
[0115] shARNTL2-1: GGATTTCGATGCCCTATGT (SEQ ID NO.7);
[0116] shARNTL2-2: GGAAGATTACAGCCATATA (SEQ ID NO.8);
[0117] shARNTL2-3:TATGCGTCTTGTAAGCGAATA (SEQ ID NO. 9).
[0118] Three shRNAs were inserted into the lentiviral expression vector PCDH-CMV-EF1A-EGFP-T2A-PURO, transformed into competent Escherichia coli DH5α, and single colonies were picked for PCR identification and sequencing verification to obtain lentiviral vectors containing ARNTL2 shRNA.
[0119] qPCR experiments showed that, compared with the shNC group, the expression levels of shARNTL2-1, shARNTL2-2, and shARNTL2-3 were all downregulated. Figure 4 Subsequent experiments will use shARNTL2-1 and shARNTL2-2, which have higher knockdown efficiency.
[0120] Subsequently, the effect of ARNTL2 on the proliferation of pancreatic cancer cells was detected using the CCK8 assay. The detection method is as follows:
[0121] Collect 100 μl of SW1990 cell suspension from each group and seed it into 96-well plates, with 2,000 cells per well. Starting on day 2 post-infection, add 10 μL of CCK-8 reagent to each well before the end of the culture, without changing the medium. After 1-3 h, place the 96-well plate on a shaker and shake for 2-5 min. Detect the OD value at 450 nm using a microplate reader.
[0122] CCK8 test results are as follows Figure 5 The results showed that, compared with the shNC group, cell proliferation was inhibited in the shARNTL2-1 group (P<0.001, fold change=1.34), and cell proliferation was also inhibited in the shARNTL2-2 group (P<0.001, fold change=1.49). This indicates that downregulation of ARNTL2 significantly slowed the proliferation rate of pancreatic cancer cells.
[0123] Next, flow cytometry was used to investigate the effect of ARNTL2 on pancreatic cancer cell death. The steps are as follows:
[0124] ARNTL2 in the pancreatic cancer cell line SW1990 was downregulated using the aforementioned method. Cells were collected, digested, resuspended, and counted. Digestion was stopped when the cell coverage reached 70% and cell death was observed under a microscope. The cells were then washed twice with PBS buffer. The cell suspension was then transferred to flow cytometry tubes, and nucleic acid staining agent was added to each tube, followed by brief vortexing for staining. The tubes were then incubated at room temperature in the dark for 30 minutes. After incubation, 400 μL of PBS buffer was added to each tube, and the cells were analyzed using flow cytometry.
[0125] See flow cytometry results Figure 6 Compared to the shNC group, apoptosis was significantly increased in the shARNTL2-1 group (P<0.001, fold change=1.80), and also significantly increased in the shARNTL2-2 group (P<0.001, fold change=2.26). Compared to the control group, the downregulated ARNTL2 group experienced more cell death, further indicating that downregulating ARNTL2 can promote the death of pancreatic cancer cells.
[0126] Furthermore, the effects of ARNTL2 on pancreatic cancer cell migration were examined using scratch assays and transwell assays. The steps are as follows:
[0127] The aforementioned method was used to downregulate ARNTL2 in the pancreatic cancer cell line SW1990.
[0128] Scratch assay: Cells in the logarithmic growth phase of each experimental group were trypsinized, resuspended in complete culture medium to form a cell suspension, and counted using a cell counter. Scratch was performed the following day. After scratching, non-adherent cells were washed away with sterile PBS, and then replaced with fresh serum-free culture medium. Cells were incubated at 37°C in a 5% CO2 incubator. Cells were then harvested at appropriate time points, such as 0, 6, 12, and 24 hours, and the scratch width was observed and photographed under a microscope. ImageJ software was used for analysis.
[0129] Transwell assay: Place the required number of chambers into an empty 24-well plate. Add 100 µL of serum-free medium to each chamber and incubate for 1-2 hours for hydration. Remove the medium. Trypsin-digest cells in the logarithmic growth phase from each experimental group, resuspend the cells in low-serum medium, and count the cells using a cell counter. Add 600 µL of medium containing 30% FBS (serum concentration can be adjusted as needed) to the lower chamber. Dilute the cells with serum-free medium at a specific ratio, and add 100 µL of this cell suspension (containing 100,000-200,000 cells) to each chamber. Transfer the chambers to the lower chamber containing 30% FBS medium using forceps. Incubate in a tissue culture incubator for 4-24 hours. Remove the medium from the upper chamber and fix the cells with 4% FPA fixative at room temperature for 10-30 minutes. Remove 4% FPA fixative, wash the upper chamber cells 1-2 times with 1×PBS, immerse the chamber in staining solution for 5-10 min, and stain the lower surface of the membrane to transfer cells. Invert the chamber onto absorbent paper to remove the culture medium, gently remove non-transferred cells with a cotton swab, wash the upper chamber several times with ddHO2, air dry, and photograph the membrane under a microscope.
[0130] The results of the scratch test are as follows Figure 7 The results showed that in the KRAS.G12D-MUT cell line-SW1990, compared with the shNC group, the shARNTL2-1 group had a significantly lower cell migration rate of 23% at 24 h (P<0.05), and the shARNTL2-2 group had a significantly lower cell migration rate of 28% at 24 h (P<0.05); the transwell assay results were as follows. Figure 8 The results showed that, compared with the shNC group, the cell migration rate of the shARNTL2-1 group was significantly reduced (P<0.001), and the cell migration rate of the shARNTL2-2 group was significantly reduced (P<0.001).
[0131] Example 3: Overexpression of ARNTL2 promotes the proliferation and migration of pancreatic cancer cells and inhibits apoptosis.
[0132] ARNTL2 was overexpressed in BxPC-3 cells of the KRAS.G12D-WT cell line, with cells before overexpression serving as a control. The same detection methods as in Example 2 were used to detect ARNTL2-overexpressing BxPC-3 cells in qPCQ, WB, CCK8, apoptosis, scratch assays, and transwell assays. The results are as follows: Figures 9-14 The results showed that, compared with the NC group, both qPCR and WB assays indicated that the expression level of ARNTL2 was upregulated in the overexpression group. Figure 9 , Figure 10 ); CCK8 experiment ( Figure 11 The results showed that ARNTL2 overexpression promoted cell proliferation (P<0.01, fold change=1.60); apoptosis assay ( Figure 12 The results showed that apoptosis was significantly reduced in the ARNTL2 group (P<0.01, fold change=2.32); the scratch assay ( Figure 13 The results showed that the cell migration rate in the ARNTL2 group increased significantly by 59% after 24 h (P<0.001); the transwell assay results also showed that the cell migration rate in the ARNTL2 group increased significantly (P<0.001).
[0133] The above results indicate that ARNTL2 is specifically highly expressed in pancreatic cancer, and downregulation of ARNTL2 can inhibit the proliferation and migration of pancreatic cancer cells and promote their death. These results suggest a close correlation between ARNTL2 and the occurrence and development of pancreatic cancer tumors, thus making it a potential biomarker for tumor diagnosis and treatment selection.
[0134] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.
Claims
1. Application of reagents for detecting ARNTL2 expression levels in the preparation of pancreatic cancer diagnostic kits.
2. The application according to claim 1, characterized in that, The reagent for detecting ARNTL2 expression level is a reagent for detecting the expression level of ARNTL2 in biological samples at the gene or protein level; the kit contains reagents for detecting the expression level of ARNTL2 in biological samples.
3. The application according to claim 2, characterized in that, The reagents used to detect ARNTL2 in biological samples are selected from one or more of the following detection techniques or methods: qPCR, Western blot, and high-throughput sequencing.
4. The application according to claim 3, characterized in that, The reagent for detecting ARNTL2 expression in biological samples contains PCR primers that are specific for detecting the ARNTL2 gene.
5. The application according to claim 4, characterized in that, The PCR primer sequences with detection specificity for the ARNTL2 gene are shown in SEQ ID NO.1~6.
6. A diagnostic kit for pancreatic cancer, characterized in that, This kit contains reagents for detecting the ARNTL2 content in biological samples.
7. The reagent kit according to claim 6, characterized in that, The kit consists of a reverse transcription system, a primer system, and an amplification system, wherein the primer system includes PCR primers as shown in SEQ ID NO.1 to 6.
8. Application of substances that inhibit or silence ARNTL2 in the preparation of products for treating pancreatic cancer.
9. The application according to claim 8, characterized in that, The substance that inhibits or silences ARNTL2 is an shRNA that inhibits ARNTL2 expression, its recombinant expression vector, transgenic cell line, or liposomes or nanoparticles containing it, wherein the DNA nucleotide sequence corresponding to the shRNA is shown in any one of SEQ ID NO. 7 to 9.
10. A pharmaceutical composition for treating pancreatic cancer, characterized in that, It includes an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is an shRNA that inhibits ARNTL2 expression, and the corresponding DNA nucleotide sequence is shown in any one of SEQ ID NO.7~9.