MTFR2 gene-based endometrial adenocarcinoma diagnostic marker and application thereof

Abstract

The invention discloses an endometrial adenocarcinoma diagnostic marker based on an MTFR2 gene and application of the endometrial adenocarcinoma diagnostic marker, and belongs to the technical field of biomedicine. The MTFR2 is remarkably and highly expressed in endometrial adenocarcinoma tissues, and is closely related to clinical parameters such as clinical stages of tumors, patient age, tumor grading, BMI and tumor invasion depth. The MTFR2 gene is used as a diagnostic marker, and when the expression level of the MTFR2 gene in a detection sample is obviously higher than that of a corresponding normal endometrial tissue or a control group, a subject is prompted to possibly suffer from endometrial adenocarcinoma. Early diagnosis and disease monitoring of endometrial adenocarcinoma can be realized, and a more accurate treatment scheme is provided for a patient. Meanwhile, the MTFR2 can also be used for predicting the sensitivity of the endometrial adenocarcinoma patient to cis-platinum treatment, so that clinical doctors are helped to formulate personalized treatment strategies, and the treatment effect is improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biomedicine, and relates to an endometrial adenocarcinoma diagnosis marker based on an MTFR2 gene and application thereof, in particular to a method for endometrial adenocarcinoma diagnosis, prognosis evaluation and treatment sensitivity prediction based on an MTFR2 gene and application thereof. BACKGROUND

[0002] Endometrial adenocarcinoma is one of common malignant tumors of the female reproductive system, and its incidence rate has been increasing in recent years, which seriously threatens the life and health of women. In clinical practice, early diagnosis and accurate prognosis evaluation are crucial for improving the survival rate of patients. However, the existing diagnosis methods (imaging examination, serum markers such as CA125, and tissue biopsy + pathological examination) still have deficiencies in sensitivity and specificity, and it is difficult to meet the precise screening demand for very early lesions.

[0003] In addition to diagnosis, chemotherapy is an important treatment method for patients with endometrial adenocarcinoma at middle and late stages, and cisplatin is often used as a first-choice or combined chemotherapy drug. However, in clinical practice, the sensitivity of different patients to cisplatin varies significantly, resulting in that some patients bear drug toxicity and side effects but do not obtain ideal effects. So far, there is still a lack of a molecular marker that can be used for early diagnosis, prognosis evaluation and early prediction of patient's chemotherapy reaction.

[0004] Through large-scale clinical sample and database analysis, the research and development team of the application found that a molecule called "MTFR2 gene" is significantly highly expressed in endometrial adenocarcinoma tissues, and its expression level is closely related to tumor pathological grading and tumor invasion depth clinical indicators, and the expression level of MTFR2 has good prediction ability for cisplatin resistance. Based on this, the application of the MTFR2 gene to the molecular diagnosis, prognosis judgment and individualized chemotherapy strategy guidance of endometrial adenocarcinoma is proposed, which fills the gap in the prior art. SUMMARY

[0005] The purpose of the application is to provide an endometrial adenocarcinoma diagnosis marker based on an MTFR2 gene and an application method thereof, which realizes early diagnosis and molecular typing of endometrial adenocarcinoma by detecting the expression level of the MTFR2 gene in a sample, and further evaluates the prognosis of patients and predicts the sensitivity to cisplatin chemotherapy, so as to provide accurate and convenient auxiliary diagnosis and individualized treatment decision support for clinical practice.

[0006] In order to achieve the above-mentioned purpose of the application, the following technical solutions are adopted in the application: Application of MTFR2 gene as a diagnostic marker for endometrial adenocarcinoma: Take endometrial biopsy tissue or peripheral blood samples from suspected endometrial adenocarcinoma patients, extract RNA or protein; use real-time quantitative PCR (qRT-PCR) or immunohistochemistry (IHC) or Western blot and other techniques to detect the mRNA or protein expression level of MTFR2 gene in the sample; if the expression level of MTFR2 is significantly higher than that of the corresponding normal endometrial tissue (or normal control group), it suggests that the detected person may have endometrial adenocarcinoma, which can assist in early diagnosis.

[0007] Application of MTFR2 gene in prognosis evaluation of endometrial adenocarcinoma: According to the expression level of MTFR2 gene in the tumor tissue of patients diagnosed with endometrial adenocarcinoma, the patients are divided into high expression group and low expression group; Kaplan-Meier survival analysis and Log-rank test are used to compare the overall survival (OS), progression-free survival (PFS) and disease-specific survival rate (DSS) of the two groups of patients; it is found that the OS, PFS and DSS of patients with high expression of MTFR2 are significantly worse than those of patients with low expression of MTFR2, so the expression level of MTFR2 is used as a prognostic evaluation index to guide postoperative treatment plan and develop follow-up plan.

[0008] Application of MTFR2 gene in predicting cisplatin chemotherapy sensitivity: A batch of endometrial adenocarcinoma patients receiving cisplatin chemotherapy were taken tumor tissue or peripheral blood samples before surgery or chemotherapy to detect the expression of MTFR2 gene; the clinical efficacy of the patients was evaluated (sensitive vs. resistant), and the correlation between high expression of MTFR2 and drug resistance was analyzed; the results showed that patients with high expression of MTFR2 had poor sensitivity to cisplatin, and patients with low expression of MTFR2 had high sensitivity to cisplatin; thus, the expression level of MTFR2 can be used to predict the response of patients to cisplatin before chemotherapy, helping clinicians to develop individualized chemotherapy regimens and reduce unnecessary toxic side effects.

[0009] MTFR2 gene as a therapeutic target and drug development application: using endometrial adenocarcinoma cell lines (such as Ishikawa, HEC-1A, AN3CA) to carry out in vitro experiments, by shRNA or siRNA knockdown MTFR2 gene expression, or using CRISPR / Cas9 technology to knock out MTFR2 gene; observe cell proliferation (colony formation experiment, EdU incorporation experiment), migration / invasion (Transwell experiment) and cell cycle regulation (flow cytometry) and other indicators; prove that knockdown or knockout MTFR2 can significantly inhibit the proliferation, migration and invasion of endometrial adenocarcinoma cells, and induce cell cycle arrest; further develop xenotransplant mouse model experiments in vivo: stably knock down MTFR2 of endometrial adenocarcinoma cells or control cells are inoculated into nude mice, combined with cisplatin or single drug administration, and the tumor volume and growth curve are observed; the results show that MTFR2 knockdown can significantly slow down tumor growth and improve cisplatin efficacy; thus, MTFR2 can be used as a potential therapeutic target to provide ideas for new drug development.

[0010] Application of MTFR2 gene in biological behavior research of endometrial adenocarcinoma cells: MTFR2 gene regulatory factors are predicted by bioinformatics means (hTFtarget, ENCODE, GTRD, ChIP-seq database), and it is found that transcription factor E2F1 is closely related to MTFR2; E2F1 overexpression or knockdown experiments are carried out in endometrial adenocarcinoma cell lines, the change of MTFR2 expression is detected, and double luciferase reporter experiment is carried out to verify the regulation of E2F1 on the promoter activity of MTFR2; further ChIP experiment verifies that E2F1 can directly bind to the promoter region of MTFR2 gene to regulate its transcription activity; GSEA is used to analyze TCGA-UCEC and GSE17025 data sets, and it is found that the expression of MTFR2 is significantly related to PI3K / AKT / mTOR pathway; Western blot and activator / inhibitor treatment (such as SC79) experiments verify that PI3K / AKT / mTOR signal is weakened after MTFR2 knockdown, and SC79 can partially rescue the cell function inhibition caused by MTFR2 knockdown; Co-IP and ubiquitination experiments verify that MTFR2 protein interacts with EZH2 protein, and it is found that MTFR2 knockdown can accelerate the degradation of EZH2 protein; in in vivo and in vitro studies, MTFR2 and EZH2 jointly participate in the regulation of endometrial adenocarcinoma cell proliferation, migration, invasion and cisplatin resistance.

[0011] Compared with the prior art, the beneficial effects of the present application mainly lie in: The application provides an endometrial adenocarcinoma diagnosis marker based on an MTFR2 gene and an application method thereof, and the endometrial adenocarcinoma diagnosis marker has high sensitivity and specificity by detecting the expression level of the MTFR2 gene in a tumor or a blood sample, and is helpful for early screening and diagnosis of the endometrial adenocarcinoma. Meanwhile, the expression level of the MTFR2 gene can be used as an independent or combined prognosis determination index, and can assist a clinician in postoperative stratified management of a patient, and realize individual follow-up. In addition, the MTFR2 gene has a significant effect on cisplatin resistance prediction, can help to distinguish patients sensitive or resistant to cisplatin before treatment, guide the development of a chemotherapy scheme, and reduce the cost of trial and error and drug toxicity. MTFR2 gene knockdown or inhibition can effectively inhibit tumor cell proliferation, migration and invasion, and improve cisplatin efficacy, and provide a key target for screening and research of a new type of targeted drug. The application provides a new and effective tool for diagnosis, treatment and research of the endometrial adenocarcinoma, and has important clinical significance and application value. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 MTFR2 is highly expressed in endometrial adenocarcinoma and is related to clinical progression; wherein Figure A. A Venn diagram shows the strategy for screening MTFR2 by integrating differentially expressed genes, survival-related genes and mitochondrial-related genes in GEO (GSE17025) and TCGA-EA data sets; B. TCGA-EA data set analysis shows the expression difference of MTFR2 in endometrial adenocarcinoma tissue, peritumoral non-tumor tissue and normal endometrial tissue; C. GSE17025 data set analysis shows the expression difference of MTFR2 in endometrial adenocarcinoma tissue and normal tissue; D. qRT-PCR detects the expression level of MTFR2 mRNA in 40 cases of paired tissues of endometrial adenocarcinoma patients; E. qRT-PCR detects the expression level of MTFR2 in endometrial adenocarcinoma tissues of different clinical stages; F. Western blot detects the expression level of MTFR2 protein in 8 cases of paired tissues, T: tumor tissue, N: peritumoral normal tissue; G. IHC staining shows the expression of MTFR2 protein in endometrial adenocarcinoma tissues of stages II-IV and peritumoral normal tissues; H. Kaplan-Meier survival analysis shows the correlation of the expression of MTFR2 in the TCGA-EA data set with overall survival, disease-free survival and progression-free survival; I. ROC curve analysis shows the diagnostic value of MTFR2 for distinguishing endometrial adenocarcinoma tissue from normal tissue in the TCGA-EA data set; Figure 2MTFR2 promotes proliferation, migration and invasion of endometrial adenocarcinoma cells; wherein Figure A, B. qRT-PCR (A) Western blot (B) detect the expression of MTFR2 in normal endometrial epithelial cells (EEC) and endometrial cancer cell lines AN3CA, HEC-1A, Ishikawa; C. qRT-PCR and Western blot verify the knockdown efficiency of sh-MTFR2 in Ishikawa and HEC-1A cells; D, E. Transwell experiment detects the effect of MTFR2 knockdown on the migration (D) and invasion (E) ability of Ishikawa and HEC-1A cells; F. Colony formation experiment detects the effect of MTFR2 knockdown on the proliferation of endometrial cancer cells; G. EdU incorporation experiment detects the effect of MTFR2 knockdown on the proliferation of endometrial cancer cells; Figure 3 MTFR2 regulates cell cycle progression and stemness of endometrial adenocarcinoma cells; wherein Figure A. GSEA analysis shows the correlation between MTFR2 expression and cell cycle-related pathways in TCGA-EA and GSE17025 data sets; B. Flow cytometry analysis of the effect of MTFR2 knockdown on the cell cycle distribution of Ishikawa and HEC-1A cells; C. Western blot detects the effect of MTFR2 knockdown on the expression of cell cycle-related proteins; D. ssGSEA analysis shows the positive correlation between MTFR2 expression and mRNAsi score in TCGA-UCEC data set; E. Spheroid formation experiment detects the effect of MTFR2 knockdown on the spheroid formation ability of Ishikawa and HEC-1A cells; F. Western blot detects the effect of MTFR2 knockdown on the expression of stemness-related markers OCT4, NANOG, SOX2; Figure 4Figure 2. E2F1 transcriptionally regulates MTFR2 expression in endometrial adenocarcinoma cells; wherein panel A. Potential transcription factors regulating MTFR2 were screened by hTFtarget, ENCODE, GTRD and ChIP databases; B, C. Pearson correlation analysis showed the correlation between E2F1 and MTFR2 expression in TCGA-EA (B) and GSE17025 (C) datasets; D. Western blot detected the expression level of E2F1 protein in Ishikawa and HEC-1A cells; E, F. Western blot verified the knockdown (E) and overexpression (F) efficiency of E2F1 in Ishikawa and HEC-1A cells; G, H. Western blot detected the effect of E2F1 knockdown (G) and overexpression (H) on MTFR2 protein expression; I. qRT-PCR detected the effect of E2F1 knockdown on MTFR2 mRNA expression; J. E2F1 binding motifs in JASPAR database; K. E2F1 binding motifs and two potential binding sites in the promoter region of MTFR2 predicted by JASPAR database; L. ChIP experiment confirmed the binding of E2F1 to the MTFR2 promoter in Ishikawa and HEC-1A cells; M. Dual luciferase reporter gene experiment detected the effect of E2F1 overexpression on the activity of MTFR2 promoter; Figure 5 Figure 3. MTFR2 interacts with EZH2 and maintains its protein stability; wherein panel A. Venn diagram showing the intersection of E2F1 target genes, MTFR2 interacting proteins predicted by BioGRID database and G2 / M checkpoint related factors, EZH2 is the common molecule of the three; B. Western blot detected the effect of MTFR2 knockdown on the expression of EZH2 protein in Ishikawa and HEC-1A cells; C. qRT-PCR detected the effect of MTFR2 knockdown on the expression of EZH2 mRNA; D. Western blot detected the effect of MG132 treatment on the expression of EZH2 protein in MTFR2 knockdown cells; E, F. Cycloheximide (CHX) chase experiment detected the effect of MTFR2 knockdown on the degradation rate of EZH2 protein; G. Co-IP experiment confirmed the interaction between MTFR2 and EZH2 in Ishikawa and HEC-1A cells; H. Molecular docking analysis predicted the binding interface of MTFR2 and EZH2; I. Ubiquitination experiment detected the effect of MTFR2 knockdown on the ubiquitination level of EZH2; Figure 6MTFR2 promotes endometrial adenocarcinoma stemness through EZH2-mediated PI3K / AKT pathway; wherein Figure A. Western blot detection of the expression levels of PI3K / AKT pathway-related proteins p-PI3K, PI3K, p-AKT, and AKT in each group; B. Balloon formation experiment to detect the balloon formation ability of cells in each group; C. Flow cytometry to detect the expression of CD44 and CD133 in each group; D. Western blot to detect the expression levels of stemness markers OCT4, NANOG, and SOX2 in each group; Figure 7 MTFR2 enhances cisplatin sensitivity of endometrial adenocarcinoma through EZH2-PI3K / AKT-mediated cancer stemness; wherein Figure A. Cell viability curve showing the survival of Ishikawa and HEC-1A cells after being treated with different concentrations of cisplatin for 48 h; B. Colony formation experiment to detect the colony formation ability of cells in each group after being treated with 10 μM cisplatin for 14 days; C. Flow cytometry to detect the apoptosis of cells in each group; Figure 8 MTFR2 promotes tumor growth and cisplatin resistance in vivo; wherein Figure A. Representative images of Ishikawa and HEC-1A cells stably expressing vectors or MTFR2 xenograft tumors; B, C. In vivo bioluminescence imaging of tumor growth at different time points after transplantation; D. Tumor growth curve showing the change in tumor volume in each group, with the arrow indicating the cisplatin administration time point; E. Comparison of tumor weights in each group at the end of the experiment; F. TUNEL experiment to detect apoptotic cells in tumor tissue; G-J. IHC staining to detect the expression of Ki-67 (G), MTFR2 (H), EZH2 (I), and CDK1 (J) in tumor tissue. DETAILED DESCRIPTION

[0013] The technical solutions of the present application are further described below in conjunction with the specific embodiments. However, those skilled in the art should understand that the following examples are only used to illustrate the present application and should not be considered as limiting the present application. The specific conditions not mentioned in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, unless otherwise specified, are conventional products obtained through commercial channels.

[0014] Example 1 Collection of patient specimens and screening of differential genes To evaluate the expression of MTFR2 in endometrial adenocarcinoma (EA) and its correlation with clinical progression, this example first describes the collection of clinical samples and the screening strategy and statistical analysis method of differential genes in public databases.

[0015] Firstly, tumor tissues and paired non-tumor tissues were collected from 40 patients with endometrial adenocarcinoma who were admitted to Pudong Hospital of Shanghai from April 2021 to February 2025 and were pathologically diagnosed. All subjects signed an informed consent form before the study, and the study was approved by the Ethics Committee of Pudong Hospital of Shanghai (Approval No. 2021-RS-M-11). The tumor and adjacent tissues were immediately frozen in liquid nitrogen and stored at -80°C after surgery. Pre-cooled PBS was used to clean and take a suitable amount of tissue for RNA extraction, protein extraction, and paraffin embedding for future use.

[0016] Transcriptome data of TCGA-UCEC and GSE17025 were downloaded from public data sets, and common differential expression analysis processes such as DESeq2 or limma were used in the R language environment to screen differential expression genes (screening threshold can be set to |log2FoldChange|≥1, P<0.05), and the screened DEGs were intersected with the mitochondrial-related gene list and the survival-related gene list to screen candidate genes; the Venn diagram can directly display the integration strategy and intersection results.

[0017] Further statistical comparison of MTFR2 expression in TCGA dataset and GSE17025 dataset, in the paired clinical sample qRT-PCR analysis, first use Shapiro-Wilk test to evaluate the normality of expression data, normal distribution uses paired t test, non-normal distribution uses corresponding non-parametric test; stage comparison uses Mann-Whitney U test or ANOVA and subsequent multiple comparison method; survival analysis uses Kaplan-Meier method and log-rank test, diagnostic performance uses ROC curve analysis and calculates AUC value.

[0018] In the experiment, TRIzol (Invitrogen) method was used for RNA extraction, cDNA synthesis and qRT-PCR were performed according to the conventional method, and GAPDH was used as an internal reference. The primers are as follows: MTFR2 (NM_004456.5): upstream primer 5'-CTGAGGGCATCGTTACCGC-3' (SEQ ID NO. 1), downstream primer 5'-TCTTGGTGCCTTCCTCCGAA-3' (SEQ ID NO. 2), product length 192 bp; EZH2 (NM_004456.5): upstream primer 5'-GGACTCAGAAGGCAGTGGAG-3' (SEQ ID NO. 3), downstream primer 5'-CTTGAGCTGTCTCAGTCGCA-3' (SEQ ID NO. 4), product length 188 bp; GAPDH: upstream primer 5'-TGTGGGCATCAATGGATTTGG-3' (SEQ ID NO. 5), downstream primer 5'-ACACCATGTATTCCGGGTCAAT-3' (SEQ ID NO. 6), product length 116 bp; Statistical analysis was performed using GraphPad Prism 9.0 or R.

[0019] The results showed that MTFR2 was screened as a candidate molecule after integrating GEO (GSE17025), TCGA data, mitochondrial-related genes and survival-related genes (as shown in Figure 1 A); In TCGA and GSE17025 data sets, MTFR2 was significantly up-regulated in endometrial adenocarcinoma tissues (as shown in Figure 1 B, 1C, and the P value of difference between TCGA data sets is shown in the figure); qRT-PCR detection of 40 pairs of clinical samples (Shapiro-Wilk test followed by paired t test) confirmed that MTFR2 mRNA was significantly increased in tumor tissues (n = 40, ****P < 0.0001, as shown in Figure 1 D); Comparison according to clinical stage, the expression of MTFR2 in patients with stage III-IV was significantly higher than that in patients with stage I-II (Mann-Whitney U test, *P < 0.05, as shown in Figure 1 E); Western blot also showed that MTFR2 protein was up-regulated in tumor tissues in 8 pairs of matched samples (as shown in Figure 1 F), and IHC results directly showed that the staining intensity of MTFR2 in tumor tissues of stage II-IV was significantly higher than that in normal tissues adjacent to cancer (scale = 50 μm, see Figure 1 G); Kaplan-Meier survival analysis showed that high expression of MTFR2 was associated with poor survival outcome in TCGA-UCEC data set (see Figure 1 H, grouped according to the median); ROC curve analysis suggested that MTFR2 had diagnostic value in distinguishing endometrial adenocarcinoma tissues from normal tissues (see Figure 1 I, and the AUC value is shown in the figure).

[0020] In summary, this example systematically verified the high expression of MTFR2 in endometrial adenocarcinoma and its correlation with tumor progression and prognosis at the level of clinical samples and public databases.

[0021] Example 2 Cell line source, culture conditions and detection of endogenous expression of MTFR2 In order to carry out subsequent cell function and mechanism verification experiments, this example describes the source of cell lines used, culture conditions and methods for detecting endogenous expression of MTFR2 in cell lines.

[0022] Human endometrial cancer cell lines AN3CA, HEC-1A, and Ishikawa were purchased from the Cell Bank of the Chinese Academy of Sciences or ATCC, respectively, and cultured in DMEM / F12 medium (Life Technologies) containing 10% fetal bovine serum (FBS), 100 μg / mL streptomycin, and 100 U / mL penicillin in a 37°C, 5% CO2 incubator. AN3CA cells were cultured in EMEM medium (Gibco), and normal endometrial epithelial cells (EEC) were purchased from Shanghai Weiboxin Biotechnology Co., Ltd. and cultured in MEM medium. Cell passage was performed by 0.25% trypsin digestion, and all cells were tested negative for mycoplasma before the experiment.

[0023] To detect the endogenous expression of MTFR2 in different cell lines, total RNA and total protein were extracted from each cell line. qRT-PCR was used to detect MTFR2 expression (method and primers were the same as in Example 1). Western blot was performed using anti-MTFR2 antibody (ORIGENE, catalog number 811427, diluted 1:1000) and GAPDH or β-tubulin as internal controls. Electrophoresis and membrane transfer were performed according to the standard SDS-PAGE and PVDF transfer procedures. Image quantification was performed using ImageJ software.

[0024] The results are as follows Figure 2 As shown in A and 2B, compared with normal EEC cells, the expression of MTFR2 mRNA and protein was significantly upregulated in endometrial cancer cell lines such as AN3CA, HEC-1A and Ishikawa. Among them, Ishikawa and HEC-1A are often used for subsequent knockdown / overexpression functional verification.

[0025] Example 3: MTFR2 functional experiments (colony formation, EdU, Transwell migration and invasion) To evaluate the oncological function of MTFR2 at the cellular level, this embodiment knocked down MTFR2 in Ishikawa and HEC-1A cells and conducted a series of phenotypic experiments, including Transwell migration / invasion, colony formation, and EdU incorporation experiments.

[0026] Short hairpin RNA (shRNA) was used for MTFR2 gene knockdown experiments, and its sequence is as follows: MTFR2 (NM_001099286.3) sh-MTFR2#1 target sequence GCTGTAAGACAGAAAGAAACT(), sh-MTFR2#2 target sequence GCCTGTAAATGAAGCTGCAAT (SEQ ID NO.7); The negative control sh-NC sequence is TTCTCCGAACGTGTCACGT (SEQ ID NO. 8); shRNA expression plasmids were transfected into cells using Lipofectamine 3000 (Invitrogen, L3000015) according to the manufacturer's instructions: 2 μg shRNA plasmid per well was added to cells at 60-70% confluency in 6-well plates, and cells were collected 48 h after transfection for verification of knockdown efficiency by qRT-PCR and Western blot. Overexpression constructs were generated by PCR amplification of the coding sequences of human E2F1, MTFR2 and EZH2 and cloned into the BamHI and XhoI sites of the pcDNA3.1(+) vector to generate OE-E2F1, OE-MTFR2 and OE-EZH2, all of which were verified by sequencing. Transient transfection was performed using Lipofectamine 3000, and RNA and protein were extracted 48 h after transfection for verification of overexpression efficiency. The methods for qRT-PCR and Western blot for verification of knockdown / overexpression efficiency were the same as in the previous examples.

[0027] Transwell migration experiments were performed in 8 μm pore size chambers, with 2 x 10 4 cells seeded in the upper chamber and chemotactic medium containing 10% FBS in the lower chamber; invasion experiments were performed in chambers pre-coated with 50 μL Matrigel and 5 x 10 4 cells in the upper chamber, and incubation was extended to 48 h; colony formation experiments were performed by seeding 1000 cells per well, and the cells were cultured for 14 days before being fixed with paraformaldehyde and stained with crystal violet for counting; EdU incorporation was performed according to the Cell-Light™ EdU Apollo® 567 kit (RiboBio) instructions, with 50 μM EdU added to the culture for 2 h, followed by fixation, staining and microscopic counting. All quantitative experiments were performed at least three times independently, and the results are expressed as mean ± SD.

[0028] The results showed that MTFR2 knockdown exhibited good efficiency in Ishikawa and HEC-1A cells (qRT-PCR and Western blot verification shown in Figure 2 C); Transwell migration and invasion experiments showed that MTFR2 knockdown significantly reduced the migration and invasion abilities of both cell lines Figure 2 D, 2E, scale bar = 50 μm); the number of colonies was significantly reduced in the knockdown group Figure 2 F), and the proportion of EdU incorporation was also significantly reduced in the knockdown group Figure 2 G, scale bar = 50 μm). Statistical tests showed that the above differences were significant (**P < 0.01, ***P < 0.001, n = 3).

[0029] This example demonstrates that MTFR2 can promote the proliferation, migration and invasion of endometrial adenocarcinoma cells in vitro, which provides a functional basis for subsequent mechanism research.

[0030] Example 4: Cell cycle, stemness marker and apoptosis analysis To explore how MTFR2 affects cell cycle and tumor stemness, this example combines GSEA / ssGSEA bioinformatics analysis, flow cytometry cell cycle detection, cell cycle related protein level detection, balloon formation experiment and stemness marker detection to systematically verify.

[0031] Based on TCGA-UCEC and GSE17025, GSEA analysis was performed to evaluate the enrichment of MTFR2 high expression group in cell cycle pathways; in vitro, sh-MTFR2 was used to knock down cells for cell cycle detection: 2x10 5 cells were inoculated in 6 cm culture dishes, trypsinized and collected, fixed with 75% ethanol, treated with RNase A and stained with PI, then detected by BD FACSCanto II flow cytometry and analyzed by FlowJo software for G0 / G1, S, G2 / M ratio; Western blot was used to detect cell cycle proteins such as CyclinB1, CDK1; balloon culture used low adsorption plate, balloon culture medium containing B27, EGF, b-FGF, etc. for 2-3 weeks and counted the number of balloons with a diameter of >75 μm; ssGSEA used the platform to evaluate the correlation between MTFR2 and mRNA si; Western blot was used to detect stemness markers such as OCT4, NANOG, SOX2. CD44 / CD133 phenotype used Human TruStain FcX blocking, antibody labeling (CD133-PE, CD44-APC) and counted ≥10,000 events by BD FACSCanto II, and the CD44 + / CD133 + ratio was obtained by FlowJo analysis; apoptosis was detected by FITC-Annexin V / PI double staining and the proportion of early and late apoptosis was detected by the above method. Statistical analysis used ANOVA, multiple comparisons were corrected by Tukey, **P<0.01 (n=3).

[0032] GSEA analysis showed that MTFR2 high expression was significantly related to cell cycle related pathways ( Figure 3 A); flow cytometry showed that after MTFR2 knockdown, cells accumulated in G0 / G1 phase and decreased in S phase ( Figure 3 B); Western blot showed that the expression of CyclinB1 and CDK1 in the knockdown group decreased ( Figure 3C); ssGSEA analysis showed that MTFR2 was positively correlated with mRNAsi score ( Figure 3 D); In the balloon formation experiment, MTFR2 knockdown significantly reduced the number of balloons formed ( Figure 3 E, left image is representative, right image is quantitative); the dry biomarkers OCT4, NANOG, and SOX2 decreased in the knockdown group ( Figure 3 F).

[0033] This embodiment demonstrates that MTFR2 can promote tumor cells to have stronger proliferation and stemness phenotype by regulating cell cycle proteins and stemness-related processes.

[0034] Example 5: Validation experiment of E2F1 regulating MTFR2 (dual luciferase + ChIP) To verify the transcriptional regulatory role of transcription factor E2F1 on MTFR2, this embodiment combines bioinformatics prediction, correlation analysis, gene knockdown / overexpression, ChIP and dual-luciferase reporter assays for systematic verification.

[0035] Potential transcription factor binding sites in the MTFR2 promoter region (-2000 bp to +100 bp) were screened using databases such as hTFtarget, ENCODE, and GTRD, and E2F1 binding motifs were obtained using JASPAR. Pearson correlation analysis was performed on the TCGA-UCEC and GSE17025 datasets to assess the expression correlation between E2F1 and MTFR2.

[0036] In Ishikawa and HEC-1A cells, E2F1 was knocked down using shRNA (see Example 3 for the procedure) or overexpressed using pcDNA3.1-E2F1. The shRNA sequence is as follows: E2F1 (NM_005225.3) sh-E2F1#1 target sequence GCATCTATGACATCACCAACG (SEQ ID NO.9), sh-E2F1#2 target sequence GCATCCAGCTCATTGCCAAGA (SEQ ID NO.10); Cells were collected 48 h after transfection to extract total protein and total RNA. The expression changes of E2F1 and MTFR2 were detected by Western blot and qRT-PCR.

[0037] ChIP experiment was performed using 1% formaldehyde cross-linking, Pierce™ Agarose ChIP Kit according to the manufacturer's instructions, and ChIP-qPCR primers were designed for the predicted sites (-908 to -897 bp and -617 to -606 bp) and enrichment was calculated using the "input percentage method"; the pGL3-MTFR2-promoter (-2000 to +100 bp) luciferase reporter plasmid and pRL-TK internal standard plasmid were constructed, co-transfected in HEK293T or target cells, and the Firefly / Renilla ratio was detected using the dual luciferase reagent 48 h later. Statistical in vitro experiments were repeated three times independently (n=3), and the differences between groups were compared using one-way ANOVA or t-test.

[0038] The results showed that database-based screening and Pearson correlation analysis showed that E2F1 and MTFR2 were significantly positively correlated in TCGA-UCEC and GSE17025 (see Figure 4 A, 3B, 3C) Western blot of Ishikawa and HEC-1A cells showed that E2F1 had detectable endogenous expression in the cells (D); the efficiency of E2F1 knockdown and overexpression was verified by Western blot (E, 3F), and up- and down-regulation of E2F1 led to corresponding down- and up-regulation of MTFR2 protein and mRNA (G, 3H, 3I); the E2F1 binding motif provided by JASPAR and the sites in the MTFR2 promoter are shown in Figure 4 J, 3K. ChIP-qPCR experiments confirmed that E2F1 could enrich specific sites in the MTFR2 promoter (L), and dual luciferase reporter experiments showed that E2F1 overexpression significantly enhanced the transcriptional activity of pGL3-MTFR2-promoter (M). Figure 4 Figure 4 Figure 4 Figure 4 Figure 4

[0039] In summary, this example proves from multiple levels of bioinformatics, expression correlation, ChIP and reporter gene that E2F1 can directly bind to and activate the MTFR2 promoter, thereby positively regulating MTFR2 transcription.

[0040] Example 6: Verification of the interaction and ubiquitination mechanism of MTFR2 and EZH2 To study the molecular mechanism of MTFR2 in regulating tumor phenotype, this example systematically verified the protein interaction between MTFR2 and EZH2, the regulation of MTFR2 on the expression and stability of EZH2, and the effect of MTFR2 knockdown on the ubiquitination level of EZH2.

[0041] ​​​​​sh-MTFR2 and control cells were constructed in Ishikawa and HEC-1A cells. Cells were lysed using RIPA buffer containing protease inhibitors and quantified using BCA. Co-IP was performed: 500 μg of total protein was collected for each IP, pre-cleaned, and immunoprecipitated with anti-MTFR2 (Proteintech) or anti-EZH2 (Cell Signaling) antibodies. Protein A / G beads were added to capture and wash the cells, followed by boiling and elution in 2×SDS buffer, and Western blot was used to detect interactions. To assess protein stability, CHX tracking (25 μg / mL CHX, collection time points 0, 20, 40, and 80 min) was performed in the control and knockdown groups, and EZH2 degradation over time was detected by Western blot. MG132 (10 μM, 6) was used. h) Inhibition of the proteasome and detection of the recovery of EZH2 expression; ubiquitination assay: before collection, EZH2 was treated with MG132 and IP was performed, and ubiquitination bands were detected with anti-Ubiquitin antibody; molecular docking was performed using AlphaFold2 to predict the MTFR2 structure, and EZH2 was based on the PDB structure. AutoDock Vina docking was used and visualization was performed using PyMOL.

[0042] The results showed that Venn diagram integration analysis indicated that EZH2 was the intersection of E2F1 target genes, BioGRID predicted interacting proteins, and G2 / M related factors. Figure 5 A); Western blot confirmed that MTFR2 knockdown led to EZH2 protein downregulation ( Figure 5 B), while qRT-PCR showed no significant change in EZH2 mRNA levels, suggesting that regulation may be at the protein stability level (B). Figure 5 C); MG132 treatment can partially reverse the EZH2 protein decrease caused by knockdown (C); Figure 5 D); CHX tracking showed that the MTFR2 knockdown group had an accelerated EZH2 degradation rate ( Figure 5 E, 5F); Co-IP experiments confirmed a direct interaction between MTFR2 and EZH2 in cells ( Figure 5 G); Molecular docking analysis predicts the potential binding interface between the two proteins ( Figure 5 H); ubiquitination experiments showed that EZH2 ubiquitination was significantly increased in the MTFR2 knockdown group ( Figure 5 I).

[0043] This embodiment demonstrates that MTFR2 can maintain the stability of EZH2 protein by interacting with EZH2 and inhibiting its ubiquitination and degradation, providing a molecular basis for MTFR2 to regulate downstream phenotypes.

[0044] Example 7: Animal model validation and in vivo mechanism analysis (IHC, TUNEL, qPCR, WB) To evaluate the comprehensive effect of MTFR2-EZH2 axis on PI3K / AKT pathway, cancer stemness and chemotherapy sensitivity, this example contains pathway and rescue experiments in vitro, chemotherapy sensitivity and apoptosis detection, and animal xenograft in vivo validation.

[0045] Ishikawa and HEC-1A cells were divided into control, sh-MTFR2, sh-MTFR2+oe-EZH2 and sh-MTFR2+SC79 groups (SC79 treatment for 24 h according to laboratory conditions); Western blot was used to detect p-PI3K, PI3K, p-AKT, AKT and other signaling molecules; balloon culture and CD44 / CD133 flow cytometry analysis, OCT4 / NANOG / SOX2 Western blot were used to evaluate stemness; cell viability detection was performed after 48 h of treatment with different concentrations of cisplatin (0, 20, 40, 60, 80 μM), and a dose-response curve was drawn and the survival rate was calculated; colony formation was cultured for 14 days in the presence of 10 μM cisplatin and counted; flow cytometry apoptosis detection was used to quantify early and late apoptosis using the FITC-Annexin V / PI method.

[0046] Animal experiments used 4-6 week old female BALB / c-nu / nu nude mice, which were subcutaneously inoculated with Ishikawa / HEC-1A cells stably expressing Vector or oe-MTFR2 at 5×10 6 / each, and randomly divided into groups (n=6 / group) when the tumor volume reached 50-100 mm 3 Pis were injected intraperitoneally twice a week at a dose of 5 mg / kg or PBS, and the volume was measured every 3 days for 4 weeks; at the end of the experiment, the tumors were collected for IHC (Ki-67, MTFR2, EZH2, CDK1) and TUNEL detection.

[0047] Statistically, n=3 in vitro and n=6 in vivo, differences were analyzed by ANOVA or t-test, and Tukey correction was used for multiple comparisons.

[0048] Western blot results showed that sh-MTFR2 led to a decrease in p-PI3K and p-AKT levels, while oe-EZH2 or AKT activator (SC79) treatment partially restored the signal Figure 6 A); balloon formation, CD44 + / CD133 + ratio and stemness marker expression were significantly reduced in the sh-MTFR2 group, but partially restored in the sh-MTFR2+oe-EZH2 or sh-MTFR2+SC79 group Figure 6B-6D), suggesting that MTFR2 maintains tumor stemness through the EZH2-PI3K / AKT axis.

[0049] In the drug sensitivity experiment, the survival curve of the sh-MTFR2 group was shifted to the left, the IC50 was reduced, and the colony formation was significantly reduced under cisplatin treatment Figure 7 A, 7B); while oe-EZH2 or SC79 treatment could partially restore the cisplatin resistance of the cells Figure 7 A, 7B). Flow cytometry apoptosis detection showed that the apoptosis rate of the sh-MTFR2 group was significantly increased under cisplatin treatment, and oe-EZH2 or SC79 could reduce the apoptosis induced by cisplatin Figure 7 C).

[0050] The in vivo experimental results showed that the tumor growth of the oe-MTFR2 group was accelerated and the antitumor effect induced by cisplatin was weakened; the combined group (cisplatin on oe-MTFR2) showed that the tumor volume and weight were significantly higher than the Vector+cisplatin group Figure 8 A-8E); IHC and TUNEL results showed that the Ki-67 positive rate of the oe-MTFR2 group was increased, the TUNEL positive cells were reduced, and the expression of EZH2 was increased Figure 8 F-8J).

[0051] In summary, the present embodiment shows that MTFR2 enhances tumor stemness and reduces chemotherapy sensitivity by maintaining the stability of EZH2 and activating the PI3K / AKT pathway, and the role of promoting tumor growth and inducing cisplatin resistance is verified by in vivo models.

[0052] Through the above specific embodiments, the present application systematically reveals the multiple application value of the MTFR2 gene in the diagnosis, prognosis evaluation and cisplatin sensitivity prediction of endometrial adenocarcinoma. The high expression of the MTFR2 gene can not only be used for early diagnosis, but also can be used as a prognosis index, and plays a guiding role in the development of chemotherapy regimens. In addition, taking MTFR2 as a treatment target, the downstream signaling pathways (PI3K / AKT / mTOR, EZH2, etc.) can be inhibited to inhibit tumor progression and improve chemotherapy sensitivity. In summary, the present application provides a complete technical solution covering from basic molecular mechanism to clinical transformation, which has significant clinical significance and industrialization prospect.

[0053] Finally, it should be pointed out that the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them. The basic principles and main features of the present application have been described above with specific embodiments, and some modifications or replacements can be made on the basis of the present application, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the present application.

Claims

1. A diagnostic biomarker for endometrial adenocarcinoma based on the MTFR2 gene, characterized in that, The biomarker is the MTFR2 gene. When the expression level of the MTFR2 gene in the test sample is significantly higher than that in the corresponding normal endometrial tissue or control group, it suggests that the subject may have endometrial adenocarcinoma.

2. A method for diagnosing endometrial adenocarcinoma based on the marker described in claim 1, characterized in that, Includes the following steps: (a) Obtain endometrial tissue or peripheral blood samples from the subject; (b) Detect the expression level of the MTFR2 gene in the sample; (c) The detected MTFR2 gene expression level is compared with the normal control. If the MTFR2 gene expression level is significantly higher than that of the normal control, the subject may be diagnosed with endometrial adenocarcinoma.

3. The method for diagnosing endometrial adenocarcinoma according to claim 2, characterized in that, The detection of MTFR2 gene expression level can be performed at the nucleic acid level or the protein level.

4. A method for prognostic assessment and chemotherapy sensitivity prediction in patients with endometrial adenocarcinoma based on the biomarker described in claim 1, characterized in that, Includes the following steps: (a) Obtain tumor tissue samples or peripheral blood samples from patients diagnosed with endometrial adenocarcinoma; (b) Detect the nucleic acid or protein expression level of MTFR2 in the sample; (c) Patients were divided into high-expression and low-expression groups based on MTFR2 gene expression levels; (d) The overall survival, progression-free survival and disease-specific survival of the high and low expression groups were analyzed by Kaplan-Meier survival curves and Log-rank test, and the results were used to guide clinical follow-up and treatment planning.

5. The use of the MTFR2 gene as described in claim 1 in the preparation of a kit for the early diagnosis of endometrial adenocarcinoma.

6. The application of the MTFR2 gene as described in claim 1 in predicting the prognosis of patients with endometrial adenocarcinoma.

7. The use of the MTFR2 gene as described in claim 1 in screening and evaluating the sensitivity of endometrial adenocarcinoma to therapeutic drugs.

8. The use of the MTFR2 gene as described in claim 1 in screening and evaluating the sensitivity of endometrial adenocarcinoma patients to cisplatin treatment.

9. The application of the MTFR2 gene as described in claim 1 in the research of preparing drug targets for the treatment of endometrial adenocarcinoma.

Images