Biomarkers for differential diagnosis of frontotemporal dementia-amyotrophic lateral sclerosis-spectrum (FTD-ALS-spectrum)

Abstract

The invention relates to a method for diagnosis, disease monitoring and / or therapy guidance in a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising (a.) providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, (b.) determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, (c.) wherein the level of the one or more biomarkers is indicative of whether the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy. The invention further relates to a kit for carrying out the method of the present invention, methods of treating patients identified using the method of the invention, methods of determining said FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, and samples comprising extracellular vesicles and said FTD-ALS-spectrum biomarkers.

Description

[0001] BIOMARKERS FOR DIFFERENTIAL DIAGNOSIS OF FRONTOTEMPORAL DEMENTIA- AMYOTROPHIC LATERAL SCLEROSIS-SPECTRUM (FTD-ALS-SPECTRUM)

[0002] DESCRIPTION

[0003] The invention is in the field of neurodegenerative diseases, in particular in the field of diagnosis, disease monitoring and therapy guidance for neurodegenerative diseases of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum).

[0004] The invention relates to a method for diagnosis, disease monitoring and / or therapy guidance in a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia- Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising (a.) providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, (b.) determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, (c.) wherein the level of the one or more biomarkers is indicative of whether the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy.

[0005] The invention further relates to a kit for carrying out the method of the present invention, methods of treating patients identified using the method of the invention, methods of determining said FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, and samples comprising extracellular vesicles and said FTD-ALS-spectrum biomarkers.

[0006] BACKGROUND OF THE INVENTION

[0007] FTD is the second most common neurodegenerative dementia in young patients (< 65 years) and has a dramatic impact on life expectancy, with survival rates ranging from 3 to 14 years after the onset of the disease. Depending on the clinical phenotype, patients may primarily suffer from behavioral changes and deficits in executive functions (behavioral FTD - bvFTD) or language disorders (primary progressive aphasia - PPA). PPA includes the semantic variant (svPPA) and the non-fluent variant (nfvPPA; see also below). The phenotypic spectrum also includes cases with concomitant amyotrophic lateral sclerosis (FTD-ALS), corticobasal syndrome (CBS) and progressive supranuclear palsy (PSP; the classic PSP syndrome is called Richardson syndrome).

[0008] FTD thus encompasses different neurodegenerative disorders, including for example behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA) and nonfluent variant primary progressive aphasia (nfvPP). The different variants of FTD, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD) and amyotrophic lateral sclerosis (ALS) are part of a disease continuum with overlapping symptoms, genetics and molecular pathology termed FTD-ALS spectrum (1). Although ALS, FTD with ALS (FTD-ALS) and roughly half of bvFTD cases are characterized by intracellular protein inclusions of TAR DNA-binding protein (TDP-43) (2), PSP, CBD and approximately 40% of bvFTD cases have been linked to tau pathology at autopsy (frontotemporal lobar degeneration, FTLD-tau) (3). Together, FTLD-tau and FTLD-TDP-43 account for nearly 90% of bvFTD cases. The microtubule-binding protein tau exists in six different isoforms caused by alternative splicing (4). Based on the presence of three or four repetitive protein domains, so-called repeats, 3-repeat or 4-repeat isoforms are distinguished (3R, 4R tau). FTLD-tau can be characterized by the predominance of 3R tau aggregates (Pick’s disease) or 4R tau pathology in PSP, CBD, argyrophilic grain disease or globular glial tauopathy (GGT) (5).

[0009] So far, disease-modifying therapies are not available for FTD-ALS spectrum disorders, although symptomatic treatments or other treatment options are available. Firstly, the overlap of the clinical features of bvFTD or svPPA with those of Alzheimer’s disease or psychiatric disorders poses a challenge for clinical diagnosis. Further, the lack of disease modifying therapies may be partially caused by the lack of biomarkers detecting the underlying molecular pathology, which is a prerequisite for patient stratification in sporadic bvFTD. Currently, diagnosis of molecular pathology is only possible postmortem, with the exception of genetic cases in which a pathogenic mutation allows ante-mortem deduction of the associated molecular pathology. It is for example known that mutations in the GRN, C9orf72, VCP and other genes result in a TDP-43 pathology (50%), while mutations in MAPT lead to a tau pathology (45%).

[0010] To date, there is a lack of diagnostic markers to differentiate between the many variants of FTD and other diseases within the FTS-ALS spectrum. A diagnostic biomarker however may further help in cases of diagnostic uncertainty and could facilitate early diagnosis, which is important because disease-modifying, novel therapies are expected to be more successful in the early disease stages when irreversible neuron loss is less progressed. Delayed and incorrect diagnoses have been reported for a substantial proportion of patients with ALS (6), PSP (7) and bvFTD (8). Therefore, pathology-specific biomarkers are urgently needed.

[0011] A number of diagnostic biomarkers for the differential diagnosis of FTD versus Alzheimer’s disease and other neurodegenerative diseases have been developed and presented in recent years (del Campo et al. (2022)). Initial approaches to differentiate FTD-related pathologies have also been attempted (different tau levels, phosphorylated tau, GFAP (glial fibrillary acidic protein), etc.), however cerebrospinal fluid (CSF) has been used almost exclusively as sample material.

[0012] Plasma glial fibrillary acidic protein / neurofilament light chain (NfL) ratios have been suggested to distinguish FTLD-tau from TDP- 43 pathologies (9). Other studies have investigated TDP-43, phosphorylated or aggregated TDP-43 in blood or cerebrospinal fluid (CSF) (10-14), CSF p- tau181 / tau ratio (15) or CSF peptides encoded by cryptic exons as markers of TDP-43 pathology (16), albeit with conflicting results and no clear differentiation of the underlying pathomechanism and diseases within the FTS-ALS spectrum (see for example Barbo et al., (2023), Genes, 14, 325 and WO2019014486).

[0013] Further, CSF tau isoforms have been proposed as diagnostic markers for 3R or 4R predominant tauopathies (17), but detection is hampered by tau fragmentation in extracellular fluids (18) resulting in extremely low concentrations of full-length tau. WO2022 / 175275 discloses 3R- and 4R specific antibodies and fragments thereof for the specific detection of 3R- and 4R in a non- denaturized physiological sample. The antibodies may be employed in an immunoassay such as an ELISA. Similarly, Silva et al. (Acta Neuropathol. 111 :329-340, 2006) and Luk et al. (J. Neurosci. Meth. 180:34-42, 2009) disclose 3R- and 4R-specific antibodies for use in an ELISA assay. Recently a CSF assay employing immunoprecipitation followed by mass spectrometry was published that could overcome this obstacle (19). However, the assay requires lumbar puncture and thus is associated with a high invasiveness. Sample acquisition for this assay thus has to be performed by specialized personal and is associated with discomfort and risk for the patient.

[0014] Giux et al (Int. J. Mol. Sci. 19:663, 2018) discloses the detection of full length and mid region tau in extracellular vesicles derived from human induced pluripotent stem cell (iPSC)-derived neuron (iN) conditioned media, cerebrospinal fluid (CSF), and plasma of patients with Alzheimer’s disease. However, Giux et al. does not disclose determination of tau in patients with other diseases and differentiation between the many variants of FTD and other diseases within the FTS-ALS spectrum.

[0015] Additionally, mass spectrometry-based proteomic analyses have identified several potential biomarkers for the differentiation of pathological subtypes of FTD from CSF (van der Ende et al. (2019), Ann. Clin. Transl. Neurol. 6:698-707; Teunissen et al. (2016), Alzheimer’s Dement. 2:86- 94) (for example neuronal pentraxin receptor (NPTXR), receptor-type tyrosine-protein phosphatase N2 (PTPRN2), neurosecretory protein VGF, chromogranin-A (CHGA), and V-set and transmembrane domain-containing protein 2B (VSTM2B); YKL-40, Catalase). However, the results of these markers in CSF and serum do not correlate and validation is still outstanding.

[0016] Discrimination of different FTD patients was further determined by a ratio of GFAP and NfL from plasma using an immunoassay (Cousins et al. (2022), JAMA Neurol. 79:1155-1164). For differentiation of chronic traumatic encephalopathy and Alzheimer’s disease, histological characterization of 3R and 4R tau repeats with 3R- and 4R- specific antibodies was performed in immunofluorescence analyses of brain tissue (hippocampus) from deceased patients (Cherry et al. (2021), Acta Neuropathol. Commun. 9:86) or from marmosets (Rizzo et al. (2022), Alzheimer’s Dement. 18(Suppl. 4):e069206). However, this method cannot be performed in living individuals and thus only performed postmortem.

[0017] In view of the medical need for disease modifying treatment means and the severeness of the diseases of the FTD-ALS spectrum, there is - despite the biomarkers and technologies known in the prior art - a strong need for biomarkers allowing for differential diagnosis of the diseases of the FTD-ALS spectrum and their underlying pathomechanism. In particular there is the need for biomarkers that allow a minimal invasive ante mortem analysis and diagnosis.

[0018] SUMMARY OF THE INVENTION

[0019] In light of the prior art, the technical problem underlying the present invention is to provide improved and / or alternative means for differential diagnosis of the diseases of the FTD-ALS spectrum and in particular their underlying molecular pathology that overcome the disadvantages of the prior art.

[0020] Another problem underlying the present invention is the provision of improved and / or alternative means for differential diagnosis of the diseases of the FTD-ALS spectrum and in particular their underlying molecular pathology that allow disease monitoring, determination of disease severity and / or therapy guidance of a patient according to the disease and molecular pathology diagnosed. Another problem of the present invention is the provision of improved and / or alternative means for differential diagnosis of the diseases of the FTD-ALS that are minimally invasive, require no specialized personnel for sample acquisition and measurement and that are thus easily applicable at low costs.

[0021] Another problem underlying the present invention is the provision of improved and / or alternative means for differential diagnosis of the diseases of the FTD-ALS that are applicable for a living subject (ante mortem) and thus allow the diagnosis, disease monitoring and therapy guidance in a patient having such disease of the FTD-ALS spectrum

[0022] Another problem underlying the present invention is the provision of improved and / or alternative means for differential diagnosis of the diseases of the FTD-ALS spectrum that allows stratification of patients within clinical studies and the development and provision of disease modifying therapies for the different diseases with different underlying pathologies of the FTD-ALS spectrum.

[0023] These problems are solved by the features of the independent claims. Preferred embodiments of the present invention are provided in the dependent claims.

[0024] In one aspect, the invention relates to a method for diagnosis, disease monitoring and / or therapy guidance in a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising a. providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, c. wherein the level of the one or more biomarkers is indicative of whether the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD-ALS- spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD- ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy.

[0025] The method of the present invention surprisingly allows to identify the underlying pathomechanism and a differential diagnosis of the diseases of the FTD-ALS spectrum, which typically show a significant overlap in clinical, genetic and pathological characteristics and are usually difficult to distinguish by the methods and biomarkers known in the prior art.

[0026] Thereby, in contrast to several methods of the prior art which can only be performed postmortem, for example by obtaining histological samples of the brain of a subject, the method of the present invention can advantageously be performed by using a sample that can be easily be acquired from a living subject. Thereby, the method not only allows ante mortem diagnosis of a neurodegenerative disease of the FTD-ALS spectrum, but also monitoring of the progression of the disease and therapy guidance of said patient, as for example several samples may be obtained over a certain period of time for performing the method of the present invention.

[0027] Further, the method may be advantageously employed for diagnosis of patients showing no or only mild symptoms of a neurodegenerative disease of the FTD-ALS spectrum such as patients with a genetic predisposition for such diseases and stratification of patients to clinical trials, thereby strongly advancing the development of new disease-modifying therapies for the diseases of the FTD-ALS spectrum.

[0028] Furthermore, in embodiments, the one or more FTD-ALS spectrum biomarkers are determined in extracellular vesicles present in a sample derived from said patient. In embodiments, the sample type represents differentiation and improvement over the prior art. In the examples below, the inventors show that extracellular vesicles derived from a sample of a patient contain substantial amounts of unfragmented FTD-ALS-spectrum biomarkers such as TDP-43 and Tau. In contrast, fragmentation of such neurodegenerative biomarkers such as the Tau protein often occurs when not present in extracellular vesicles. This allows for example the measurement of 3R and 4R tau isoform ratios, which has not been possible from many samples, such as blood samples, until the present time. The determination of unfragmented biomarkers in the extracellular vesicles thus allows accurate determination of the biomarkers, reflecting disease pathology and allowing direct linkage of the determined biomarker level to the underlying pathomechanism and disease of the FTD-ALS spectrum.

[0029] Further, interfering proteins such as plasma albumin and immunoglobulins are largely absent in extracellular vesicles. Thus, upon determination of the biomarkers of the FTD-ALS spectrum within extracellular vesicles, such as by an immunoassay using specific binding agents, for example antibodies or other binding agents, interference with such proteins is easily avoided. This is particularly advantageous for the determination of TDP-43.

[0030] In embodiments, the invention relates to a method for diagnosis, disease monitoring and / or therapy guidance of a patient with a neurodegenerative disease of the Frontotemporal Dementia- Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising a. providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, c. wherein the level of the one or more biomarkers is indicative of a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy, thereby distinguishing between the two medical indications.

[0031] In one embodiment, the one or more FTD-ALS-spectrum biomarkers is a protein that can form a pathological protein aggregate in neurons of subjects with a neurodegenerative disease of FTD- ALS-spectrum.

[0032] In one embodiment, the one or more FTD-ALS-spectrum biomarkers is a ratio of the level of 3R- Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TAR DNA-binding protein 43 (TDP-43).

[0033] As shown in the examples below, EV 3R / 4R tau ratio and TDP-43 have been determined in a large neurodegenerative disease cohort (DESCRIBE cohort) and it has been demonstrated that TDP-43 and a ratio of the levels of 3R-Tau and 4R-Tau or a combination of these biomarkers advantageously allow to distinguish Tau from TDP-43 pathology within the diseases of the FTS- ALS spectrum. For example, tau ratios were low in progressive supranuclear palsy and high in bvFTD with tau pathology. As a further example, TDP-43 levels were high in ALS and in bvFTD with TDP-43 pathology. Both markers discriminated between the diagnostic groups with area under the curve values >0.9, and between TDP-43 and tau pathology in bvFTD. Both markers strongly correlate with neurodegeneration, and clinical and neuropsychological markers of disease severity. These findings were validated in a second, independent cohort (Sant Pau cohort), comprising 287 participants with ALS, ALS-FTD, bvFTD, PSP and HC, including 34 genetically confirmed cases.

[0034] It is further shown that extracellular vesicles (EVs) contain quantifiable amounts of TDP-43 and full-length tau, which allow the reliable quantification of 3-repeat (3R) and 4-repeat (4R) tau isoforms. Thus, the levels of tau or TDP-43 in extracellular vesicles advantageously accurately reflect disease pathology as both tau and TDP-43 can be transported by EVs to other cells where they can induce protein aggregation and cytoplasmic (mis)localization of TDP-43 is likely required for its secretion with EVs.

[0035] Taken together, it is demonstrated that TDP-43 levels, 3R / 4R tau ratios and or a combination thereof in extracellular vesicles allows the molecular diagnosis of diseases of the FTD-ALS- spectrum such as of FTD and ALS, thereby providing one or more biomarkers to monitor disease progression and target engagement in clinical trials, which can be reliably any easily be determined in a sample derived from a living subject.

[0036] In embodiments, the quantifiable amounts of TDP-43 and full-length tau, which allow the reliable quantification of 3-repeat (3R) and 4-repeat (4R) tau isoforms, and their analysis using the means described herein, represents an unexpected finding and departure from common protocols in the art.

[0037] In one embodiment, the neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy is progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), non-fluent variant primary progressive aphasia (nfvPPA) comprising a Tau proteinopathy and / or behavioral variant FTD comprising a Tau proteinopathy (bvFTD), and the neurodegenerative disease of the FTD-ALS-spectrum associated with a TPD-43-proteinopathy is amyotrophic lateral sclerosis (ALS), FTD-ALS, bvFTD comprising a TPD-43 proteinopathy, semantic variant primary progressive aphasia (svPPA), non-fluent variant primary progressive aphasia (nfvPPA) comprising a TPD-43 proteinopathy, TDP-43 co-pathology in Alzheimer’s disease and / or FTD with motor neuron disease (FTD-MND).

[0038] In one embodiment, the neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy is progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), non-fluent variant primary progressive aphasia (nfvPPA) comprising a Tau proteinopathy and / or behavioral variant FTD comprising a Tau proteinopathy (bvFTD), and the neurodegenerative disease of the FTD-ALS-spectrum associated with a TPD-43-proteinopathy is amyotrophic lateral sclerosis (ALS), FTD-ALS, bvFTD comprising a TPD-43 proteinopathy, semantic variant primary progressive aphasia (svPPA), non-fluent variant primary progressive aphasia (nfvPPA) comprising a TPD-43 proteinopathy, and / or FTD with motor neuron disease (FTD-MND). In one embodiment, the neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy is progressive supranuclear palsy (PSP), corticobasal degeneration (CBD) or behavioral variant FTD comprising a Tau proteinopathy (bvFTD), and the neurodegenerative disease of the FTD-ALS-spectrum associated with a TPD-43-proteinopathy is amyotrophic lateral sclerosis (ALS), bvFTD comprising a TPD-43 proteinopathy, semantic variant primary progressive aphasia (svPPA), non-fluent variant primary progressive aphasia (nfvPPA) and / or FTD with motor neuron disease (FTD-MND).

[0039] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample lower than a 3R / 4R-Tau-ratio in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has PSP or CBD, and a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample higher than a 3R / 4R-Tau-ratio in in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has bvFTD associated with a Tau-proteinopathy.

[0040] In one embodiment, a level of TDP-43 in the extracellular vesicles in said sample higher than a level of TDP-43 in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has ALS and / or bvFTD associated with a TPD-43-proteinopathy.

[0041] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample higher than a 3R / 4R-Tau-ratio in in extracellular vesicles in a control sample of a healthy individual, and a level of TDP-43 in the extracellular vesicles in said sample equal toTPD-43 in in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has bvFTD associated with a Tau-proteinopathy.

[0042] In one embodiment, a 3R / 4R-Tau-ratio in said extracellular vesicles in said sample in essence equal to or not diverging significantly from a 3R / 4R-Tau-ratio in extracellular vesicles in a control sample of a healthy individual, and a level of TDP-43 in said extracellular vesicles in said sample higher than a level of TPD-43 in in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has ALS and / or bvFTD associated with a TPD-43- proteinopathy.

[0043] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles of said sample equal or below a reference value of 0.77±20%, indicates that said patient has PSP.

[0044] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles of said sample equal or below a reference value of 0.77±10%, indicates that said patient has PSP.

[0045] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles of said sample above a reference value of 0.77±20%, indicates that said patient does not have PSP.

[0046] Variation in the reference value may be employed, for example any value of 0.60, 0.61 , 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71 , 0.72, 0.73, 0.74, 0.75, 0.76, 0.78, 0.79, 0.80. 0.81 , 0.82, 0.83, 0.84, 0.085, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91 , 0.93 and 0.93, or any value within these values, or any value within a range formed by any two endpoints from this list, may be employed. Any reference value may also employ variation by ± 1 , 2, 3, 4, 5, 10, 15, 20, 25, or 30% from the specific value or any variation within this range. This possible variation in reference value applies to any given embodiment in the present disclosure for the relevant biomarker, i.e. a 3R / 4R-Tau-ratio. In one embodiment a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample above a reference value of 1 ,27±20%, indicates that said patient has bvFTD associated with a Tau- proteinopathy.

[0047] In one embodiment a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample above a reference value of 1.27±10%, indicates that said patient has bvFTD associated with a Tau- proteinopathy.

[0048] In one embodiment a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample below a reference value of 1 ,27±20%, indicates that said patient does not have bvFTD associated with a Tau-proteinopathy.

[0049] Variation in the reference value may be employed, for example any value of 1 .00, 1.01 , 1 .02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.10, 1.11 , 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19,

[0050] 1.20, 1 ,21 , 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 128, 1.29, 1.30, 1.31 , 1.32, 1.33, 1.34, 1.35, 1.36,

[0051] 1 .37, 1 .38, 1 .39, 1 .40, 1 .41 , 1 .42, 1 .43, 1 .44 and 1 .45 or any value within these values, or any value within a range formed by any two endpoints from this list, may be employed. Any reference value may also employ variation by ± 1 , 2, 3, 4, 5, 10, 15, 20, 25, or 30% from the specific value or any variation within this range. This possible variation in reference value applies to any given embodiment in the present disclosure for the relevant biomarker, i.e. a 3R / 4R-Tau-ratio in the extracellular vesicles.

[0052] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample of 0.77±20% to 1.27±20%, and a level of TDP-43 in the extracellular vesicles in said sample equal or higher than a cut off value of 13.87 pg / mL±20% indicates that said patient has ALS and / or bvFTD associated with a TDP-43-proteinopathy.

[0053] In one embodiment, a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample of 0.77±10% to

[0054] I .27±10%, and a level of TDP-43 in the extracellular vesicles in said sample equal or higher than a cut off value of 13.87 pg / mL±10% indicates that said patient has ALS and / or bvFTD associated with a TDP-43-proteinopathy.

[0055] Variation in the reference value may be employed, for example any value of 11 .0, 11.1 , 11 .2,

[0056] I I .30 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12.0, 12.1 , 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.0, 13.1 , 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.87, 13.9, 14.0, 14.1 , 14.2, 14.3, 14.4., 14.5, 14.6, 14.7, 14.8, 14.9, 15.0, 15.1 , 15.2, 15.3, 1.5.4, 1.5.5, 15.6, 15.7, 15.8, 15.9, 16.0, 16.1 , 16.2, 16.3, 16.4, 16.5, 16.6 and 16.7 or any value within these values, or any value within a range formed by any two endpoints from this list, may be employed. Any reference value may also employ variation by ± 1 , 2, 3, 4, 5, 10, 15, 20, 25, or 30% from the specific value or any variation within this range. This possible variation in reference value applies to any given embodiment in the present disclosure for the relevant biomarker, i.e. a level of TDP-43 in the extracellular vesicles.

[0057] In one embodiment, said patient is diagnosed with bvFTD, and a 3R / 4R-Tau-ratio of 0.77±10% to 1 ,27±10% and a level of TDP-43 equal or higher than cut off value of 13.87 pg / mL±10% in the extracellular vesicles in said sample, indicates that said patient has bvFTD associated with a TDP-43-proteinopathy, and a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample above a reference value of 1.27±10%, indicates that said patient has bvFTD associated with a Tau- proteinopathy.

[0058] In one embodiment, a level of TDP-43 in the extracellular vesicles in said sample above a reference value of 56.18±20% pg / mL, indicates that said patient has essentially pure motor ALS.

[0059] In one embodiment, a level of TDP-43 in the extracellular vesicles in said sample above a reference value of 56.18±10% pg / mL, indicates that said patient has essentially pure motor ALS.

[0060] Variation in the reference value may be employed, for example any value of 44.5, 45.0, 45.5, 50.0, 50.5, 51.0, 51.5, 52.0, 52.5, 53.0, 53.5, 54.0, 54.5, 55.0, 55.5, 56.0, 56.18, 56.5, 57.0, 57.5, 58.0, 58.5, 59.0, 59.5, 60.0, , 60.5, 61.0, 61.5, 62.0, 62.5, 63.0, 63.5, 64.0, 64.5, 65.0, 65.5, 66.0, 66.5, 67.0 and 67.5 or any value within these values, or any value within a range formed by any two endpoints from this list, may be employed. Any reference value may also employ variation by ± 1 , 2, 3, 4, 5, 10, 15, 20, 25, or 30% from the specific value or any variation within this range. This possible variation in reference value applies to any given embodiment in the present disclosure for the relevant biomarker, i.e. a level of TDP-43 in the extracellular vesicles.

[0061] In embodiments, the reference values, cut-offs, or other statistical values for the disease indication FTD-ALS, preferably as a TPD-43-proteinopathy, are the same as those represented for FTD with a TPD-43-proteinopathy. In embodiments, the reference values, cut-offs, or other statistical values for the disease indication ALS, preferably as a TPD-43-proteinopathy, are the same as those represented for FTD with a TPD-43-proteinopathy. In embodiments, the3R / 4R- Tau-ratios and / or levels of TDP-43, in extracellular vesicles, as described herein for indicating the presence of FTD with a TPD-43-proteinopathy, also may be employed to indicate that a subject has FTD-ALS, preferably as a TPD-43-proteinopathy, and / or ALS, preferably as a TPD-43- proteinopathy.

[0062] In one embodiment, the sample is a blood sample, preferably a plasma sample.

[0063] Advantageously, the method of the present invention can be performed with blood samples, such as plasma samples derived from a subject suspected of having a neurodegenerative disease of the FTD-ALS-spectrum, which represent a sample type that can be easily provided with low effort and without requiring specialized personnel. Surprisingly, the present invention thus provides a low-invasive liquid biomarker for the identification of molecular pathology, allowing pathologybased diagnosis and for example stratification of patients to clinical trials, thereby strongly advancing the development of new disease-modifying therapies for the diseases of the FTD-ALS spectrum. In light of novel therapeutic approaches in ALS and FTD, such biomarkers are strongly desired. The clinical study disclosed in the examples below, comprising a large cohort of 704 patients, including 37 genetically and 31 pathologically confirmed samples as well as in an independent validation cohort of 287 patients with 34 genetically confirmed cases, it is clearly demonstrated shown that determining a level of one or more FTD-ALS-spectrum biomarkers in extracellular vesicles derived from plasma (in particular TDP-43 and / or the 3R / 4R-Ta-ratio in plasma EVs) allows a differential diagnosis of tau and TDP-43 pathology and differential diagnosis of the disease of the FTS-ALS spectrum. The determination of the biomarkers in plasma EVs for example allows to discriminate between tau and TDP-43 pathology in bvFTD, and can discriminate patients with ALS and PSP from healthy and neurodegenerative disease controls with high diagnostic accuracy (AUC > 0.91).

[0064] In one embodiment, the extracellular vesicles are small extracellular vesicles (sEVs) and / or medium extracellular vesicles (mEVs).

[0065] In one embodiment, the extracellular vesicles (EVs) are neuron derived EVs.

[0066] In one embodiment, the extracellular vesicles (EVs) are L1 cell adhesion molecule (L1CAM) positive (L1CAM+-EVs) extracellular vesicles.

[0067] In one embodiment the extracellular vesicles (EVs) are CD81 positive (CD81+-EVs) extracellular vesicles.

[0068] In one embodiment the extracellular vesicles (EVs) are CD9 positive (CD9+-EVs) extracellular vesicles.

[0069] In one embodiment the extracellular vesicles (EVs) are CD63 positive (CD63+-EVs) extracellular vesicles.

[0070] In one embodiment the extracellular vesicles (EVs) are L1 cell adhesion molecule (L1 CAM) positive (L1CAM+-EVs), CD81 positive (CD81 +-EVs), CD9 positive (CD9+-EVs) and / or CD63 positive (CD63+-EVs) extracellular vesicles.

[0071] In one embodiment the extracellular vesicles have one or more specific surface markers on their surface. In one embodiment the extracellular vesicles have one or more specific surface markers on their surface, wherein the surface markers are selected from the group consisting of L1 Cell Adhesion Molecule (L1CAM), Neural Cell Adhesion Molecule (NCAM), CD81 , CD9 and CD63.

[0072] In one embodiment, the level of the one or more biomarkers is indicative of disease progression and / or disease severity of said neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy or associated with a TPD-43-proteinopathy

[0073] In one aspect, the invention relates to a kit for carrying out the method of the invention, comprising: a. reagents for isolating and optionally concentrating extracellular vesicles from a sample obtained from a patient, b. detection reagents for determining the level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, wherein the one or more biomarkers are preferably a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TDP-43, c. reference data comprising a reference level for diagnosis of whether the patient has a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau- proteinopathy or associated with a TPD-43-proteinopathy, or for disease monitoring and / or therapy guidance in a patient diagnosed with a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy or associated with a TPD-43- proteinopathy, d. wherein said reference data is preferably stored on a computer readable medium and / or employed in in the form of computer executable code configured for comparing the determined levels of the one or more biomarkers to said reference level.

[0074] In one aspect, the invention relates to a method for treating a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising diagnosis, disease monitoring and / or therapy guidance of the patient, the method comprising: a. providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, c. wherein the level of the one or more biomarkers is indicative of whether the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD-ALS- spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD- ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy, and d. treating said patient with a therapeutically effective agent for treating a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy.

[0075] As described in more detail herein, the treatment of said disorders can be tailored according to the pathomechanisms of the disease, as determined using the methods and means described herein. For example, the method of the invention enables differentiating between a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy and a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy, preferably comprising additionally a specific treatment for the identified condition.

[0076] In one aspect, the invention relates to a method for determining a level of one or more FTD-ALS- spectrum biomarkers in extracellular vesicles of a sample from a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosisspectrum (FTD-ALS-spectrum), the method comprising: a. providing a sample from said patient, wherein said sample comprises extracellular vesicles, and b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample.

[0077] In one aspect, the invention relates to a sample obtained from a patient (or a sample derived from a patient sample) suspected of or having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), the sample comprising: a. extracellular vesicles obtained from a blood sample of the patient, or the contents of said extracellular vesicles, and b. one or more binding agents that specifically bind a target FTD-ALS-spectrum biomarker, in complex with said target biomarker, in the extracellular vesicles, or in the sample comprising the contents of said extracellular vesicles.

[0078] In embodiments relating to the methods of treatment, methods of determining, and the sample, the FTD-ALS-spectrum biomarker is a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TAR DNA-binding protein 43 (TDP-43).

[0079] In embodiments of the sample, or the method of determining a level of one or more FTD-ALS- spectrum biomarkers in extracellular vesicles of a sample, a. a 3R / 4R-Tau-ratio is above 1.27±10, b. a 3R / 4R-Tau-ratio is from 0.77±10% to 1.27±10%, and a level of TDP-43 is equal or higher than 13.87 pg / mL±20%, c. said patient is diagnosed with bvFTD, and a 3R / 4R-Tau-ratio is from 0.77±10% to 1.27±10%, and a level of TDP-43 is equal or higher than 13.87 pg / mL±10%, and / or d. a level of TDP-43 is above 56.18±10% pg / mL.

[0080] As described above, the various levels and / or amounts of the biomarkers disclosed herein may indicate a diagnosis, disease monitoring, treatment and / or therapy guidance of a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosisspectrum (FTD-ALS-spectrum).

[0081] Other similar methods and / or samples employed in such methods may be considered by a skilled person to fall under the scope of the invention. All features described in the present specification may be employed to define any other embodiment or aspect of the invention. For example, features used to describe the method may be used to describe the kit, and vice versa. For example, features used to describe the method of diagnosis may be used to describe the method of treatment, and vice versa. In essence, any embodiment applicable to one aspect or embodiment of the invention may be used to define any other aspect or embodiment of the invention, as would be understood by a skilled person. Despite covering various embodiments or aspects, these various means of the invention are unified by their unique and related ability to effectively and accurately diagnose a neurodegenerative disease of the FTS-ALS spectrum and determine the underlying molecular pathology of the neurodegenerative disease of the FTD-ALS- spectrum.

[0082] DETAILED DESCRIPTION

[0083] The invention relates broadly to a method for diagnosis, disease monitoring and / or therapy guidance in a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic, in particular for diagnosis of a disease of the FTD-ALS spectrum and its underlying molecular pathomechanism. The method comprises multiple steps, each of which may be used to define the invention, without necessary limitation to all other method steps disclosed herein. General terms:

[0084] As used herein, the terms “comprising” and “including” or grammatical variants thereof are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof. This term encompasses the terms “consisting of’ and “consisting essentially of’.

[0085] Thus, the terms “comprising” / “including” / ”having” mean that any further component (or likewise features, integers, steps and the like) can / may be present. The term “consisting of’ means that no further component (or likewise features, integers, steps and the like) is present.

[0086] The term “consisting essentially of’ or grammatical variants thereof when used herein are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof but only if the additional features, integers, steps, components or groups thereof do not materially alter the basic and novel characteristics of the claimed composition, device or method.

[0087] Thus, the term “consisting essentially of’ means those specific further components (or likewise features, integers, steps and the like) can be present, namely those not materially affecting the essential characteristics of the composition, device or method. In other words, the term "consisting essentially of' (which can be interchangeably used herein with the term "comprising substantially"), allows the presence of other components in the composition, device or method in addition to the mandatory components (or likewise features, integers, steps and the like), provided that the essential characteristics of the device or method are not materially affected by the presence of other components.

[0088] The term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, biological and biophysical arts. As used herein, the “patient” or "subject" may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and animals, particularly mammals, and other organisms.

[0089] Medical conditions:

[0090] “Neurodegenerative diseases” are caused by the progressive loss of structure or function of neurons, in the process known as neurodegeneration. Such neuronal damage may ultimately involve cell death. Neurodegenerative diseases include for example amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease, multiple system atrophy, and prion diseases.

[0091] “Dementia” is a condition comprising a variety of related symptoms, comprising progressive impairments in memory, thinking, and behavior, which negatively impact a person's ability to function and carry out everyday activities. Besides memory impairment and the disruption in thought patterns, the most common symptoms comprise emotional problems, difficulties with language, and decreased motivation. Several diseases and injuries to the brain, such as a stroke, can give rise to dementia. However, the most common cause is Alzheimer's disease, a neurodegenerative disorder. Vascular dementia is the second most common type of dementia and is caused by reduced blood supply to the brain due to diseased blood vessels. Mixed dementia is a condition in which a person suffers from more than one type of dementia, whereby Alzheimer’s disease and vascular dementia are the most common types. Frontotemporal dementias (FTDs) are characterized by drastic personality changes and language difficulties. In all FTDs, the person has a relatively early social withdrawal and early lack of insight. A frontotemporal dementia associated with amyotrophic lateral sclerosis (ALS) known as (FTD- ALS) includes the symptoms of FTD (behavior, language and movement problems) co-occurring with amyotrophic lateral sclerosis (loss of motor neurons).

[0092] The term “neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum)” refers to a specific group of neurodegenerative diseases that is characterized by the degeneration of neurons in the brain and spinal cord, specifically involving diseases of the frontotemporal dementia (FTD) spectrum and the amyotrophic lateral sclerosis (ALS) spectrum. The diseases of the FTD-ALS spectrum are linked and considered as one spectrum of diseases dure to their overlapping clinical, genetic, and pathological characteristics, often affecting both cognitive functions and motor skills. For example, genetic mutations in specific genes, such as GRN, C9orf72, VCP, MAPT, TARDBP, and PUS, have been identified in both diseases of the FTD spectrum and the ALS spectrum. Further, both diseases of the FTD and the ALS spectrum involve the abnormal accumulation and aggregation of proteins within neurons, such as TDP-43 (“TDP-43 pathology” also termed ’’TPD-43- proteinopathy”, FUS (“FUS pathology”, also termed “FUS-proteinopathy”, and tau proteins (“Tau pathology” also termed “Tau-proteinopathy”), leading to disruption of cellular function and neurodegeneration. It is further known that mutations in the GRN, C9orf72, VCP and other genes result in a TDP-43 pathology within the diseases of the FTS-ALS spectrum, while mutations in MAPT \ead to a tau pathology within the diseases of the FTD-ALS spectrum.

[0093] Frontotemporal dementia (FTD) encompasses different neurodegenerative disorders that involve the progressive loss of neurons and synapses in the frontal and temporal lobes, leading to atrophy and dysfunction of these brain regions associated with personality, behavior, and language. FTD is characterized by a variety of symptoms and can be categorized into different clinical subtypes. Depending on the clinical phenotype, patients may primarily suffer from behavioral changes and deficits in executive functions (behavioral FTD - bvFTD) or language disorders (primary progressive aphasia - PPA). Behavioral Variant FTD (bvFTD) is the most common form of FTD, characterized by significant changes in personality and behavior. Patients often exhibit apathy, disinhibition, loss of empathy, compulsive behaviors, and alterations in social conduct. PPA includes the semantic variant (svPPA) characterized by the loss of word meaning, leading to difficulties in understanding and producing meaningful language, the nonfluent variant (nfvPPA) characterized by difficulties in speech production and by slow, effortful, and halting speech, and the logopenic Variant PPA (IvPPA) characterized by impaired word retrieval and sentence repetition, with relatively preserved grammar and motor speech.

[0094] To date there are no curative or disease modifying therapies for FTD spectrum diseases. Treatments addressing the symptoms of FTD include without limitation antidepressants such as trazodone and serotonin reuptake inhibitors (SSRIs) such as citalopram, escitalopram, paroxetine or sertraline to address behavioral symptoms and antipsychotics such as olanzapine and quetiapine to address behavioral symptoms. Further behavioral therapy, cognitive therapy, speech therapy, physical therapy and occupational therapy may be employed. Treatment approaches still under experimental investigation include gene therapy targeting specific genetic mutations such as mutations of the GRN or C9orf72 gene, antisense oligonucleotides (ASOs), immunotherapy targeting and clearing abnormal tau proteins and aggregates, small molecule inhibitors for inhibit tau aggregation or enhance the clearance of tau aggregates, neurotrophic factors such as brain-derived neurotrophic factor (BDNF) or glial cell line-derived neurotrophic factor (GDNF) and cell replacement therapies to replace lost neurons.

[0095] Amyotrophic Lateral Sclerosis (ALS) is a progressive neurodegenerative disease that primarily affects motor neurons in the brain and spinal cord, leading to muscle weakness, atrophy, and ultimately paralysis. ALS involves the selective loss of upper motor neurons in the brain and lower motor neurons in the spinal cord and brainstem. This leads to muscle weakness, spasticity, and hyperreflexia (exaggerated reflexes). ALS is characterized by the progressive loss of motor function, starting with muscle weakness and atrophy in the limbs (limb-onset ALS) or in the muscles involved in speech and swallowing (bulbar-onset ALS). Common symptoms include muscle twitching (fasciculations), cramps, stiffness, and difficulty walking or using the hands. As the disease advances, patients may experience difficulties with speaking (dysarthria), swallowing (dysphagia), and breathing, often requiring ventilatory support. While ALS primarily affects motor neurons, some patients may also experience cognitive and behavioral changes, especially those with overlap with FTD (non-motor symptoms in ALS). ALS can be sporadic (with no known family history) or familial (inherited). Several genetic mutations are known to be associated with ALS, including those in the C9orf72, SOD1, TARDBP, FL / S, and other genes and abnormal protein aggregates, such as TDP-43, SOD1 , and FUS, are found in the motor neurons of ALS patients. A mutation in the C9orf72 gene is the most common genetic cause of both ALS, FTD and FTD with concomitant amyotrophic lateral sclerosis (FTD-ALS).

[0096] Treatment means available include managing symptoms and improving quality of life such as by physical therapy, occupational therapy, speech therapy, nutritional support, and respiratory care. Further, riluzole and edaravone FDA-approved drugs for the treatment of ALS, which may slow disease progression. Further therapeutic agents may be employed for managing symptoms such as muscle spasticity, pain, and depression, including muscle relaxants such as baclofen or tizanidine, anticholinergics such as glycopyrrolate and atropine, antidepressants such as SSRIs (e.g., sertraline) or tricyclic antidepressants (e.g., amitriptyline) and painkillers such as NSAIDs, opioids, and neuropathic pain agents (e.g., gabapentin). Further approaches still under experimental investigation include gene therapy addressing mutations in genes associated with ALS such as SOD1 and C9orf72, antisense oligonucleotides (ASOs), stem cell therapy to replace lost neurons and provide neuroprotective factors to support remaining motor neurons, neuroprotective agents such as antioxidants, anti-inflammatory agents, and mitochondrial protectants and immunotherapy.

[0097] Pure- Motor ALS is a specific phenotype of Amyotrophic Lateral Sclerosis affecting motor neurons without involving sensory, autonomic, or cognitive functions. Patients usually exhibit weakness and atrophy of voluntary muscles due to motor neuron loss, while sensory functions and mental status remain intact. The primary symptoms include progressive muscle weakness, fasciculations (muscle twitches), spasticity, and atrophy. The FTD-ALS spectrum also includes FTD with concomitant amyotrophic lateral sclerosis (FTD- ALS), wherein patient present with may present with both FTD and ALS symptoms, such as behavioral changes alongside muscle weakness and atrophy, corticobasal syndrome (CBS) and progressive supranuclear palsy (PSP; the classic PSP syndrome is called Richardson syndrome).

[0098] Overall, within the FTD-ALS spectrum ALS, FTD-ALS and roughly half of bvFTD cases are characterized by intracellular protein inclusions of TAR DNA-binding protein (TDP-43) (2), PSP, CBD and approximately 40% of bvFTD cases have been linked to tau pathology at autopsy (frontotemporal lobar degeneration, FTLD-tau) (3). Together, FTLD-tau and FTLD-TDP-43 account for nearly 90% of bvFTD cases.

[0099] Corticobasal Syndrome (CBS) is a neurodegenerative disorder that involves the progressive degeneration of the cerebral cortex and the basal ganglia. CBS is characterized by a combination of motor, cognitive, and behavioral symptoms that overlap with those observed in frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). CBS is mainly associated with tau- aggregates (tau-pathology), neurofibrillary tangles, and sometimes TDP-43 aggregates (TDP-43 pathology), disrupting neuronal function and leading to cell death. Motor symptoms include asymmetrical motor dysfunction, apraxia, alien limb phenomenon and myoclonus, cognitive and behavioral symptoms include executive dysfunction, language impairments and behavioral changes such as apathy, disinhibition, and compulsive behaviors.

[0100] To date there are no curative or disease modifying therapies for CBS. Treatments addressing the symptoms of CBS include without limitation levodopa to address the motor symptoms, cholinesterase inhibitors such as donepezil, rivastigmine and galantamine to address cognitive symptoms, antidepressants and antipsychotics to address anxiety symptoms, aggression and behavioral symptoms and clonazepam to address muscle spasms. Further physical therapy, occupational therapy and speech therapy are employed. Further approaches still under experimental investigation include gene therapy, antisense oligonucleotides (ASOs), stem cell therapy to replace lost neurons and provide neuroprotective factors to support remaining motor neurons and neuroprotective agents such as neurotrophic factors.

[0101] Progressive supranuclear palsy (PSP) is a neurodegenerative disorder characterized by the accumulation of abnormal tau protein in the brain (Tau-pathology), leading to progressive deterioration of specific brain regions, particularly those controlling movement, balance, and eye movements. PSP involves the progressive loss of neurons in the brainstem, basal ganglia, and frontal lobes, leading to the characteristic motor symptoms such as postural instability, gait disturbance, axial rigidity and oculomotor dysfunction and cognitive and behavioral symptoms such as executive dysfunction, apathy, disinhibition, and changes in personality and mood. Most cases of PSP are sporadic, however, specific genetic mutations, such as in the MAPT gene, have been identified in PSP patients.

[0102] To date there are no curative or disease modifying therapies for PSP. Treatments addressing the symptoms of PSP include without limitation Parkinsons disease treatments such as levodopa to address cognitive and behavioral symptoms, onabotulinumtoxinA (Botox) to address oculomotor dysfunction and eyelid spasms, and behavioral changes such as impulsive behavior. Further eyeglasses with bifocal or prism lenses, speech and swallowing evaluations and therapy, physical therapy and occupational therapy. Further approaches still under experimental investigation include gene therapy, antisense oligonucleotides (ASOs), stem cell therapy to replace lost neurons and provide neuroprotective factors to support remaining motor neurons and neuroprotective agents such as neurotrophic factors.

[0103] Alzheimer’s disease is a neurodegenerative disorder characterized by pathological hallmarks such as the accumulation of senile plaques mainly composed of amyloid p (Ap) fibrils, and neurofibrillary tangles (NFTs) made up of tau fibrils (Serrano-Pozo et al., 2011). The formation and spread of these protein aggregates in the brain are implicated in the impairment of neurotransmitter systems and the loss of neurons. In the early stages of the disease, neural connections involved in memory, including the entorhinal cortex and hippocampus, are affected. As the disease progresses the pathology spreads to other areas of the brain such as the cerebral cortex important for language, logic, and social interactions.

[0104] The amyloid p proteins Ap40 and Ap42 are the main constituents of extracellular plaque in the AD brain. Serial proteolytic cleavage of the amyloid precursor protein (APP) by enzymes p- and y- secretase yields a 37-43 residue Ap peptide, whose length depends on the y-secretase cleavage site (Zhang et al., 2007). APP is a transmembrane protein that functions in neuronal development, axonal transport, and neurite outgrowth (Kang et al., 1987). Ap42 is more prevalent than Ap40 in amyloid plaques and is also more aggregation-prone presumably owing to its highly hydrophobic residues in the carboxy-terminal region of the peptide. The main component of neurofibrillary tangles (NFTs) in AD is the microtubule-associated protein tau. Multiple lines of structural evidence have revealed that tau self-assembles through various intermediates into p- sheet-rich amyloid structures (Nizynski et al., 2017).

[0105] In the context of the present invention the term “proteinopathy” refers to a pathological condition characterized by the abnormal accumulation and aggregation of specific proteins in the central nervous system (CNS). These misfolded proteins disrupt normal cellular functions and lead to neurodegeneration. Proteinopathies involve proteins that have misfolded and formed abnormal structures. These misfolded proteins can aggregate and form insoluble deposits within neurons and glial cells. The accumulation of these protein aggregates can interfere with cellular processes, disrupt cellular homeostasis, and lead to cell death. In diseases of the FTD-ALS spectrum in particular Tau protein, TAR DNA-binding protein 43 (TDP-43), FUS and SOD1 are involved. In the context of the present invention the term “Tau-proteinopathy” refers to a pathological condition characterized by the abnormal accumulation and aggregation of Tau protein. In the context of the present invention the term “TPD-43-proteinopathy” refers to a pathological condition characterized by the abnormal accumulation and aggregation of TDP-43.

[0106] The term "subject" or “patient may be in the context of the invention preferably be a mammal, more preferably a human. Herein the terms "subject" or “patient may be used interchangeably. In the context of the present invention a subject or patient has preferably been diagnosed with a neurodegenerative disease or may be suspected of having a neurodegenerative disease of the FTS-ALS spectrum and / or may be showing early signs of a neurodegenerative disease.

[0107] Diagnosis, disease monitoring and therapy guidance:

[0108] The methods and kits of the invention may be used for monitoring, therapy monitoring, therapy guidance and / or therapy control. “Monitoring” or “disease monitoring” relates to keeping track of a patient, potentially occurring complications and disease progression, e.g. to analyze the progression of the disease or healing process or the influence of a particular treatment or therapy on the health state of the patient.

[0109] The term “therapy monitoring” or “therapy control” in the context of the present invention refers to the monitoring and / or adjustment of a therapeutic treatment of said patient, for example by obtaining feedback on the efficacy of the therapy. As used herein, the term “therapy guidance” refers to application of certain therapies, therapeutic actions or medical interventions based on the value / level of one or more biomarkers and / or clinical parameter and / or clinical scores. This includes the adjustment of a therapy or the discontinuation of a therapy.

[0110] Biomarkers:

[0111] As used herein, terms such as “marker”, “surrogate”, “prognostic marker”, “factor” or “biomarker” or “biological marker” are used interchangeably and relate to measurable and quantifiable biological markers (e.g., specific protein or enzyme concentration or a fragment thereof, specific hormone concentration or a fragment thereof, or presence of biological substances or a fragment thereof such as TDP-43 or Tau protein or a ratio of 3R- and 4R Tau protein fragments) which serve as indices for health- and physiology-related assessments, such as a disease / disorder / clinical condition risk, preferably the presence of a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum) and the identification of its underlying molecular mechanism. A marker or biomarker is defined as a characteristic that can be objectively measured and evaluated as an indicator of normal biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention. Biomarkers may be measured in a sample (as a blood, plasma, urine, or tissue test), in particular in extracellular vesicles in said sample.

[0112] The term “FTD-ALS-spectrum biomarkers” refers to biomarkers which are associated with the presence and underlying molecular pathomechanism of neurodegenerative disease of the FTD- ALS-spectrum in a subject. Such biomarkers in particular involve proteins that can form a pathological protein aggregate in neurons of a subject with a neurodegenerative disease of FTD- ALS-spectrum and include without limitation Tau protein or fragment(s) thereof such as 3R-Tau or 4R-Tau, TDP-43, FUS and superoxid dismutase-1 (SOD1), preferably Tau protein or fragment(s) thereof and TDP-43. In embodiments an FTD-ALS-spectrum biomarker may also be a ratio of the level of these proteins or fragment(s) thereof such as a ratio of the level of 3R-Tau and 4R-Tau. In one embodiment the level of one or more FTD-ALS-spectrum biomarkers is determined in extracellular vesicles in a sample derived from a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosisspectrum (FTD-ALS-spectrum).

[0113] Tau proteins are primarily expressed in neurons of the central nervous system (CNS) and are crucial for regulating the assembly and stabilization of microtubules. Encoded by the MAPT gene, tau exists in six isoforms in the adult human brain, generated through alternative splicing, with variations in N-terminal domains and repeated binding domains (4). Its subcellular localization varies, with predominant distribution in axonal regions, dendritic spines, and even the nucleus, influenced by specific isoforms. Structurally, tau comprises a projection domain and a microtubule-binding domain, with a proline-rich region facilitating interactions with signaling proteins. Post-translational modifications, notably phosphorylation, heavily regulate tau's function, impacting its binding affinity to microtubules and aggregation propensity, particularly evident in neurodegenerative diseases like Alzheimer's disease (AD). Based on the presence of three or four repetitive protein domains, so-called repeats, 3-repeat or 4-repeat isoforms are distinguished (3R, 4R tau). Tau aggregation characterizes tauopathies (also termed “Tau-proteinopathies” or Tau-pathologies”), with multiple factors influencing this process, including specific phosphorylation sites and truncation. Tau's main functions include regulating microtubule dynamics, axonal transport, synaptic plasticity, and even roles in neurogenesis and nucleic acid integrity. Furthermore, tau can propagate pathology through various mechanisms, including cell- to-cell transmission facilitated by extracellular release and internalization. Neurodegenerative diseases can be characterized by the predominance of 3R tau aggregates (Pick’s disease) or 4R tau pathology for example in PSP, CBD, argyrophilic grain disease or globular glial tauopathy (GGT) (5).

[0114] TAR DNA-binding protein 43 (TDP-43) is a nuclear protein encoded by the TARDBP gene, binding nucleic acids. TDP-43 plays a critical role in various cellular processes including gene expression regulation, RNA splicing, transport, and stability. TDP-43 is predominantly located in the nucleus, but under pathological conditions, it can mislocalize to the cytoplasm and form insoluble aggregates, also termed inclusions. In the context of diseases of the FTD-ALS spectrum, TDP-43 proteinopathies are characterized by the abnormal accumulation, phosphorylation, ubiquitination, and cleavage of TDP-43 in neurons and glial cells. These pathological inclusions are for example observed in ALS, FTD-ALS, bvFTD comprising a TPD-43 proteinopathy, semantic variant primary progressive aphasia (svPPA), non-fluent variant primary progressive aphasia (nfvPPA) comprising a TPD-43 proteinopathy, Alzheimer’s disease and / or FTD with motor neuron disease (FTD-MND). The misfolding and aggregation of TDP-43 disrupts normal cellular functions and contributes to neurodegeneration by impairing RNA metabolism and inducing cellular stress responses.

[0115] The term “healthy individual” refers to a subject not being diagnosed, not suspected of and / or not showing symptoms of a neurodegenerative disease, in particular a neurodegenerative disease of the FTD-ALS-spectrum. In embodiments the term “control sample” refers to a sample obtained from a healthy individual that is obtained and prepared in a similar manner as the sample derived from a subject suspected of having a neurodegenerative disease of the FTD-ALS-spectrum according to the present invention. In embodiments the level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles is determined in a similar manner in the sample from said subject and in the control sample.

[0116] As used herein, the term “sample” is a biological sample that is obtained or isolated from the patient or subject. “Sample” as used herein may, e.g., refer to a sample of bodily fluid or tissue obtained for the purpose of analysis, diagnosis, prognosis, or evaluation of a subject of interest, such as a patient. Preferably herein, the sample is a sample of a bodily fluid, such as blood, serum, plasma, cerebrospinal fluid, urine, saliva, sputum, pleural effusions, cells, a cellular extract, a tissue sample, any tissue sample from the upper or lower respiratory tract, a tissue biopsy, a stool sample and the like. Particularly, the sample is blood, blood plasma, blood serum, most preferably blood plasma.

[0117] “Plasma” in the context of the present invention is the virtually cell-free supernatant of blood containing anticoagulant obtained after centrifugation. Exemplary anticoagulants include calcium ion binding compounds such as EDTA or citrate and thrombin inhibitors such as heparinates or hirudin. Cell-free plasma can for example be obtained by centrifugation of the anticoagulated blood (e.g. citrated, EDTA or heparinized blood), for example for at least 15 minutes at 2000 to 3000 g.

[0118] “Serum” in the context of the present invention is the liquid fraction of whole blood that is collected after the blood is allowed to clot. When coagulated blood (clotted blood) is centrifuged serum can be obtained as supernatant.

[0119] Extracellular vesicles:

[0120] Extracellular vesicles (EVs) are small vesicles that are released by many cell types including neurons and serve various functions, including clearance of superfluous or toxic cellular content and cell-cell communication (Vidal et al., Traffic 2019; 20(11): 815-828; Mathieu et al., Nat Cell Biol 2019; 21 (1): 9-17; van Niel, G et al., Nat. Rev. Mol. Cell Biol. 19, 213-228 (2018)). Based on their biogenesis, EVs can be classified into “exosomes” derived from the endosomal system usually having a diameter of 30 to 150 nm, “microvesicles” secreted by direct budding from the plasma membrane usually having a diameter of 50 to 1000 nm, and “apoptotic bodies” produced during apoptosis of a cell usually having a diameter of 50 to 5000 nm. EVs can be further classified by their size into “small extracellular vesicle (small EVs)” usually having a diameter of 30 to 150 nm, “medium extracellular vesicles" (medium EVs) usually having a diameter of 100 to 100 nm, and “large extracellular vesicles” (large EVs) usually having a size of > 2000 nm. Small EVs include mainly exosomes and may comprise specific markers such as tetraspanins (e.g., CD9, CD63, CD81), ESCRT proteins, certain lipids and other proteins such as tau and / or TDP- 43. They are involved in transferring proteins, lipids, and genetic material between cells, facilitating cell communication and various biological processes. Medium and large EVs mainly comprise microvesicles and apoptotic bodies. Microvesicles contain a broad range of cellular components, including proteins such as Tau and / or TPD-43, lipids, and nucleic acids, and are involved in diverse biological functions like inflammation, coagulation, and cellular communication. Apoptotic bodies are the largest EVs formed during programmed cell death (apoptosis), containing cellular fragments and organelles. They play a role in clearing apoptotic cells and maintaining tissue homeostasis. In embodiments the extracellular vesicles are small extracellular vesicles (sEVs) and / or medium extracellular vesicles (mEVs).

[0121] A person skilled in the art is well aware of methods for determining the size, e.g. the diameter of EVs. Such methods for size determination include nanoparticle tracking analysis (NTA), dynamic light scattering (DLS), transmission electron microscopy (TEM), scanning electron microscopy (SEM), atomic force microscopy (AFM), resistive pulse sensing (RPS) and flow cytometry.

[0122] Neuron derived EVs (NDEVs) are a specific subset of extracellular vesicles (EVs) released from neurons. These vesicles play crucial roles in neuronal communication, synaptic plasticity, and the maintenance of neural network integrity. NDEVs may carry a diverse range of biological molecules such as proteins including synaptic proteins, enzymes, receptors, and signaling molecules, lipids such as lipids involved in neuronal signaling and membrane structure, nucleic acids such as mRNAs, microRNAs, and other non-coding RNAs that can influence gene expression in recipient cells, metabolites such as small molecules and metabolites that can affect cellular metabolism and signaling. They can further transport pathological tau (21- 24) and TDP- 43 (25) species between cells and induce aggregate formation in target cells. Importantly, the presence of TDP-43 in EVs could reflect its disease-associated mislocalization from the nucleus to the cytosol, because extranuclear localization of TDP-43 is a prerequisite for its sorting into EVs.

[0123] Extracellular vesicles carry specific surface markers. Surface markers present on the surface of EVs include without limitation L1 Cell Adhesion Molecule (L1 CAM, also termed CD171), Neural Cell Adhesion Molecule (NCAM, also termed CD65), CD81 , CD9 and CD63. Surface markers particularly expressed on the surface of neuron-derived extracellular vesicles (NDEVs) include without limitation L1 Cell Adhesion Molecule (L1CAM, also termed CD171) and Neural Cell Adhesion Molecule (NCAM, also termed CD65). In one embodiment the extracellular vesicles have one or more specific surface markers on their surface, wherein the surface markers are selected from the group consisting of L1 Cell Adhesion Molecule (L1CAM), Neural Cell Adhesion Molecule (NCAM), CD81 , CD9 and CD63.

[0124] Methods for the isolation of extracellular vesicles form a sample such as cerebrospinal fluid (CSF) fluid or a blood sample such as a plasma sample are disclosed in the examples below and in various publications such as Stundl et al., Movement Disorders, 2021 . Methods for isolating and concentrating extracellular vesicles (EVs) from biological samples include without limitation differential centrifugation which utilizes successive centrifugation steps at increasing speeds to separate EVs based on size and density, density gradient centrifugation separating EVs based on their buoyant density using density gradients (e.g., sucrose or iodixanol), size exclusion chromatography (SEC) separating EVs based on their size using a chromatography column packed with porous beads, ultrafiltration separating EVs based on their size using membranes with specific molecular weight cut-offs, immune affinity capture methods utilizing antibodies targeting specific EV surface markers to isolate EVs (such as L1CAM to isolate neuron derived EVs), precipitation by using polyethylene glycol (PEG) or other reagents and using microfluidic devices to isolate EVs based on size, charge, or other properties.

[0125] Measurement methods:

[0126] A skilled person is capable of obtaining or developing means for the identification, measurement, determination and / or quantification of any one of the above molecules, or fragments or variants thereof, as well as the other markers of the present invention according to standard molecular biological practice.

[0127] The level of the one or more biomarkers of the present invention can be determined by any assay that reliably determines the concentration of the marker. Particularly, mass spectrometry (MS) and / or immunoassays can be employed as exemplified in the appended examples. As used herein, an immunoassay is a biochemical test that measures the presence or concentration of a macromolecule / polypeptide in a solution through the use of an antibody or antibody binding fragment or immunoglobulin. Determination of the one or more biomarkers based on antibody recognition is a preferred embodiment of the invention. As used herein, the term, "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immuno reacts with) an antigen. According to the invention, the antibodies may be monoclonal as well as polyclonal antibodies.

[0128] An antibody is considered to be specific, if its affinity towards the molecule of interest, is at least 50-fold higher, preferably 100-fold higher, most preferably at least 1000-fold higher than towards other molecules comprised in a sample containing the molecule of interest. It is well known in the art how to develop and to select antibodies with a given specificity. In the context of the invention, monoclonal antibodies are preferred. The antibody or the antibody binding fragment binds specifically to the herein defined markers or fragments thereof. In particular, the antibody or the antibody binding fragment binds to the herein defined biomarkers.

[0129] Exemplary immunoassays can be luminescence immunoassay (LIA), radioimmunoassay (RIA), chemiluminescence- and fluorescence- immunoassays, enzyme immunoassay (EIA), Enzyme- linked immunoassays (ELISA), luminescence-based bead arrays, magnetic beads based arrays, protein microarray assays, rapid test formats, rare cryptate assay. Further, assays suitable for point-of-care testing and rapid test formats such as for instance immune-chromatographic strip tests can be employed.

[0130] Alternatively, instead of antibodies, other capture molecules or molecular scaffolds that specifically and / or selectively recognize the one or more biomarkers of the present invention may be encompassed by the scope of the present invention. Herein, the term “capture molecules” or “molecular scaffolds” comprises molecules which may be used to bind target molecules or molecules of interest, i.e. analytes from a sample. Capture molecules must thus be shaped adequately, both spatially and in terms of surface features, such as surface charge, hydrophobicity, hydrophilicity, presence or absence of lewis donors and / or acceptors, to specifically bind the target molecules or molecules of interest. Hereby, the binding may, for instance, be mediated by ionic, van-der-Waals, pi-pi, sigma-pi, hydrophobic or hydrogen bond interactions or a combination of two or more of the aforementioned interactions or covalent interactions between the capture molecules or molecular scaffold and the target molecules or molecules of interest. In the context of the present invention, capture molecules or molecular scaffolds may for instance be selected from the group consisting of a nucleic acid molecule, a carbohydrate molecule, a PNA molecule, a protein, a peptide and a glycoprotein. Capture molecules or molecular scaffolds include, for example, aptamers, DARpins (Designed Ankyrin Repeat Proteins). Affimers and the like are included.

[0131] Preferably, one of the antibodies can be labeled and the other antibody can be bound to a solid phase or can be bound selectively to a solid phase. In a particularly preferred aspect of the assay, one of the antibodies is labeled while the other is either bound to a solid phase or can be bound selectively to a solid phase. The first antibody and the second antibody can be present dispersed in a liquid reaction mixture, and wherein a first labeling component which is part of a labeling system based on fluorescence or chemiluminescence extinction or amplification is bound to the first antibody, and a second labeling component of said labeling system is bound to the second antibody so that, after binding of both antibodies to said biomarkers or fragments thereof to be detected, a measurable signal which permits detection of the resulting sandwich complexes in the measuring solution is generated. The labeling system can comprise a rare earth cryptate or chelate in combination with a fluorescent or chemiluminescent dye, in particular of the cyanine type.

[0132] Kits:

[0133] The invention further relates to kits, the use of the kits and methods wherein such kits are used.

[0134] The kit may additionally comprise items useful for obtaining a sample, such as a blood sample, for example the kit may comprise a container, wherein said container comprises a device for attachment of said container to a cannula or syringe, is a syringe suitable for blood isolation, exhibits an internal pressure less than atmospheric pressure, such as is suitable for drawing a pre-determined volume of sample into said container, and / or comprises additionally detergents, chaotropic salts, ribonuclease inhibitors, chelating agents, such as guanidinium isothiocyanate, guanidinium hydrochloride, sodium dodecylsulfate, polyoxyethylene sorbitan monolaurate, RNAse inhibitor proteins, and mixtures thereof, and / or A filter system containing nitro-cellulose, silica matrix, ferromagnetic spheres, a cup retrieve spill over, trehalose, fructose, lactose, mannose, poly-ethylen-glycol, glycerol, EDTA, TRIS, limonene, xylene, benzoyl, phenol, mineral oil, anilin, pyrol, citrate, and mixtures thereof.

[0135] The kit may further comprise reagents and means for isolating and optionally concentrating extracellular vesicles from a sample such as buffer solutions, reagents for creating a density gradient such as sucrose or iodixanol and / or reagents for precipitation such as polyethylene glycol (PEG).

[0136] As used herein, the “detection reagent” or the like are reagents that are suitable to determine the herein described marker(s), e.g. a level of TDP-43 and a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio). Such exemplary detection reagents are, for example, ligands, e.g. antibodies or fragments thereof, which specifically bind to the peptide or epitopes of the herein described marker(s). Such ligands might be used in immunoassays as described above. Further reagents that are employed in the immunoassays to determine the level of the marker(s) may also be comprised in the kit and are herein considered as detection reagents. Detection reagents can also relate to reagents that are employed to detect the markers or fragments thereof by MS based methods. Such detection reagent can thus also be reagents, e.g. enzymes, chemicals, buffers, etc, that are used to prepare the sample for the MS analysis. A mass spectrometer can also be considered as a detection reagent. Detection reagents according to the invention can also be calibration solution(s), e.g. which can be employed to determine and compare the level of the marker(s).

[0137] The methods of the present invention may in embodiments be partially computer-implemented. For example, the step of comparing the detected level of a biomarker, e.g. TDP-43 or 3R / 4R-Tau- ratio, with a reference level can be performed in a computer system. In the computer-system, the determined level of the biomarker(s) can be combined with other biomarker levels and / or clinical parameters of the subject in order to calculate a score, which is indicative for whether the patient has a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy or associated with a TPD-43-proteinopathy, or for disease monitoring and / or therapy guidance in a patient diagnosed with a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy or associated with a TPD-43-proteinopathy. For example, the determined values may be entered (either manually by a health professional or automatically from the device(s) in which the respective marker level(s) has / have been determined) into the computersystem. The computer-system can be directly at the point-of-care (e.g. primary care, hospital or home setting) or it can be at a remote location connected via a computer network (e.g. via the internet, or specialized medical cloud-systems, optionally combinable with other IT-systems or platforms such as hospital information systems (HIS)). Typically, the computer-system will store the values (e.g. biomarker level or clinical parameters such as age, blood pressure, weight, BMI, sex or Scores etc. on a computer-readable medium and calculate the score based-on pre-defined and / or pre-stored reference levels or reference values. The resulting score will be displayed and / or printed for the user (typically a health professional such as a physician or the patient). Alternatively or in addition, the associated diagnosis, disease monitoring and / or therapy guidance, patient management guidance or stratification will be displayed and / or printed for the user (typically a health professional such as a physician or the patient).

[0138] Statistical measures:

[0139] For any particular marker (like TDP-43 or 3R / 4R-Tau-ratio), a distribution of marker levels for subjects with and without a disease / condition will likely overlap. Under such conditions, a test does not absolutely distinguish normal from disease with 100% accuracy, and the area of overlap might indicate where the test cannot distinguish normal from disease. A threshold is selected, below which the test is considered to be abnormal and above which the test is considered to be normal or below or above which the test indicates a specific condition, e.g. infection. The area under the ROC curve is a measure of the probability that the perceived measurement will allow correct identification of a condition. ROC curves can be used even when test results do not necessarily give an accurate number. As long as one can rank results, one can create a ROC curve. For example, results of a test on "disease" samples might be ranked according to degree (e.g. 1=low, 2=normal, and 3=high). This ranking can be correlated to results in the "normal" population, and a ROC curve created. These methods are well known in the art; see, e.g., Hanley et al. 1982. Radiology 143: 29-36. Preferably, a threshold is selected to provide a ROC curve area of greater than about 0.5 (<= 0.5 means a test without discriminative power, more preferably greater than about 0.7, still more preferably greater than about 0.8, even more preferably greater than about 0.85, and most preferably greater than about 0.9 (up to 1 .0 means a test with perfect discrimination). The term "about" in this context refers to + / - 5% of a given measurement.

[0140] The horizontal axis of the ROC curve represents (1 -specificity), which increases with the rate of false positives. The vertical axis of the curve represents sensitivity, which increases with the rate of true positives. Thus, for a particular cut-off selected, the value of (1 -specificity) may be determined, and a corresponding sensitivity may be obtained. The area under the ROC curve is a measure of the probability that the measured marker level will allow correct identification of a disease or condition. Thus, the area under the ROC curve can be used to determine the effectiveness of the test.

[0141] Receiver Operating Characteristic (ROC) curves and the Concordance (C) statistic (also termed C index) are often used to assess the ability of a risk factor to predict outcome. For example, often a biomarker or risk factor is included in a logistic regression model to predict the likelihood a patient will develop a disease of interest. These predictive probabilities or risks can be examined to see how accurate they are at identifying patients who will develop the disease or not. For example, if the predicted probabilities for the diseased individuals are all higher than the predicted probabilities for the healthy individuals, then we say that the model has perfect discrimination. Discrimination is commonly measured using ROC curves. To construct an ROC curve, the predicted probabilities of the outcome of interest are repeatedly dichotomized into above vs. below a cutoff. For each cutoff, one can estimate the sensitivity (probability that the predicted risk is above the cutoff among patients with the disease) and the specificity (probability that the predicted risk is below the cutoff among patients without the disease). One can vary the cutoff to show a range of sensitivities vs. specificities. If the model has perfect discrimination, the ROC curve should hit the upper left corner of the plot (100% sensitivity and 100% specificity) (Logan, Medical College of Wisconsin, Biostatistics).

[0142] The area under the ROC curve is a useful measure for summarizing the ROC curve. If a curve is close to the upper left corner (Sensitivity=100%, Specificity=100%), then the area under the ROC curve should be close to 1 . The area under the ROC curve is equivalent to another statistic commonly used to summarize model discrimination, the C statistic or Concordance statistic. The C statistic is interpreted as the probability that a randomly selected subject who experienced the outcome will have a higher predicted probability of having the outcome occur than a randomly selected subject who did not experience the outcome. In addition to computing the area under the ROC curve, this probability can be estimated by taking all pairs of observations where one patient experienced the event and the other did not, and computing the proportion of those pairs where the patient experiencing the event had the higher predicted risk. The C statistic can also be interpreted as the rank correlation between predicted probabilities of the outcome occurring and the observed response (Logan, Medical College of Wisconsin, Biostatistics).

[0143] FIGURES

[0144] The invention is demonstrated by way of the example through the figures disclosed herein. The figures provided represent particular, non-limiting embodiments and are not intended to limit the scope of the invention.

[0145] Brief description of the figures

[0146] Fig.1 : 3R / 4R tau ratio in plasma sEV in DESCRIBE subcohort.

[0147] Fig.2: 3R / 4R tau ratio in plasma sEV in DESCRIBE subcohort 2.

[0148] Fig.3: TDP-43 levels in plasma sEV in DESCRIBE subcohort 2.

[0149] Fig.4 : Distribution of plasma sEV 3R / 4R tau ratio versus plasma EV TDP-43 levels stratified by diagnosis in DESCRIBE subcohort 2.

[0150] Fig.5 : 3R / 4R tau ratio in plasma sEVs in the Sant Pau cohort.

[0151] Fig.6 : Distribution of plasma sEV 3R / 4R tau ratio versus plasma EV TDP-43 levels stratified by diagnosis in the Sant Pau cohort.

[0152] Fig.7.: Study Design. Fig.8 Correlation of plasma EV Tau ratio with NfL in DESCRIBE cohort 2 and Sant Pau cohort.

[0153] Fig.9: Plasma TDP-43 levels in DESCRIBE subcohort 2.

[0154] Fig.10: Plasma sEV 3R / 4R Tau ratio versus plasma EV TDP-43 levels in bvFTD cases of DESCRIBE subcohort 2.

[0155] Fig.11 : Sant Pau cohort, Receiver Operating Characteristic (ROC) curves for plasma sEV 3R / 4R Tau ratios.

[0156] Fig.12: Receiver Operating Characteristic (ROC) curve with AUC values for plasma sEV TDP-43 in Sant Pau cohort.

[0157] Fig.13: Receiver Operating Characteristic (ROC) curve with AUC values for plasma sEV TDP-43 and plasma NfL in the Sant Pau cohort.

[0158] Fig.14: Characterization of CSF and plasma EVs (CSF left column)

[0159] Fig.15: EVs contain full-length Tau Amino acid sequence, subdomains and tryptic peptides(red) of 4 Repeat and 3 Repeat isoform human Tau.

[0160] Fig.16: 3R and 4R Tau in plasma mEV and sEV.

[0161] Fig.17: Detection of 3R, 4R Tau and TDP-43 in L1CAM immunoisolated plasma EVs.

[0162] Fig.18: Correlation matrix.

[0163] Fig.19: CSF and plasma EV Tau ratio correlations.

[0164] Fig.20: 3R / 4R Tau ratio in plasma mEV in DESCRIBE subcohort 2.

[0165] Fig.21 : Correlation matrix.

[0166] Fig.22: Plasma mEV 3R / 4R Tau ratio in genetic (n=37) or autopsy confirmed (n=31) cases from DESCRIBE subcohort 2.

[0167] Fig.23: Presence of TDP-43 in plasma EVs.

[0168] Fig.24: Plasma mEV TDP-43 levels in DESCRIBE subcohort 2.

[0169] Fig.25: Correlation of plasma and CSF TDP-43 in DESCRIBE subcohort 2, ALS group.

[0170] Fig.26: TDP-43 in plasma mEV in genetic (n=37) or autopsy confirmed (n=31) cases from DESCRIBE subcohort 2.

[0171] Fig.27: Correlation analysis of plasma EV Tau ratio and TDP-43 in DESCRIBE subcohort 2, bvFTD group.

[0172] Fig.28: Definition of cut-offs by Gaussian mixture modelling.

[0173] Fig.29: Plasma mEV 3R / 4R Tau ratios in the Sant Pau cohort.

[0174] Fig.30: Sant Pau cohort, plasma mEV 3R / 4R Tau ratios in genetic cases.

[0175] Fig.31 : Plasma mEV TDP-43 levels in the different diagnostic groups of Sant Pau cohort. Fig.32: Plasma mEV TDP-43 levels in genetic cases of Sant Pau cohort.

[0176] Fig.33: Correlation analysis of plasma EV Tau ratio and TDP-43 in the Sant Pau cohort bvFTD group (sporadic and genetic cases).

[0177] Fig.34: Determination of cut-off values in the Sant Pau cohort.

[0178] Fig.35: Plasma sEV particle concentrations in TBK-1 and VCP mutation carriers.

[0179] Fig.36: Uncropped Western Blots from Fig. 17 a.

[0180] Detailed description of the figures

[0181] Fig.1 : 3R / 4R tau ratio in plasma sEV in DESCRIBE subcohort 1 . a, The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. (HC versus bvFTD P = 0.0003, HC versus PSP P = 0.0000044, AD versus bvFTD P = 0.0003, AD versus PSP P = 0.0000052, svPPA versus bvFTD P = 0.0007, svPPA versus PSP P = 0.0000057, bvFTD versus PSP P = 0.0000019;

[0182] *P < 0.05, **P < 0.001 , ***P < 0.0001 , ****P < 0.00001 . Biologically independent samples: HC n = 15, AD n = 23, svPPA n = 17, bvFTD n = 42, PSP n = 44. b-h, ROC curve for sEV 3R / 4R tau ratio in PSP versus HC (b), PSP versus AD (c), PSP versus svPPA (d), PSP versus bvFTD (e), bvFTD versus HC (f), bvFTD versus AD (g) and bvFTD versus svPPA (h). i,j, Two-tailed Spearman correlation analysis of associations and monotonic regression splines between sEV 3R / 4R ratio and plasma NfL levels within PSP (i) and bvFTD (j) (P = 0.00009) diagnostic groups, k-n, Correlation matrix depicting results of two-tailed Spearman correlations, visualized by plotting strength of correlation (r) as a heat map along with P values (right): PSP (k,l) and bvFTD (m,n). PSP: MoCA (34), PSP-RS (35), PSP-CDS (36), SEADL (37), CGI-s (38); PSP-SS (35), MDS-UPDRS Part III (39), SAS (40) and the PSP-QoL (41). bvFTD: MMSE (33), MoCa, FAQ (42), CDR-SB (43), CDR plus NACC FTLD, previously termed CDR-SB FTD (44), NPI-Q (45) and CBI-M (46).

[0183] Fig.2 : 3R / 4R tau ratio in plasma sEV in DESCRIBE subcohort 2. a, Horizontal lines indicate median and IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus bvFTD P = 0.0000057, HC versus PSP P = 0.000009, ALS versus bvFTD P = 0.0000074, ALS versus PSP P = 0.0000023, bvFTD versus PSP P = 0.0000067; ****P < 0.00001 . Biologically independent samples: HC n = 56, ALS n = 165, bvFTD n = 179, PSP n = 163. b-f, ROC curve for plasma sEV 3R / 4R tau ratio: PSP versus HC (b), PSP versus ALS (c), PSP versus bvFTD (d), bvFTD versus HC (e) and bvFTD versus ALS (f). g-j, Correlation matrix depicting the results of two-sided Spearman correlations, visualized by plotting strength of correlation (r) as a heat map along with P values (right): PSP(g,h) and bvFTD (i,j). kJ, 3R / 4R tau ratio in plasma-derived sEV in genetically (n = 37) or autopsy-confirmed (n = 31) cases from DESCRIBE subcohort 2 (total number of individual cases n = 63, 5 of these cases had both genetic and neuropathological diagnosis), k, sEV 3R / 4R tau ratios in the different pathology groups, stratified by clinical diagnosis. HC versus bvFTD P = 0.0000052, HC versus PSP P = 0.0000012, ALS versus bvFTD P = 0.0000097, ALS versus PSP P = 0.0000056, bvFTD versus PSP P = 0.0000041 ;

[0184] ****p < 0.00001 . I, sEV 3R / 4R tau ratios of the different pathology groups, independent of clinical diagnostic group. The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus tau (PSPZGGT)-type P = 0.000007, HC versus MAPT mutations P = 0.0000063, tau(PSP / GGT)-type versus MAPT mutations P = 0.000004, tau(PSP / GGT)-type versus non- tau / non-TDP-43 P = 0.0000078, MAPT mutations versus non-tau / non-TDP-43 P = 0.0000041 ; ****p < 0.00001 . TDP-43 pathology group: bvFTD (C9orf72 (n = 13), GRN (n = 4), VCP (n = 4), TBK-1 (n = 2)); ALS (C9orf72 (n = 5)); neuropathological diagnosis (FTLD-TDP (n = 1)); ALS-TDP (n = 17), ALS-FTLD-TDP (n = 6)). PSP / GGT-type tau pathology group: neuropathological diagnosis ((PSP-tau (n = 3); FTLD-tau GGT-type (n = 1)). bvFTD MAPT mutations (MAPT P301 L (n = 1), MAPT P364S (n = 1), MAPT IVS10+16C>T (n = 1)). Non-tau / non-TDP-43 pathology group: ALS (SOD-1 (n = 2); FUS (n = 2); CHCHD10 (n = 1 )); bvFTD (CHCHD10 (n = 1 )).

[0185] Fig.3 : TDP-43 levels in plasma sEV in DESCRIBE subcohort 2. a, The long horizontal line represents the median and the short horizontal lines represent IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus ALS P = 0.000003, HC versus bvFTD P = 0.000006, ALS versus bvFTD P = 0.0000074, ALS versus PSP P = 0.0000028, bvFTD versus PSP P = 0.0000012; ****P < 0.00001 . Biologically independent samples: HC n = 56, ALS n = 165, bvFTD n = 179 and PSP n = 163. b-f, ROC curve for sEV TDP-43 (red) and plasma NfL (blue): ALS versus HC (b), ALS versus PSP (c), ALS versus bvFTD (d), bvFTD versus HC (e) and bvFTD versus PSP (f). (g-j), Correlation matrix depicting results of twosided Spearman correlations, visualized by plotting strength of correlation (r) as a heat map along with P values (right). ALS (g,h) and bvFTD (i,j). TDP-43 in plasma sEV in genetically (n = 37) or autopsy- confirmed (n = 31) cases from the DESCRIBE subcohort 2 (total number of individual cases: n = 63, 5 of which had both genetic and neuropathological diagnoses), k, sEV TDP-43 in the different pathology groups, stratified by clinical diagnosis. HC versus ALS P = 0.000003, HC versus bvFTD P = 0.000006, ALS versus bvFTD P = 0.0000074, ALS versus PSP P = 0.0000028, bvFTD versus PSP P = 0.0000012; ****P < 0.00001. I, sEV TDP-43 concentrations in the different pathology groups, independent of clinical diagnostic group. The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus TDP-43 P = 0.000008, TDP-43 versus tau (PSPZGGT)-type P = 0.000006, TDP-43 versus MAPT mutations P = 0.0000035, TDP-43 versus non-tau / non-TDP-43 P = 0.0000039; ****P < 0.00001. TDP-43 pathology group: bvFTD (C9orf72 (n = 13), GRN (n = 4), VCP (n = 4), TBK1 (n = 2)); ALS (C9orf72 (n = 5)); neuropathological diagnosis (FTLD-TDP (n = 1); ALS-TDP (n = 17), ALS-FTLD-TDP (n = 6)). PSP / GGT-type tau pathology group: neuropathological diagnosis (PSP-tau (n = 3); FTLD-tau GGTtype (n = 1)). bvFTD MAPT mutations: MAPT P301 L (n = 1), MAPT P364S (n = 1), MAPT IVS10+16OT (n = 1). Non-tau / non-TDP-43 pathology group: ALS (SOD-1 (n = 2); FUS (n = 2); CHCHD10 (n = 1)); bvFTD (CHCHD10 (n = 1)).

[0186] Fig.4 : Distribution of plasma sEV 3R / 4R tau ratio versus plasma EV TDP-43 levels stratified by diagnosis in DESCRIBE subcohort 2. a, Subcohort 2 without pathology-confirmed cases. Color codes indicate the different clinical diagnostic groups (ALS, bvFTD, PSP, HC). Cut-off values were determined by Gaussian mixture modeling. EV 3R / 4R tau ratio cut-offs: 0.77 and 1 .28; EV TDP-43 cut-offs: 13.87 pg ml-1and 56.18 pg ml-1, b, Genetically or neuropathologically confirmed cases were also plotted, c, The ALS-FTD overlap group (ALS with FTD (ALS-FTD), ALS patients with cognitive impairment and ALS patients with behavioral impairment) is indicated. Fig.5 : 3R / 4R tau ratio in plasma sEVs in the Sant Pau cohort, a, Stratified by clinical diagnosis. Horizontal lines indicate the median and IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus bvFTD P = 0.000009, HC versus PSP P = 0.000007, ALS versus bvFTD P = 0.0000091 , ALS versus PSP P = 0.0000016, ALS-FTD versus bvFTD P = 0.0000074, ALS-FTD versus PSP P = 0.0000041 , bvFTD versus PSP P = 0.000006;

[0187] ****P < 0.00001 . Biologically independent samples: HC n = 50, ALS n = 65, ALS-FTD n = 58, bvFTD n = 50 (+23 mutation carriers), PSP n = 41 . b,c, sEV 3R / 4R tau ratios in plasma-derived sEV in genetic cases from Sant Pau cohort (n = 34 genetic cases) stratified by clinical diagnosis (b), HC versus bvFTD P = 0.000009, HC versus PSP P = 0.000007, ALS versus bvFTD P = 0.0000091 , ALS versus PSP P = 0.0000016, ALS-FTD versus bvFTD P = 0.0000074, ALS- FTD versus PSP P = 0.0000041 , bvFTD versus PSP P = 0.000006; ****P < 0.00001 ; and stratified by associated molecular pathology and independent from clinical diagnosis (c). The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal- Wallis test with Dunn’s correction for multiple comparisons. HC versus TDP-43 P = 0.758, HC versus non-tau / non-TDP-43 P = 0.632, TDP-43 versus non-tau / non-TDP-43 P = 0.425; NS, not significant. TDP-43 pathology group: bvFTD (C9orf72 (n = 12), GRN (n = 6), TARDP (n = 1), VCP (n = 1), TBK-1 (n = 3)); ALS (C9orf72 (n = 3)); ALS-FTD (C9orf72 (n = 1)). Non-tau / non-TDP-43 pathology group: ALS (SOD-1 (n = 3)); FUS (n = 3); ALS-FTD (SOD-1 (n = 1)). d,e, Correlation matrix depicting results of two-sided Spearman correlations in the PSP group, visualized by plotting strength of correlation (r) as a heat map (d) along with P values (e). f,g, Correlation matrix depicting results of two-sided Spearman correlations in the bvFTD group, visualized by plotting strength of correlation (r) as a heat map (f) along with P values (g). h, TDP-43 levels in plasma sEV of the Sant Pau cohort stratified by clinical diagnosis. The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC versus ALS P = 0.0000075, HC versus ALS-FTD P = 0.0000046, ALS versus bvFTD P = 0.00074, HC versus PSP P = 0.578, ALS versus bvFTD P = 0.000009, ALS versus PSP P = 0.000007, ALS-FTD versus bvFTD P = 0.0000043, ALS-FTD versus PSP P = 0.0000055, bvFTD versus PSP P = 0.0005; *P < 0.05, **P < 0.001 , ***P < 0.0001 , ****P < 0.00001 . Biologically independent samples: HC n = 50, ALS n = 65, ALS-FTD n = 58, bvFTD n = 50 (+23 mutations), PSP n = 41 . i,j, Plasma sEV TDP-43 concentrations in genetic cases of the Sant Pau cohort (n = 34 genetic cases) stratified by clinical diagnosis (i), HC versus ALS P = 0.0000075, HC versus ALS-FTD P = 0.0000046, ALS versus bvFTD P = 0.00074, HC versus PSP P = 0.578, ALS versus bvFTD P = 0.000009, ALS versus PSP P = 0.000007, ALS- FTD versus bvFTD P = 0.0000043, ALS-FTD versus PSP P = 0.0000055, bvFTD versus PSP P = 0.0005; and stratified by molecular pathology, independent of clinical diagnosis (j). The long horizontal line represents the median and the short horizontal lines represent the IQR. Kruskal- Wallis test with Dunn’s correction for multiple comparisons. HC versus TDP-43 P = 0.0000063, HC versus non-tau / non-TDP-43 P = 0.541 , TDP-43 versus non-tau / non-TDP-43 P = 0.0000051 ; 43 pathology group: bvFTD (C9orf72 (n = 12), GRN (n = 6), TARDP (n = 1), = 3)); ALS (C9orf72 (n = 3)); ALS-FTD C9orf72(n = 1). Non-tau / non-TDP- 43 pathology group: ALS (SOD-1 (n = 3); FUS (n = 3)); ALS-FTD (SOD-1 (n = 1)). k,i, Correlation matrix depicting results of two-sided Spearman correlations in the ALS group, visualized by plotting strength of correlation (r) as a heat map (k) along with P values (i). ALS-FRS (sEV: r= -0.212), P = 0.015 and time since diagnosis / disease duration (sEV: r= 0.514, P = 0.0004). n,m, Correlation matrix depicting results of two-sided Spearman correlations in the ALS-FTD group, visualized by plotting strength of correlation (r) as a heat map (m) along with P values (n). ALS-FRS (sEV: r = -0.702), P = 0.0002 and time since diagnosis / disease duration (sEV: r= 0.445, P = 0.0005); MMSE (sEV: r= -0.535, P = 0.018).

[0188] Fig.6 : Distribution of plasma sEV 3R / 4R tau ratio versus plasma EV TDP-43 levels stratified by diagnosis in the Sant Pau cohort, a, Sant Pau cohort without pathology-confirmed cases. Color codes indicate the different clinical diagnostic groups (ALS, bvFTD, PSP, HC). Cut-off values as determined by Gaussian mixture modeling. EV 3R / 4R tau ratio cut-offs: 0.78 and 1.28; EV TDP- 43 cut-offs: 17.85 pg ml-1and 57.34 pg ml-1, b, Genetically confirmed cases were also plotted in the graph, c, The ALS-FTD overlap group is indicated in light blue, d-f, Sant Pau cohort without pathology-confirmed cases (d), Sant Pau cohort including pathology-confirmed cases (e) and Sant Pau cohort, ALS-FTD group indicated in light blue (f). Similar to a-c but superimposed with Sant Pau and DESCRIBE cutoffs. The black solid line indicates Sant Pau cut-offs (EV 3R / 4R tau ratio cut-offs: 0.78 and 1 .28; EV TDP-43 cut-offs: 17.85 pg ml-1 and 57.34 pg ml-1). The red dashed line indicates DESCIRBE subcohort 2 cut-offs (EV 3R / 4R tau ratio cut-offs: 0.77 and 1.28; EV TDP-43 cut-offs: 13.87 pg ml-1 and 56.18 pg mF1).

[0189] Fig.7.: Study Design. Pilot study with samples from the DESCRIBE cohort (subcohort 1): HC, AD, svPPA, bvFTD, PSP groups, based on clinical diagnosis and supported by CSF biomarkers in AD; detection of plasma EV 3R / 4R Tau. Validation study in the larger DESCRIBE subcohort 2, comprising samples of the DESCRIBE cohort with HC, ALS, bvFTD and PSP groups and 63 pathology confirmed samples: detection of plasma EV 3R / 4R Tau ratios, plasma EV TDP-43 levels, and plasma TDP-43 concentrations. Validation of plasma EV Tau ratios, and plasma EV TDP-43 levels in the independent Sant Pau cohort, including HC, ALS, ALS-FTD, bvFTD, and PSP as diagnostic groups with altogether 34 genetically confirmed samples. Lower panel: Experimental flow of sEV and mEV preparation.

[0190] Fig.8 : Correlation of plasma EV Tau ratio with NfL in DESCRIBE cohort 2 and Sant Pau cohort, (a-d) Two-sided Spearman correlation analysis of associations and monotonic regression splines between plasma sEV 3R / 4R Tau ratios and plasma Nfl levels in (a) PSP (p = 0.000012) and (b) bvFTD (p = 0.000051) diagnostic groups. Spearman correlation analysis of associations and monotonic regression splines between plasma sEV TDP-43 levels and plasma Nfl levels in (c) ALS (p = 0.000046) and (d) bvFTD (p = 0.000063). (e-g) Sant Pau cohort: Spearman correlation analysis of associations and monotonic regression splines between plasma sEV 3R / 4R Tau ratio and plasma Nfl levels in (e) PSP and (f) bvFTD. Spearman correlation analysis of associations and monotonic regression splines between plasma sEV TDP-43 and plasma Nfl levels in (g) bvFTD (p = 0.000085). (NfL measurements were only available for a subset of Sant Pau cases).

[0191] Fig.9 : Plasma TDP-43 levels in DESCRIBE subcohort 2. (biologically independent samples: HC n = 56, ALS n = 165, bvFTD n = 179, PSP n = 163). The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR) Kruskal-Wallis test with Dunn’s correction for multiple comparisons, ns: non-significant.

[0192] Fig.10: Plasma sEV 3R / 4R Tau ratio versus plasma EV TDP-43 levels in bvFTD cases of DESCRIBE subcohort 2. Genetically or neuropathologically defined bvFTD cases are indicated by the different color-codes. Cut-off values as determined by Gaussian mixture modeling for subcohort 2 (Fig. 4, Fig. 28). The two cut-offs for separation of bvFTD into putative TDP-43 and Tau pathology groups are indicated by bold blue lines (sEV 3R / 4R Tau ratio cut-off: 1.27; sEV TDP-43 cut-off: 13.87 pg / ml).

[0193] Fig.11 : Sant Pau cohort, Receiver Operating Characteristic (ROC) curves for plasma sEV 3R / 4R Tau ratios, (a) PSP vs. HC (b) PSP vs. ALS (c) PSP vs. ALS-FTD (d) PSP vs. bvFTD (e) bvFTD vs. HC (f) bvFTD vs. ALS (g) bvFTD vs. ALS-FTD.

[0194] Fig.12: Receiver Operating Characteristic (ROC) curve with AUC values for plasma sEV TDP-43 in Sant Pau cohort, (a) ALS vs. HC (b) ALS vs. ALSFTD (c) ALS vs. PSP (d) ALS vs. bvFTD (e) ALS-FTD vs. HC (f) ALS-FTD vs. PSP (g) ALS-FTD vs. bvFTD (h) bvFTD vs. HC (i) bvFTD vs. PSP.

[0195] Fig.13: Receiver Operating Characteristic (ROC) curve with AUC values for plasma sEV TDP-43 and plasma NfL in the Sant Pau cohort, (a) bvFTD vs. HC and (b) bvFTD vs. PSP. Plasma NfL levels were not available for ALS and ALS-FTD groups.

[0196] Fig.14: Characterization of CSF and plasma EVs (CSF left column); plasma (right column)), using (a,b) Western blotting (WB) (n=3 independent experiments), (c,d) nanoparticle tracking analysis (NTA)(n=3 independent experiments), and (e,f) transmission electron microscopy (TEM) (n=2 8 independent experiments).

[0197] Fig.15: EVs contain full-length Tau Amino acid sequence, subdomains and tryptic peptides(red) of 4 Repeat and 3 Repeat isoform human Tau. (a) NT: N-terminus; N1 , N2: N-terminal inserts; P1 , P2: proline rich regions; R1-4: repetitive amino acids; R’ pseudo-repeat; CT: C-terminus. 3R Tau isoforms are characterized by R1 ,R3,R4; 4R Tau by an additional repeat domain, R2. Anti- 3R Tau antibody binds to an epitope spanning R1 and R3; anti-4R Tau is specific to R2. (b) Left: amino acid sequence of 2N4R human Tau, the longest Tau isoform. Right: Tryptic peptides. Peptide 7 is localized in R1 , peptide 8 and 9 are specific to 4R Tau, peptide 10 is localized in repeat 4. (c) IP-MS results from neat CSF, CSF-derived mEV, sEV, plasma-derived mEV, sEV. Abundance of Tau peptides normalized to Tau mid-domain (peptide 5).

[0198] Fig.16: 3R and 4R Tau in plasma mEV and sEV. (a) Western blot analysis of (lanes from left to right) plasma mEVs, sEVs, and EV-depleted plasma with antibodies directed against the 3R Tau isoform (n=3 independent experiments), (b) Western blot analysis of (lanes from left to right) plasma mEVs, sEVs, and EV-depleted plasma with antibodies directed against the 4R Tau isoform (n=3 independent experiments), (c) 3R Tau antibody specificity tested by Western blot analysis with recombinant 3R and 4R Tau proteins (n=3 independent experiments), (d) 4R Tau antibody specificity tested by Western blot analysis with recombinant 3R and 4R Tau proteins (n=3 independent experiments), (e) Western blot of recombinant 3R and 4R Tau with isoformindependent antibody HT7 (n=3 independent experiments).

[0199] Fig.17: Detection of 3R, 4R Tau and TDP-43 in L1CAM immunoisolated plasma EVs (a) Preparation of total plasma EVs, L1 CAM-immuno-isolated EVs from plasma EV preparations, supernatant (SN) of L1CAM beads after incubation with plasma EV preparations and centrifugation (=L1CAM EV cleared fraction) (Left to right: Total plasma mEV, L1CAM positive mEV, SN mEV (supernatant of L1CAM beads incubated with plasma mEV preparations after centrifugation, corresponding to L1CAM EV cleared supernatant), total plasma sEV, L1CAM positive sEV, SN sEV (supernatant of L1 CAM beads incubated with plasma sEV preparations, after centrifugation), EV depleted plasma (after SEC preparation of total plasma EVs), plasma total, IgG bead immuno- isolation of total plasma sEVs as negative control for L1 CAM bead immuno-isolation). WB analysis of L1CAM, Calnexin, and Flotillin-2. WB analysis revealed, that L1CAM was 2.40 fold enriched in the L1CAM-EV preparation obtained from mEVs (2.4±0.16, n=3 independent experiments) and 3.2 fold in L1CAM EVs prepared from sEVs (3.2±0.23, n=3 independent experiments; representative WB). (b) NTA analysis of L1CAM immuno-isolated plasma sEVs and mEVs, total plasma sEVs and mEVs. L1CAM EVs represent a subpopulation of total plasma EVs, based on NTA analysis of EV numbers in the different preparations (sEV: mean particle concentrations in L1CAM EV preparations: 3.77E+08±5.86E+03 SD particles / ml and total plasma EV 2.82E+09±1.53E+05 particles / ml; mEV: mean particle concentrations in L1CAM EV preparations: 5.31 E+08±3.87e+03 particles / ml and total plasma EV 2.86E+09±4.82+06 particles / ml). (c) WB analysis of 3R-Tau and (d) 4R Tau (Left to right: Total plasma mEV, L1CAM positive mEV, SN mEV (supernatant of L1CAM beads incubated with plasma mEV preparations after centrifugation), total plasma sEV, L1CAM positive sEV, SN sEV (supernatant of L1CAM beads incubated with plasma sEV preparations after centrifugation), EV depleted plasma (after SEC preparation of total plasma EVs), plasma total, IgG bead immuno- isolation of total plasma sEVs as negative control for L1CAM bead immuno-isolation). (e) WB analysis of TDP-43 (Left to right: Total plasma mEV, L1CAM positive mEV, SN mEV (supernatant of L1CAM beads incubated with plasma mEV preparations after centrifugation), total plasma sEV, L1CAM positive sEV, SN sEV (supernatant of L1CAM beads incubated with plasma sEV preparations after centrifugation), EV depleted plasma (after SEC preparation of total plasma EVs), plasma total, IgG bead immuno-isolation of total plasma sEVs as negative control for L1CAM bead immuno- isolation). Unprocessed WB: Fig. 36.

[0200] Fig.18: Correlation matrix. Results of two-sided Spearman correlations between different clinical measures and sEV 3R / 4R ratio, visualized by plotting strength of correlation (r) as a heat map along with p values (right). PSP: Neuropsychiatric Inventory Questionnaire (NPI-Q) (105), Functional Activities Questionnaire score (FAQ) (106), PSP staging system (PSP-SS) (107), MDS-Unified Parkinson’s Disability Rating Scale (MDS-UPDRS) Part III (108), Starkstein Apathy Scale (SAS) (109), PSP quality of life scale (PSP-QoL) (110).

[0201] Fig.19: CSF and plasma EV Tau ratio correlations. Two-sided Spearman correlation analysis 5 of associations and monotonic regression splines between CSF sEV 3R / 4R Tau ratio and plasma sEV 6 3R / 4R Tau ratio in DESCRIBE subcohort 1 where CSF had been obtained in parallel to blood sampling 7 (total number of samples n=141 ) . The majority of CSF sEV 4R Tau levels were below the assay’s 8 detection limit and EV 3R / 4R Tau ratios could not be calculated (CSF sEV 3R Tau detectable cases 9 n=100, CSF sEV 4R Tau detectable cases n=34; bvFTD number of total cases in subcohort 1 n=42, CSF 10 sEV 4R Tau detectable cases n=10. (a) CSF to plasma sEV 3R / 4R Tau correlation, all diagnostic groups 11 (n=34), (b) CSF to plasma sEV 3R / 4R Tau correlation in the bvFTD group only (n=10). No significant 12 correlation was found between CSF and plasma sEV Tau ratios across all diagnostic groups of 13 subcohort 1 in samples which had detectable CSF EV 4R Tau levels (sEV: r=0.277, p=0.117). In the 14 bvFTD group. CSF sEV Tau ratios correlated significantly with the corresponding plasma sEV Tau 15 ratios (sEV: r=0.535, p=0.034). CSF sEV 3R Tau levels correlated with plasma EV sEV 3R Tau (r=0.24, 16 p=0.016) Fig.20: 3R / 4R Tau ratio in plasma mEV in DESCRIBE subcohort 2. (a) Biologically independent samples: HC n= 56, ALS n=165, bvFTD n= 179, PSP n=163. Horizontal lines: median and interquartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. bvFTD p=0.0000052, HC vs. PSP p=0.0000012, ALS vs. bvFTD p=0.0000097, ALS vs. PSP p=0.0000056, bvFTD vs. PSP p=0.0000041 ; **** p<0.00001). (b-f) Receiver Operating Characteristic (ROC) curve for mEV 3R / 4R Tau ratio: (b) PSP vs. HC (c) PSP vs. ALS (d) PSP vs. bvFTD (e) bvFTD vs. HC(f) bvFTD vs. ALS (g-h) Two-sided Spearman correlation analysis and monotonic regression splines were performed between mEV 3R / 4R ratio and plasma Nfl levels within (g) PSP and (h) bvFTD diagnostic groups, (i-l) Correlation matrix depicting results of two-sided Spearman correlations, visualized by plotting strength of correlation (r) as a heat map along with p values (right).

[0202] Fig.21 : Correlation matrix. Results of two-sided Spearman correlations between different clinical and neuropsychological measures of disease severity and sEV and mEV 3R / 4R Tau ratio, visualized by plotting strength of correlation (r) as a heat map along with p values (right).

[0203] Fig.22: Plasma mEV 3R / 4R Tau ratio in genetic (n=37) or autopsy confirmed (n=31) cases from DESCRIBE subcohort 2. Total number of individual cases n= 63, 5 of these cases had both, genetic and neuropathological diagnosis. TDP-43 pathology group: bvFTD [C9orf72 (n=13), GRN (n=4), VCP (n=4), TBK1 (n=2)]; ALS [C9orf72 (n=5)]; neuropathological diagnosis [FTLD-TDP (n=1)]; ALS-TDP (n=17), ALS-FTLD TDP (n=6)]. PSP / GGT-type Tau pathology group: neuropathological diagnosis [(PSP-Tau (n=3); FTLD-Tau GGT type (n=1)]. bvFTD MAPT mutations: [MAPT P301 L (n=1), MAPT P364S (n=1), MAPT IVS10+16OT (n=1], Non-Tau / non- TDP-43 pathology group: ALS [SOD-1 (n=2); FUS (n=2); CHCHD10 (n=1)]; bvFTD [CHCHD10 (n=1)]. (a) mEV 3R / 4R Tau ratios in the different pathology groups, stratified by clinical diagnosis (HC vs. bvFTD p=0.0000052, HC vs. PSP p=0.0000012, ALS vs. bvFTD p=0.0000097, ALS vs. PSP p=0.0000056, bvFTD vs. PSP p=0.0000041 ; ****p<0.00001). (b) mEV 3R / 4R Tau ratios of the different pathology groups, independent from clinical diagnostic group. The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons. HC vs. Tau (PSP / GGT) type p=0.0000058, HC vs. MAPT mutations p=0.0000069, Tau (PSP / GGT) type vs. MAPT mutations p=0.0000084, Tau (PSP / GGT) type vs. non-Tau / non-TDP-43 p=0.0000099, MAPT mutations vs. non-Tau / non-TDP-43 p=0.0000032; **** p<0.00001). mEV 3R / 4R Tau ratios in the different groups. HC: median mEV 0.90, IQR[0.75-1.05]; TDP-43 group: median mEV 1.03, IQR[0.93- 1.09]; non-TDP-43 / non-Tau group: median mEV 1.03, IQR[0.95-1 .11 ]. Neuropathologically confirmed PSP / GGT-type 4R Tau pathology group: median mEV 0.41 , IQR[0.31-0.55], Patients with Tau pathology in the bvFTD group (MAPT mutation carriers): median mEV 3.79, IQR[3.45- 4.01],

[0204] Fig.23: Presence of TDP-43 in plasma EVs. (a) Western blot of (lanes from left to right) plasma mEVs, sEVs, EV-depleted plasma, and total plasma with an antibody directed against TDP-43.

[0205] (b) Western blot of SY5Y cell lysates (lanes from left to right) after mock transfection, scrambled siRNA, and TDP-43 siRNA transfection. Upper panel probed with anti-Calnexin antibody as a loading control, lower panel probed with anti-TDP-43 antibody (n= 3 independent experiments).

[0206] (c) Western blot quantification: TDP-43 signal (optical density) normalized to Calnexin. Mock, scrambled, and TDP-43 siRNA transfected SY5Y cell lysates. (n= 3 independent experiments). Kruskal-Wallis test with Dunn’s correction for multiple comparisons. ns=non-significant, mock vs. TDP-43 siRNA p=0.0000063, scrambled vs. TDP-43 siRNA; p=0.0000033; **** p<0.00001). (d) SIMOA assay quantification of SY5Y cell lysates (from left to right): spiked with recombinant TDP- 43, mock, scrambled, and TDP-43 siRNA transfected. (n= 9 independent experiments). Kruskal- Wallis test with Dunn’s correction for multiple comparisons. ns=non-significant, TDP-43 spike vs. mock p=0.0000027, TDP-43 spike vs. scrambled siRNA p=0.0000048, TDP-43 spike vs. scrambled siRNA p=0.0000015; **** p<0.00001.

[0207] Fig.24: Plasma mEV TDP-43 levels in DESCRIBE subcohort 2. Biologically independent samples: HC n= 56, ALS n=165, bvFTD n= 179, PSP n=163. (a) Plasma mEV TDP-43 in the different diagnostic groups. Horizontal lines: median and inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. ALS p=0.0000028, HC vs. bvFTD p=0.0000054, ALS vs. bvFTD p=0.0000043, ALS vs. PSP p=0.0000012, bvFTD vs. PSP p=0.0000093; **** p<0.00001). (b-f) Receiver Operating Characteristic (ROC) curve for mEV TDP-43 (red) and plasma NfL (blue): (b) ALS vs. HC (c) ALS vs. PSP (d) ALS vs. bvFTD (e) bvFTD vs. HC (f) bvFTD vs. PSP. The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons. **** p<0.00001 . (g-h) Two-sided Spearman correlation analysis of associations between mEV 3R / 4R ratio and plasma Nfl levels and monotonic regression splines within (g) ALS (p=0.000016) and (h) bvFTD diagnostic groups.

[0208] Fig.25: Correlation of plasma and CSF TDP-43 in DESCRIBE subcohort 2, ALS group. EVs prepared from 1 .5 ml of pooled AD patients CSF revealed TDP-43 levels around the LLOQ and below LLOQ when a CSF volume of 1 ml was used for EV preparation. In contrast, pooled ALS CSF samples showed higher CSF EV TDP-43 concentrations and allowed starting volumes down to 1 ml. We therefore focused on available and corresponding ALS group CSF samples from DESCRIBE subcohort 2. Two-tailed Spearman correlation analysis of associations and monotonic regression splines between (a) CSF sEV TDP-43 and plasma sEV TDP-43 (n=30), (b) CSF mEV TDP-43 and plasma mEV TDP-43 (n=40). CSF volume for EV preparation: 1 ml. 75.6% (n=41) of the tested CSF samples had EV TDP-43 levels above the detection limit. n=41 biologically independent samples.

[0209] Fig.26: TDP-43 in plasma mEV in genetic (n=37) or autopsy confirmed (n=31) cases from DESCRIBE subcohort 2. Total number of individual cases n= 63, 5 of these cases had both, genetic and neuropathological diagnosis, (a) plasma mEV TDP-43 in the different pathology groups, stratified by clinical diagnosis (HC vs. ALS p=0.0000028, HC vs. bvFTD p=0.0000054, ALS vs. bvFTD p=0.0000043, ALS vs. PSP p=0.0000012, bvFTD vs. PSP p=0.0000093; **** p<0.00001). (b) plasma mEV TDP-43 concentrations in the different pathology groups, independent from clinical diagnostic group. The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR) (HC vs. TDP-43 p=0.0000052, TDP-43 vs. Tau (PSP / GGT) p=0.0000091 , TDP-43 vs. MAPT mutations p=0.0000026, TDP-43 vs. non-Tau / non-TDP-43 p=0.0000057; **** p<0.00001). Kruskal-Wallis test with Dunn’s correction for multiple comparisons. **** p<0.00001. TDP-43 pathology group: bvFTD [C9orf72 (n=13), GRN (n=4), VCP (n=4), TBK1 (n=2)]; ALS [C9orf72 (n=5)]; neuropathological diagnosis [FTLD-TDP (n=1)]; ALS-TDP (n=17), ALS-FTLD TDP (n=6)]. PSP / GGT-type Tau pathology group: neuropathological diagnosis [(PSP-Tau (n=3); FTLD-Tau GGT type (n=1)]. bvFTD MAPT mutations: [MAPT P301 L (n=1), MAPT P364S (n=1), MAPT IVS10+16OT (n=1], Non-Tau / non TDP-43 pathology group: ALS [SOD-1 (n=2); FUS (n=2); CHCHD10 (n=1)]; bvFTD [CHCHD10 (n=1)]. Median plasma mEV TDP-43 in the different groups. TDP-43 pathology group: 48.74 pg / ml, IQR[34.32-58.70]; PSP / GGT-type Tau pathology group: 2.73 pg / ml, IQR[2.53-3.72]; genetic MAPT group: 2.30 pg / ml, IQR[2.23-2.35; non-TDP-43 / non-Tau pathology group: 10.74 pg / ml, IQR[9.45-12.36],

[0210] Fig.27: Correlation analysis of plasma EV Tau ratio and TDP-43 in DESCRIBE subcohort 2, bvFTD group, (a) Two-sided Spearman correlation analysis and monotonic regression splines of associations between plasma sEV 3R / 4R Tau ratio and plasma sEV TDP-43 levels (p=0.000019). (b) Two-sided Spearman correlation analysis and monotonic regression splines of associations between plasma mEV 3R / 4R Tau ratio and plasma mEV TDP-43 levels (p=0.000049); n=179 biologically independent samples.

[0211] Fig.28: Definition of cut-offs by Gaussian mixture modelling. (a,b) Distributions of raw data, plasma sEV 3R / 4R Tau, and plasma sEV TDP-43 in DESCRIBE subcohort 2. (c,d) Data with an estimated mixture of normals. Vertical lines indicate the intersections of the normal mixture components which were defined as cut-off values.

[0212] Fig.29: Plasma mEV 3R / 4R Tau ratios in the Sant Pau cohort, (a) Biologically independent samples: HC n= 50, ALS n=65, ALS-FTD n=58, bvFTD n=50 (+23 mutation carriers), PSP n=41). The long horizontal line represents the median and the short horizontal lines represent the interquartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. bvFTD p=0.0000056, HC vs. PSP p=0.0000027, ALS vs. bvFTD p=0.0000067, ALS vs. PSP p=0.0000018, ALS-FTD vs. bvFTD p=0.0000061 , ALS-FTD vs. PSP p=0.0000039, bvFTD vs. PSP p= 0.0000057; **** p<0.00001). (c-d) Two-sided Spearman correlation analysis of associations and monotonic regression splines between plasma mEV 3R / 4R Tau ratios and plasma Nfl levels within (i) PSP and (j) bvFTD diagnostic groups. (

[0213] Fig.30: Sant Pau cohort, plasma mEV 3R / 4R Tau ratios in genetic cases. TDP-43 pathology, non-Tau / non-TDP-43 pathology (a) stratified by the different diagnostic groups (HC vs. bvFTD p=0.0000056, HC vs. PSP p=0.0000027, ALS vs. bvFTD p=0.0000067, ALS vs. PSP p=0.0000018, ALS-FTD vs. bvFTD p=0.0000061 , ALS-FTD vs. PSP p=0.0000039, bvFTD vs. PSP p=0.0000057; **** p<0.00001) (b) independent from diagnostic groups. The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. TDP-43 p=0.632, HC vs. non-Tau / non-TDP-43 p=0.412, TDP-43 vs. non-Tau / non-TDP-43 p=0.256; n.s. not significant). TDP-43 pathology group: bvFTD [C9orf72 (n=12), GRN (n=6), TARDP (n=1), VCP (n=1), TBK-1 (n=3)]; ALS [C9orf72 (n=3)]; ALS-FTD C9orf72 (n=1 )]. Non-Tau / non-TDP-43 pathology group: ALS [SOD-1 (n=3); FUS (n=3)]; ALS-FTD [SOD-1 (n=1 )]. Plasma mEV 3R / 4R Tau ratios. HC: median 0.94, IQR[0.81-1.06]; TDP-43 associated genetic cases group: median 1.03, IQR[0.86-1.44]; non-TDP-43 / non-Tau associated genetic cases group: median 0.9, IQR[0.76-1 .15]).

[0214] Fig.31 : Plasma mEV TDP-43 levels in the different diagnostic groups of Sant Pau cohort, (a) Biologically independent samples: HC n= 50, ALS n=65, ALS-FTD n=58, bvFTD n=50(+23 mutations), PSP n=41). The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. ALS p=0.0000014, HC vs. ALS-FTD p=0.0000033, ALS vs. bvFTD p=0.00059, HC vs. PSP p=0.763, ALS vs. bvFTD p=0.000005, ALS vs. PSP p=0.0000062, ALS- FTD vs. bvFTD p=0.0000053, ALS-FTD vs. PSP p=0.0000042, bvFTD vs. PSP p=0.00054; **p<0.001 , ****p<0.00001). (b) Two-sided Spearman correlation analysis between plasma mEV TDP-43 and plasma Nfl levels and monotonic regression splines in patients with bvFTD (p=0.00007).

[0215] Fig.32: Plasma mEV TDP-43 levels in genetic cases of Sant Pau cohort. Cases associated with TDP-43 pathology (brown circles) or non-Tau / non-TDP-43 pathology (filled green circles) (a) stratified by the different diagnostic groups (HC vs. ALS p=0.0000014, HC vs. ALS-FTD p=0.0000033, ALS vs. bvFTD p=0.00059, HC vs. PSP p=0.763, ALS vs. bvFTD p=0.000005, ALS vs. PSP p=0.0000062, ALS-FTD vs. bvFTD p=0.0000053, ALS-FTD vs. PSP p=0.0000042, bvFTD vs. PSP p=0.00054; ** p < 0.001 , **** p<0.00001). (b) independent from diagnostic groups. The long horizontal line represents the median and the short horizontal lines represent the inter-quartile range (IQR). Kruskal-Wallis test with Dunn’s correction for multiple comparisons (HC vs. TDP-43 p=0.0000063, HC vs. non-Tau / non-TDP-43 p=0.541 , TDP-43 vs. non-Tau / non- TDP-43 p=0.0000051 ; **p<0.001 , ***p<0.0001 , ****p<0.00001); n.s. not significant. TDP-43 pathology group: bvFTD [C9orf72 (n=12), GRN (n=6), TARDP (n=1), VCP (n=1), TBK-1 (n=3)]; ALS [C9orf72 (n=3)]; ALS-FTD C9orf72 (n=1)]. Non-Tau / non-TDP-43 pathology group: ALS [SOD-1 (n=3); FUS (n=3)]; ALS-FTD [SOD-1 (n=1)]. Plasma mEV TDP-43 levels. TDP-43 pathology group: median mEV: 72.16 pg / ml, IQR[10.35-135.6]), non-Tau / non-TDP-43 group: median mEV: 15.17 pg / ml, IQR[12.30-18.63]), HC: median mEV: 15.20 pg / ml, IQR[10.23-27.73],

[0216] Fig.33: Correlation analysis of plasma EV Tau ratio and TDP-43 in the Sant Pau cohort bvFTD group (sporadic and genetic cases), (a) Two-sided Spearman correlation analysis and monotonic regression splines of associations between plasma sEV 3R / 4R Tau ratio and plasma sEV TDP- 43 levels (p=0.000021). (b) Two-sided Spearman correlation analysis and monotonic regression splines of associations between plasma mEV 3R / 4R Tau ratio and plasma mEV TDP-43 levels (p=0.000036); n=73 biologically independent samples.

[0217] Fig.34: Determination of cut-off values in the Sant Pau cohort. (a,b) distributions of raw data, (a) plasma sEV 3R / 4R Tau ratio, and (b) plasma sEV TDP-43. (c,d) data with an estimated mixture of normal, (c) sEV Tau ratio, (d) sEV TDP-43. Vertical lines indicate the intersections of the normal mixture components which were defined as cut-off values. Distribution of sEV Tau ratios and TDP-43 was best approximated by three normal Gaussian distributions. Plasma sEV 3R / 4R Tau ratio: p=0.001 ; sEV TDP-43: p=0.001 compared to one (plasma sEV 3R / 4R Tau ratio: p=0.001 ; sEV TDP-43: p=0.01), two (plasma sEV 3R / 4R Tau ratio: p=0.001 ; sEV TDP-43: p=0.01) or four Gaussian distributions (plasma sEV 3R / 4R Tau ratio: p=0.1 ; sEV TDP-43: p=0.1).

[0218] Fig.35: Plasma sEV particle concentrations in TBK-1 and VCP mutation carriers. Plasma sEV concentrations are given as particle numbers / mL in TBK-1 mutation carriers (black), VCP mutation carriers (brown) and all other samples (red). Data were normalized and pooled from DESCRIBE subcohort 2 and Sant Pau cohort. Of note, VCP mutation carriers showed plasma EV concentrations which were comparable to the cohorts’ mean value. (TBK-1 , n=5 in DESCRIBE subcohort 2 and Sant Pau cohort) and VCP (n=5 in DESCRIBE subcohort 2 and Sant Pau cohort). Total cohort: n= 850 biologically independent samples, sEV particle numbers of DESCRIBE subcohort 2 (n=563) and Sant Pau cohort (n=287). Kruskal-Wallis test followed by Dunn’s correction for multiple comparisons. Data are presented as mean + / - SEM. n.s: nonsignificant; TBK-1 vs. VCP p=0.0000085, TBK-1 vs. total cohort p=0.0000065, VCP vs. total cohort p = 0.733, ****p < 0.00001 .

[0219] Fig.36: Uncropped Western Blots from Fig. 17 a. (a) anti-L1CAM, (b) anti-Calnexin, (c) anti- Flotillin-2.

[0220] EXAMPLES

[0221] The invention is demonstrated through the examples disclosed herein. The examples provided represent particular embodiments and are not intended to limit the scope of the invention. The examples are to be considered as providing a non-limiting illustration and technical support for carrying out the invention.

[0222] Methods

[0223] Patient samples

[0224] The DZNE Clinical Registry Study of Neurodegenerative Diseases (DESCRIBE) cohort is a multicentric, longitudinal observational study conducted by the German Center for Neurodegenerative Diseases (DZNE) and its clinical sites. It recruits patients with different neurodegenerative conditions, including ALS, bvFTD and PSP. Recruitment of these patients is described in more detail below. The multicenter, longitudinal Degeneration Controls and Relatives cohort (DANCER) serves to provide HCs for all DESCRIBE subcohorts. After written informed consent (University of Bonn Ethics Board statement 311 / 14) all participants undergo baseline and annual follow-up visits with clinical and neurological examination, cognitive assessments, 3T magnetic resonance imaging (MRI), blood and CSF sampling following identical standard operating procedures. Patients with AD dementia were recruited as part of the DESCRIBE cohort, following the National Institutes of Aging-Alzheimer’s Association diagnosis criteria (65) and confirmed by positive CSF amyloid-beta, total tau and p-tau181 status.

[0225] The DESCRIBE cohort

[0226] The DESCRIBE ALS cohort. ALS patients were diagnosed according to the revised El Escorial Criteria (66). Different motor phenotypes of ALS were classified as classical ALS, progressive bulbar paresis, flail arm, flail leg, progressive muscular atrophy, primary lateral sclerosis or genetic ALS. Participants were clinically characterized using the Amyotrophic Lateral Sclerosis Functional Rating Scale-revised (67). The Edinburgh Cognitive and Behavioral ALS Screen (68) served as an additional test to identify cognitive and behavioral impairment. ALS patients with cognitive impairment, ALS with behavioral impairment, ALS with cognitive and behavioral impairment, ALS-FTD following the Strong criteria (69) and genetic ALS with a pathogenic FTD mutation also underwent the assessments of the DESCRIBE FTD cohort.

[0227] The DESCRIBE FTD cohort

[0228] Patients with bvFTD were diagnosed according to the revised Rascovsky criteria (70) by an experienced multidisciplinary team of neurologists, psychiatrists and neuropsychologists, and under consideration of MRI and CSF data, when available. Neuropsychological assessments included MMSE, the MoCA (58) , Free and Cued Selective Reminding Test (71) , the Neuropsychological battery of the Consortium to Establish a Registry for Alzheimer’s Disease Plus test (72) including Trail Making Tests A and B and the mini-Social cognition & Emotional Assessment test (73) . Psychiatric scales included Geriatric Depression Scale (74), the brief questionnaire of the NPI-Q (45) , and the functional scales CDR-SB, CDR plus NACC FTLD, FAQ (42) and a modification of the revised Cambridge Behavior Inventory (46) , the CBI-M. Patients with svPPA were diagnosed according to Gordon-Tempini criteria (75) . Baseline assessment of patients with PPA additionally included a modified version of the Camel and Cactus test (76), the visual form of the Sentence Comprehension Test (77) , the Sentence Repetition Test from the Aachen Aphasia Test (78), hierarchical word lists (79) and the Repeat and Point Test (80).

[0229] The DESCRIBE PSP cohort

[0230] The cohort design is summarized in ref. 81. Diagnosis of PSP was based on the National Institute of Neurological Disorders and Stroke and the Society for PSP criteria (82) for participants recruited before 2017, and on the Movement Disorder Society (MDS-PSP) diagnostic criteria (83) for participants recruited after 2017. Participants were clinically phenotyped by the PSP-RS (35), PSP-SS (35), PSP-QoL (41) , PSP-CDS (36), SEADL (37) , MDS-UPDRS Part III (39) , SAS (40), CGI-s (38), Geriatric Depression Scale (74) and MoCA (34).

[0231] The healthy control (HC) cohort DANCER

[0232] HC samples were obtained from DANCER and included (71) participants who, based on neuropsychological testing, neurological and psychiatric examination, do not suffer from a neurodegenerative disease. Participants additionally underwent MRI. The neuropsychological test battery follows the same protocol and includes all assessments as the one used for participants of the DESCRIBE FTD cohort. Participants undergo an annual follow-up as well as genetic testing at baseline (see below). Relatives with a known pathogenic FTD-ALS mutation were excluded as controls.

[0233] Genetics

[0234] All patients with a diagnosis of bvFTD, FTD-ALS, ALS with cognitive and or behavior impairment, and all control subjects were tested for pathogenic C9orf72 hexanucleotide repeat expansions, for insertions or deletions in MAPT and GRN genes by multiplex ligation-dependent probe amplification and for other protein-coding variants by whole-exome sequencing. Specifically, expansions of the C9orf72 GGGGCC hexanucleotide repeat were detected by the AmplideX PCR / CE C9orf72 kit (Asuragen) with a cut-off value of 30 repeats defining pathologically expanded repeats. For detection of deletions or duplications in GRN and MAPT genes we employed the SALSA multiplex ligation-dependent probe amplification kit (MRC-Holland). Participants with ALS and PSP were not systematically screened for mutations as part of the DESCRIBE study protocol. Our study sample contained 37 mutation carriers, including 18 C9orf, 4 GRN, 3 MAPT, 4 VCP, 2 TBK1, 2 CHCHD10, 2 PUS and 2 SOD-1 cases.

[0235] DZNE Brain Bank postmortem cohort and neuropathological diagnosis In the DZNE Brain Bank, autopsies and sampling of tissues for diagnostics and research is performed after written informed consent in accordance with local ethics review boards. Brain autopsies and neuropathological diagnosis were available for 31 participants from subcohort 2, consisting of 24 cases with a TDP-43 proteinopathy (ALS-TDP and FTLD-TDP, including 2 cases with TBK1 mutation), 5 cases with a tau proteinopathy (PSP and FTLD-tau including 1 case with MAPT mutation), as well as 1 ALS with a mutation in SOD-1 and 1 ALS case with a CHCHD10 mutation. Neuropathological evaluation was performed for all cases on formalin-fixed paraffin- embedded tissue sections from 20 standardized neuroanatomical regions following guidelines for the assessment and diagnosis of neurodegenerative diseases including immunohistochemistry with antibodies against phosphorylated TDP-43 (clone 1 D3) (84), phosphorylated tau (clone AT8, Thermo Fisher), a-synuclein (clone 4D6, Origene) and beta-amyloid (clone 4G8, Covance). For all cases, assessment included reporting of AD neuropathological changes (85) and presence / regional distribution of Lewy pathology (86). Cases with FTLD-TDP were subclassified according to current criteria (87).

[0236] The Sant Pau cohort

[0237] Patients with ALS were prospectively recruited from the Motor Neuron Disease Clinic at Hospital de la Santa Creu i Sant Pau. We included patients categorized as probable laboratory-supported or definite ALS according to El Escorial revised criteria (88). ALSFRS-R in its Spanish version (89) was systematically assessed at the time of sample acquisition. Unimpaired HCs, bvFTD and PSP patients were recruited at the Sant Pau Memory Unit and include individuals from the Sant Pau Initiative on Neurodegeneration multimodal biomarker cohort. ALS-FTD patients were recruited by Sant Apu Memory Unit and Motor Neuron Disease Clinic. Information about clinical and neuropsychological assessments and sample processing have been previously described in detail (49). Plasma samples were obtained using the same standard operating procedure. All patient samples (ALS, ALS-FTD, bvFTD and PSP) were screened for the presence of a pathogenic repeat expansion mutation in C9orf72. In addition, patients with ALS were tested for mutations in genes causing ALS, FTD and AD using a gene panel. bvFTD and PSP patients underwent whole-exome sequencing. In total, pathogenic mutations were found in C9orf72 (n = 16), GRA / (n = 6), SOD1 (n = 4), TBK1 (n = 3), AGS (n = 3), TARDBP (n = ) and VCP (n = 1). This study was approved by the Hospital de la Santa Creu i Sant Pau Ethics Committee. Written informed consent was obtained from all participants.

[0238] EV isolation from plasma and CSF

[0239] EVs were prepared from EDTA plasma as described in reference 26 by a blinded experimenter. Briefly, 500 pl of plasma was thawed on ice and subjected to serial centrifugation to isolate sEVs and mEVs. To remove cellular debris, plasma was centrifuged for 10 min at 4 °C and 3,500g, and twice at 4,500g. The supernatant was subsequently centrifuged for 30 min at 10,000g and 4 °C. The resulting pellet (mEV fraction) was resuspended in 100 pl of PBS, 1 % CHAPS, whereas the supernatant was applied to size-exclusion columns equilibrated with 10 ml of 20 mM HEPES buffer (pH 7.4) to isolate sEVs (qEVoriginal, 70 nm+; Izon Science Limited). Using the Izon Automatic Fraction Collector and by adding 20 mM HEPES buffer (pH 7.4), we eluted 24 fractions with a volume of 500 pl. As shown previously (26), fractions 7-10 contain the highest EV concentrations without contamination by nonvesicular plasma proteins. We therefore pooled fractions 7-10 as the sEV fraction and subjected them to 4,000g centrifugation at 4 °C in an Amicon Ultra centrifugal filter with a 3-kDa cut-off (Merck Millipore) for 40 min at 20 °C to concentrate the sample. Subsequently, the volume was filled up with 10% CHAPS in a 20-mM HEPES to a final concentration of 1% CHAPS (300 pl). Samples were divided in three, stored at -20 °C until further analysis of tau and TDP-43 content. CSF EV for correlation analysis of CSF and plasma EV tau levels were prepared from all DESCRIBE subcohort 1 cases, following the same protocol as for plasma EVs, with a starting volume of 1 .5 ml of CSF. We prepared CSF EV for correlation analysis with corresponding plasma EV TDP-43 levels for all ALS cases in DESCRIBE subcohort 2 for which CSF was available (n = 41). A starting volume of 1 ml of CSF was used. Of note, in all cases CSF was drawn at the same visit as plasma samples. In all cohorts, we aimed for sex-balanced and age-balanced diagnostic groups. The sex of participants was determined based on self-report.

[0240] L1CAM immunocapture assay

[0241] Plasma (500 pl) was thawed on ice and subjected to serial centrifugation to isolate mEVs and sEVs as described above. mEVs were resuspended in 300 pl of PBS. sEV preparations were concentrated to a final volume of 300 pl, which was divided into three aliquots of 100 pl each. L1CAM immunoisolation from EV preparations was performed as described previously (90). In brief, 100 pl of sEVs were diluted in 400 pl of double-distilled H2O supplemented with protease and phosphatase inhibitors and 3% bovine serum albumin. Dilutions were incubated for 60 min with 2.7 pg of biotinylated mouse anti-human CD171 (L1 CAM neural adhesion protein) antibody (clone 5G3; eBiosciences) at room temperature and under constant shaking at 800 rpm. For the IgG control condition, 2.7 pg of biotinylated mouse immunoglobulin G2 (lgG2) antibody (clone eBM2a; cat. no. 13-4724-85, Thermo Fisher Scientific) was added instead of anti-human CD171 antibody. Subsequently, 26 pl of streptavidin agarose Ultralink resin (Thermo Fisher Scientific) was added followed by 60 min of incubation at room temperature and shaking at 800 rpm. Solutions were centrifuged for 10 min at 800g at 4 °C and pellets were resuspended for 10 s in 50 pl of cold 0.1 M glycine-HCI (pH 3.0) followed by centrifugation at 4 °C and 4,500g for 5 min. The supernatant was transferred to tubes containing 50 pl of 3% bovine serum albumin in 1 M Tris-HCI (pH 8.0). Aliquots of 5, 15 and 80 pl were used for nanoparticle tracking analyzer (NTA), western blot and TDP- 43 or tau analysis by SIMOA or electrochemiluminescence / Meso Scale discovery (MSD)ZELISA, respectively. Before TDP-43 and tau analysis, CHAPS was added at a final concentration of 1 %.

[0242] Western blotting

[0243] Western blotting was performed according to standard protocols using 10% or 12% sodium dodecyl sulfate polyacrylamide gels, followed by transfer to polyvinylidene fluoride (PVDF) membranes (Millipore). PVDF membranes were blocked for 30 min in 4% w / v nonfat dried milk in TBS-Tween 0.5% v / v (TBS-T). Primary antibodies were incubated with the PVDF membrane overnight at 4 °C, and secondary antibodies for 1 h at room temperature. Protein bands were visualized using an ECL western blotting detection kit (GE Healthcare). The following antibodies were used. (1) Primary antibodies: anti-Calnexin (1 :2,000 dilution; cat. no. C4731 , Sigma-Aldrich), anti-Flotillin-2 (1 :500 dilution; cat. no. 610384, BD Biosciences); anti-3R tau (RD3 anti 3R tau antibody; 1 :500 dilution; cat. no. 05-803, Merck), anti-4R tau (anti-4R tau antibody; dilution 1 :500; cat. no. ab218314, Abeam), and anti-TDP-43 antibody (dilution 1 :500; cat. no. ab305694, Abeam). (2) Secondary antibodies: HRP anti-mouse IgG (1 :5,000 dilution; Dako), HRP antirabbit IgG (1 :5,000 dilution; Dako).

[0244] Nanoparticle tracking analyzer (NTA)

[0245] NTA was performed with a NanoSight LM10 instrument and a LM14 viewing unit equipped with a 532 nm laser (NanoSight, Malvern Instruments) by a blinded experimenter. Samples were recorded in quadruplicates for 30 s and analyzed with the NTA 2.3 software.

[0246] Development of 3R and 4R isoform-specific tau immunoassays

[0247] We developed two sandwich immunoassays for the specific detection of 3R and 4R tau isoforms, using antibody pairs of isoform-specific tau antibodies with HT7, an antibody raised against an N- terminal, isoform-independent epitope (amino acids 159-163). Detection of 3R and 4R tau in plasma EVs and the specificity of the antibodies was demonstrated by western blot analysis with recombinant 3R and 4R tau proteins (Fig. 16a-e). Optimal dilutions of capture and detection antibodies were standardized, using the checkerboard method with serially increasing dilutions of capture and detection antibodies, different dilution buffers, incubation times, temperatures and EV lysis methods. The reproducibility of each assay was tested by performing them at least three times with technical replicates. Immunoassay performance parameters such as precision, intraassay and interassay variability, matrix effect, linearity and parallelism were determined for both 3R and 4R tau assays in plasma-derived sEVs and mEVs using three biological replicates. (Table 4).

[0248] 3R tau immunoassay

[0249] Plasma sEV and mEV 3R tau were measured in duplicate, 50 pl per well, by a blinded experimenter. Briefly, 96-well multiarray plates (Meso Scale Discovery) were coated with RD3 anti-3R tau antibody (cat. no. 05-803, Merck) after 1 :600 dilution in Dulbecco's Phosphate Buffered Saline overnight at 4 °C. After washing three times with 0.05% Tween-20 in Dulbecco's Phosphate Buffered Saline (PBST), plates were blocked at room temperature with 150 pl of blocking buffer per well for 1 h under shaking at 350 rpm. Protein standards were prepared from 3R recombinant tau (htau23) by serial 2* dilution in blocking buffer (7,000 pg ml-1highest standard to 109.38 pg ml-1lowest standard). Standards and samples were incubated at room temperature under shaking at 350 rpm for 2 h, followed by washing three times with PBST. Plates were then incubated for 1 h at room temperature with the detection antibody, biotinylated antitotal tau HT7 (product no. MN1000B, Thermo Fisher Scientific, epitope residues 159-163), at a 1 :300 dilution in blocking buffer and under shaking at 350 rpm. After washing three times in PBST, 50 pl of sulfo-tagged streptavidin (Meso Scale Discovery) was added in a 1 :300 dilution per well and incubated for 1 h at room temperature in the dark and under shaking at 350 rpm. Plates were then washed three times and each well was incubated with 150 pl of 2* MSD Reading Buffer T (Meso Scale Discovery). Plates were then measured using a Sector Imager 6000 and the MSD Discovery Workbench 3.0 Data Analysis Toolbox (Meso Scale Discovery).

[0250] 4R tau immunoassay Plasma sEV and mEV 4R tau were measured in duplicate, 50 pl per well, by a blinded experimenter. Plates (cat. no. DY008, Biotechne) were incubated with capture antibody directed against 4R tau (Abeam 4R antibody; [EPR21725], cat. no. ab218314) in 100 pl of a 1 :300 dilution in plate-coating buffer (R&D DY008 kit) for 18 hours at room temperature and under constant shaking at 150 rpm. After washing three times washing in 1 x washing buffer (R&D DY008 kit), blocking buffer (10x diluted in dPBS, R&D blocking buffer, containing 0.1 x HAMA blocker (cat. no. ab193969, Abeam)) was added to each well and the mixture was incubated at room temperature for 1 h under shaking at 350 rpm. Wells were subsequently washed three times in washing buffer. 4R tau standard was prepared from recombinant 4R tau (htau40) by serial dilution in blocking buffer (standard 1 (7,000 pg ml-1) to standard 7 (109.48 pg ml-1)). Standard and samples were incubated for 2 h 20 min at room temperature under shaking at 350 rpm. After washing three times, wells were incubated under shaking at 350 rpm for 2 h at room temperature with detection antibody (biotinylated total tau HT7, 1 :300 dilution in blocking buffer; product no. MN1000B, Thermo Fisher Scientific), followed by washing three times and incubation with streptavidin HRP (R&D Systems) for 30 min at room temperature in the dark with shaking at 350 rpm. Next, wells were washed three times and incubated for 15 min with substrate solution (R&D DY008 kit) and subsequently with stop solution. The plates were subsequently measured immediately using a BMG Fluostar ELISA reader.

[0251] TDP-43 SIMOA assay

[0252] TDP-43 levels were determined from plasma, plasma sEV and mEV fractions using the human TDP-43 Advantage kit on a SIMOA HD-X analyzer, software v.3.1 (Quanterix) by a blinded experimenter following the manufacturer’s instructions. As per the product information, the assay was developed against TDP-43 amino acids 203-209 and the C-terminal region. Samples were thawed on ice and randomized on plates. Plasma samples were measured in duplicate, and sEV and mEV samples as singlets, 50 pl per well. Plasma EV TDP-43 levels were sometimes low in the HC and PSP groups, with 28 sample measurements below the lower limit of quantification, most likely reflecting the absence of TDP-43 alterations in these groups. Such floor effects could be a limiting factor; however, they can be easily overcome by using larger plasma volumes (>500 pl) for sample preparation, if necessary.

[0253] Plasma NfL SIMOA assay

[0254] Plasma NfL concentrations were determined in duplicate, as previously described (91), using the SIMOA NF-light Advantage kit on a Quanterix HD1 analyzer (Quanterix) by a blinded experimenter according to the manufacturer’s instructions.

[0255] Statistical analysis

[0256] Statistical analysis and data visualization were performed using Prism 7 (GraphPad Software), SPSS Statistics 21 (IBM) and R (R Foundation for Statistical Computing) software programs. The statistical tests were two-tailed and values with P < 0.05 were considered significant.

[0257] Comparisons of marker levels were performed using Kruskal-Wallis tests followed by Dunn’s correction for multiple comparisons because of non-Gaussian distributions. Normal distribution assumption was assessed based on visual inspection of histograms and Kolmogorov- Smirnov tests. To assess the link between EV marker and clinical scales as well as plasma NfL, Spearman correlations were used. To illustrate associations between plasma NfL and plasma EV 3R / 4R tau ratio, plasma NfL and plasma EV / TDP-43, as well as plasma EV 3R / 4R tau and plasma EV TDP- 43 (Figs. 1 , 2 and 4 and Figs. 18, 20, 24 and 27), monotonic regression splines (using the ‘cgam’ function from R package ‘splines’) were modeled. Notably, potential confounders (age, sex and disease duration) showed no influence on plasma biomarker levels. We therefore used the nonparametric tests described above with covariate adjustment to account for violations of normal distribution assumptions and nonlinear relationships.

[0258] MedCalc software was used for computation and comparison of ROC curves, using the method of Hanley and McNeil (92) (standard error, 95% Cl for the difference and P value), as well as for calculation of sensitivity and specificity. Precision recall curves, area under the precision recall curve and Cis were calculated using the R code from reference 93 and published prevalence estimates for the different diagnoses (PSP (94), ALS (95), bvFTD (96)).

[0259] The cut-off values of 3R / 4R tau ratio and TDP-43 levels were defined with Gaussian mixture modeling using the R statistical software program v.3.2.1 mix tools package as previously described in reference 42. First, the R boot.comp function was used to determine the number of distributions that fitted best to the data. Next, we defined data-driven cut-offs as the point at which the lines of fitted normal distributions crossed each other. Specifically, we derived three normal distributions (as suggested by bootstrapping) and determined the intersection of the middle normal distribution with the two more extreme distributions. We computed sensitivity and specificity based on the cut-offs of plasma sEV 3R / 4R tau ratio and TDP-43 levels as determined by mixture modeling.

[0260] Modified version of the Cambridge Behavioural Inventory (CBI-M)

[0261] In the DESCRIBE-FTD cohort, we used a modified 50-item version of the CBI-R. Before including this new version into the analyses, we conducted a principal component analysis (PCA) with varimax rotation to confirm the theoretical factor structure. Participants with over 20% missing rate over all items were removed. In addition, one item with over 20% missing rate across all participants was excluded. Four further items were excluded due to the low factor loadings and cross-loadings. Therefore, the modified version (CBI-M) resulted in 45 items with 12 new items and 33 items from the CBI-R. The total CBI-M score was calculated by the mean of all available item scores for each bvFTD participant.

[0262] Transmission electron Microscopy (TEM)

[0263] TEM was performed as described previously (99). Formvar coated copper grids (150 hexagonal mesh, Science Services, Munich, Germany) were incubated for 10 min on top of 10 pl droplets containing EV preparations. After 5 times PBS washing, grids were incubated first on water droplets and then 5 min on uranyl acetate-oxalate droplets (1 :9 dilution of 4% uranyl acetate in 2% methylcellulose). Samples were imaged with a LEO912 transmission electron microscope (Carl Zeiss Microscopy, Oberkochen, Germany) equipped with an on-axis 2k CCD camera (TRS, Moorenweis, Germany).

[0264] Cell Culture & siRNA transfection Cells of the human neuroblastoma-derived SH-SY5Y cell line were maintained in DMEM, supplemented with 10% fetal bovine serum (FBS), 1 mM glutamine, 100U / mL penicillin and 100 pg / mL streptomycin in a humidified incubator with 5% CO2 at 37°C.

[0265] For siRNA-mediated knock-down of TDP-43, the following siRNA sequences were used (100): siTDP-43 sense (SEQ ID No. 1): GCGGGAAAAGUAAAAGAUGUU siTDP-43 antisense (SEQ ID No. 2): AACAUCUUUUACUUUUCCCGC) scrambled siRNA sense (SEQ ID No. 3): AUCCCGCUAGGCCAUUCAAGUU scrambled siRNA antisense (SEQ ID No. 4): AACUUGAAUGGCCUAGGGGAU.

[0266] Scrambled siRNA was used as a negative control. siRNAs were transfected into 1x106SH-SY5Y cells using RNAiMax transfection reagent (Invitrogen, catalog# 13778150) according to the manufacturer’s instructions. The cells were lysed with Tris-HCI, pH 8.0, 250 mM NCI, 0.5% NP- 40, 1 mM EDTA, 1 mM DTT, and 1 * protease inhibitors (Thermo Scientific, catalog#A32965) 72 hours after transfection. The siRNA knockdown efficiency was evaluated by Western Blotting using BioRad Image lab software (Image Lab 6.1 (BioRad, USA).

[0267] Immunoprecipitation-Mass Spectrometry (IP-MS)

[0268] Tau was immunopurified, then digested as previously described and multiple tau peptides were quantified using high resolution mass spectrometry (MS) (101) from plasma and CSF sEV and mEV preparations (pooled samples, corresponding to 10 ml starting volume of plasma and CSF, respectively). Prior to immunopurification, 2.5 ng of fully 15 N-labeled 441 (2N4R) tau internal standard was mixed with CSF or plasma fractions and diluted in 0.5% NP40, 2.5 mM guanidine and protease inhibitors. Tau was immunopurified by incubating the samples with Tau1 (provided by Drs. Nicholas Kanaan and Lester Binder) and HJ8.5 (provided by Dr. David Holtzman) antibodies at room temperature for 4 hours (3 mg antibody per g of beads) (102). Immunopurified tau was digested for 16 hours at 37°C with 400 ng of trypsin (Promega). The peptide mixture was purified by solid phase extraction on C18 TopTip (Glygen Corp, Columbia, MD). Eluates were dried, resuspended and transferred in MS vials. Samples were subjected to liquid chromatography and tandem high resolution mass spectrometry (LC-MS / HRMS) analysis on a nanoAcquity UPLC system (Waters, Mildford, Massachusetts) coupled to an Orbitrap Tribrid Fusion MS (Thermo Scientific, San Jose, California) operating in PRM mode. MS / HRMS transitions were extracted using Skyline version 22.2.2.278 (MacCoss lab, University of Washington). Tau peptides concentrations were calculated using measured ratios between MS / HRMS transitions of endogenous non-phosphorylated peptides and 15N labeled peptides from the protein internal standard on peptides 151-155, 156-163, 181-190, 195-209, 212-221 , 226-230, 260-267, 282-290, 299-321 , 354-369 and 396-406.

[0269] Preparation of recombinant Tau protein hTau23 (0N3R, 352 residues) is the shortest Tau ((UniProt ID 10636) isoform in human CNS containing 3 repeats, whereas hTau40 (2N4R, 441 residues) is the longest Tau isoform with 4 repeats and two N-terminal inserts (Fig. 15). Recombinant Tau protein was prepared from Escherichia coli BL21 (DE) strains expressing either hTau23 or hTau40 as described (103). Purity of recombinant Tau 30 and isoform specificity of 3R and 4R Tau antibodies were analyzed by Western Blotting.

[0270] Assay Validation

[0271] Assay validation was performed according to the guidelines published in Andreasson et al. (104).

[0272] Sensitivity: For the determination of the lower limit of quantification (LLOQ) of each assay, 16 blank samples were measured on one plate. The calibration curves were calculated using a four- parameter logistic curve fit for all assays, which gave the optimal fit. LLOQ was calculated as the concentration corresponding to the 2.5 signal standard deviation above the background (zero calibrator

[0273] Precision: Intra-assay variation (repeatability) was determined by analysis of samples (n=5) in four replicates on one plate. Inter-assay variation (intermediate precision) was measured to determine the variation of analyses between 5 different days.

[0274] Dilutional linearity: Three different EV samples were used in duplicates to perform the dilution linearity experiments. The dilutional linearity (dilutions 2x, 4x and 8x) was calculated as follows: %Linearity = [observed C ‘dilution factor / previous observed C*previous dilution factor] *100; C = concentration(pgZmL).

[0275] Recovery: Three different plasma EV samples, measured in duplicates, were spiked with recombinant 3R Tau, 4R Tau, and TDP43 calibrator at three different concentrations (low: 3R and 4R Tau 1 ,750 pg / mL, TDP-43 1 ,250 pg / mL; medium: 3R and 4R Tau 3,500 pg / mL, TDP-43 2,500 pg / mL; high: 3R and 4R Tau 7,000 pg / mL, TDP-43 5,000 pg / mL). For neat samples, the buffer was spiked instead of the calibrator. Spike recoveries were calculated according to the formula: % Recovery = [C spike sample-C neat sample / theoretical C spike] *100; C = concentration (pg / mL). Parallelism: Three different EV samples with high endogenous protein concentrations were serially diluted (2x, 4x and 8x). Both reciprocal relative dilution factor and OD450 absorbance signals of the samples and calibrator were log-transformed and linear regression was performed to calculate the slopes of the sample and calibrator curves. The slope of the linear parts of the log-log transformed calibrator and sample dilution series were compared to determine the degree of parallelism by calculating the “in range%” using the following formula: in range% = [slope of sample dilution / series slope of calibration curve] *100.

[0276] Results

[0277] Detection of full-length tau in CSF and plasma EVs

[0278] Medium-sized CSF and plasma EVs (mEVs) were prepared after sequential centrifugation from the 10,000g centrifugation pellet (26). Small EVs (sEVs) were isolated from the 10,000g supernatant by size-exclusion chromatography as previously described (26) (Fig. 14c,d). Mass spectrometry revealed full-length tau in CSF and plasma EVs, allowing the distinction of 3R and 4R isoforms (Fig. 15). Because venous puncture is less invasive than lumbar puncture, it was decided to assess 3R and 4R tau isoform concentrations in plasma EVs, using sandwich immunoassays (Fig. 29a-e, Table 4). To test whether plasma EV tau stems from brain or peripheral nerve cells (27), thrombocytes (28) or lymphocytes (29), anti-L1 cell adhesion molecule-positive EVs (L1CAM EVs) were immunoisolated from plasma EV preparations. L1CAM EVs are considered brain-neuron derived (30). As shown in Fig. 17, the vast majority of plasma EV tau resided in L1CAM EVs.

[0279] Table 4: 3R-4R Tau and TDP-43 assay validation parameters in plasma sEV and mEV

[0280] Characterization of EV preparations

[0281] EV preparations were characterized by Western Blot for the presence of the typical EV marker protein Flotillin-2 and the absence of Calnexin to rule out contamination of the preparations with microsomal fractions (Fig.14a, b). Nanoparticle tracking analysis (NTA) revealed a size range of 80 to 150 nm for the sEV preparation and of 100 to 400 nm for the mEV fraction (Fig.14c, d). Transmission electron microscopy (TEM) showed the typical cup-shaped morphology of EVs (Fig.14e, f).

[0282] Characterization of EV Tau by LC-MS / HRMS

[0283] Since the lipid bilayer membrane can protect EV cargo from degradation, we hypothesized that EVs may contain full-length Tau and thus allow the quantification of Tau isoforms, which is otherwise hampered by Tau fragmentation. We solubilized plasma and CSF EVs prepared from 10 ml of pooled samples with 0.5% NP40 and 2.5 mM guanidine prior to Tau immunopurification. To determine the abundance of 3 and 4R Tau isoforms (Fig.15a) and Tau fragmentation status, we performed liquid chromatography and tandem high resolution mass spectrometry (LC- MS / HRMS) (Fig.15b). Eleven Tau peptides were detected, including peptides specific to the repeat region (peptides 7-10). 4R Tau isoforms are characterized by the presence of the second repeat and were identified by detection of peptides 8 (residues 282-290 in the second repeat) and 9 (residues 299-321 spanning the transition from the second to third repeat) (Fig.15b). In neat CSF, extremely low levels were detected for peptides 7-10 which cover the repeat region, compared to mid domain specific peptides 1-5 (Fig. 15c). This data is consistent with the previously described fragmentation of Tau’s microtubule binding repeat region in extracellular fluids, including plasma (97). In contrast, in CSF sEV and mEV fractions, 4R Tau specific peptides 8 and 9 were highly abundant, suggesting that CSF EVs mainly contain the full microtubule-binding repeat region of Tau (Fig.15b).

[0284] Plasma EVs contain TDP-43

[0285] We first tested the specificity of the SIMOA assay in SY5Y cell lysates upon RNAi-mediated down-regulation of endogenous TDP-43 with scrambled siRNA as a control. We found RNAi- mediated downregulation of TDP-43 as quantified by Western blot analysis (86.12% compared to scrambled control, p<0.0001) and SIMOA assay (81.29% downregulation, p<0.0001) (Fig.23a, c). In contrast, spiking of SY5Y cell lysates with recombinant TDP-43 protein resulted in appropriate increase of TDP-43 protein concentrations as determined by SIMOA assay (96.33% recovery) (Fig.25d). We then tested the assay performance specifically with plasma sEV and mEV preparations, as the manufacturer’s assay performance parameters were determined for plasma, not EVs (Table 4).

[0286] Plasma EV 3R / 4R tau ratio is low in PSP and high in bvFTD

[0287] A pilot study on plasma EV 3R and 4R tau content was performed in a subcohort of the DZNE multicenter DESCRIBE cohort (subcohort 1) (Table 1 and Fig. 7). Table 1 : Demographic and Clinical Characteristics of All Patients in DESCRIBE subcohort 1

[0288] The plasma EV 3R / 4R tau ratio did not correlate with age, sex and disease duration. HC, AD and svPPA groups showed plasma sEV 3 / 4R tau ratios of ~1 , consistent with the balanced ratios of 3R and 4R tau described in physiological conditions and in AD tau aggregates 31 (HC median 1.16, interquartile range (IQR) [0.99-1 .28]; AD median 0.91 , IQR [0.57-1 .25]; svPPA median

[0289] 1.00, IQR [0.98-1.11]) (Fig. 1a). sEV 3R / 4R tau ratios were lower in the 4R tauopathy PSP (median 0.18, IQR [0.13-0.29]; P < 0.0001 for all comparisons), and higher in bvFTD compared with all other groups (bvFTD median 2.59, IQR [2.02-3.87], P < 0.001 versus HC; P < 0.0001 versus all other groups). Individual bvFTD values overlapped partially with HC, svPPA and groups. Receiver operating characteristic (ROC) curve analysis revealed high diagnostic accuracies for the distinction of PSP (Fig. 1 b-e) and bvFTD (Fig. 1 f— h) from all other groups (AUC PSP versus HC 0.96, 95% confidence interval (Cl) [0.83-0.98]; PSP versus AD 0.99, Cl [0.90-1.00]; PSP versus svPPA 0.96, Cl [0.90-0.98]; PSP versus bvFTD 0.99, Cl [0.94-1.00]; bvFTD versus HC 0.93, Cl [0.88- 1 .00]; bvFTD versus AD 0.90, Cl [0.90 1 .00]; bvFTD versus svPPA 0.95, Cl [0.90-0.98]).

[0290] Plasma sEV 3R / 4R tau ratios correlated positively (r= 0.68, P < 0.0001) with plasma NfL levels in bvFTD, and negatively in the 4R tauopathy PSP (Fig. 1 i,j (sEV r= -0.48, P = 0.001)). High plasma EV 3R / 4R tau ratios in bvFTD corresponded to more severe clinical and cognitive impairment, as did low ratios in PSP, consistent with 4R tau predominance in PSP (Fig. 1 k-n, Fig. 18). Next a potential correlation of 3R / 4R tau ratios between CSF and plasma sEV was tested (Fig.19). However, low sample numbers and the need for larger CSF sample volumes prevent a clear conclusion on whether CSF and plasma sEV 3R and 4R tau correlate with each other.

[0291] The findings were validated in additionally available samples of the DZNE DESCRIBE cohort (subcohort 2: 56 HC, 165 ALS, 179 bvFTD and 163 PSP samples). Patient demographics are given in Table 2. ALS was chosen as a TDP-43 control group because the vast majority of ALS cases are associated with TDP-43 pathology (32). Plasma sEV 3R / 4R tau ratios were lowest in PSP (median sEV: 3R / 4R tau 0.45, IQR [0.34-0.60]) and differed from all other diagnostic groups (median sEV: HC 0.99, IQR [0.91-1.03], PSP versus HC P < 0.0001 ; ALS 0.95, IQR [0.88-1.01], PSP versus ALS P < 0.0001 ; bvFTD 1.10, IQR [0.99-1.76], PSP versus bvFTD P < 0.0001) (Fig.

[0292] 2a). ROC analysis (Fig. 2b-d), revealed high accuracy for the distinction of PSP from HC (AUC 0.98, Cl [0.96-1.00]), ALS (AUC 0.96, Cl [0.94-0.99]) and bvFTD (AUC 0.98, Cl [0.73-1.00]) (Fig. 20a-d).

[0293] Table 2: Demographic and Clinical Characteristics of All Patients in DESCRIBE subcohort 2

[0294] Increased EV 3R / 4R tau ratios were detected in bvFTD. Approximately 50% (54.19%) of bvFTD values were above the control group median, suggesting tau pathology in these cases (median sEV 3R / 4R tau in bvFTD 2.28, IQR [1.13-2.4]; median mEV 3R / 4R tau in bvFTD 1.84, IQR [1.19-2.13]; bvFTD versus all other diagnostic groups P < 0.0001 (median sEV); bvFTD versus all other diagnostic groups P < 0.0001 (median mEV)). Plasma EV 3R / 4R tau ratios distinguished bvFTD from HC, ALS and PSP with high diagnostic accuracy (sEVs AUC 0.89-0.98 (Fig. 2d-f) and mEVs AUC 0.86-0.97 (Fig. 20d,f). As in subcohort 1 , EV tau ratios were not correlated with age, sex and disease duration.

[0295] Plasma EV 3R / 4R tau ratios correlate with disease severity

[0296] Similar to subcohort 1 , plasma EV 3R / 4R tau ratios correlated with plasma NfL in bvFTD (r = 0.28, P < 0.0001 (sEV) and r= 0.36, P = 0.002 (mEV)) and inversely in PSP (r= -0.33, P < 0.0001 (sEV) and r= -0.24, P = 0.005 (mEV)) (Fig. 8a, b; Fig. 20g, h). Plasma EV 3R / 4R tau ratios correlated with clinical, neurological and cognitive measures of disease severity in the PSP group, with low plasma ratios indicative of increased severity (PSP: Mini Mental State Examination (MMSE) (33) , Montreal Cognitive Assessment (MoCA) (34), PSP rating scale (PSP-RS) (35), PSP clinical deficits scale (PSP-CDS) (36), Schwab and England disability scale (SEADL) (37), Clinical Global Impression Severity Scale (CGI-s) (38) (Fig. 2g, h; Fig. 21 i,j), PSP staging system (PSP-SS) (35), MDS-Unified Parkinson’s Disability Rating Scale part III (MDS-UPDRS III) (39), Starkstein Apathy Scale (SAS) (40) and PSP quality of life scale (PSP-QoL) (41) (Fig. 21a, b).

[0297] In bvFTD, high plasma sEV 3R / 4R tau ratios were associated with impaired cognition, compromised functional activities, increased symptom severity and a higher burden of behavior symptoms (MMSE, MoCA, Functional Activities Questionnaire (FAQ) (42), Clinical Dementia Rating-Sum of Boxes (CDR-SB) (43), Clinical Dementia Rating (CDR) plus National Alzheimer’s Coordinating Center (NACC) Behavior and Language Domains Frontotemporal Lobar Degeneration (NACC FTLD) (44), Neuro psychiatric Inventory Questionnaire (NPI-Q) (45), and the modified version of the Cambridge Behavior Inventory-Revised Version (CBI-M) (46) (Fig. 2i,j). Similar results were observed for mEVs. Plasma EV tau ratios in pathology-confirmed cases

[0298] We stratified cases with known mutations (n = 37) or neuropathologically confirmed diagnoses (n = 31) into TDP-43, tau and non-TDP-43 / non-tau pathology groups (number of individual cases n = 63, 5 of these had both genetic and neuropathological diagnosis). Most mutations were linked to TDP-43 pathology (18 C9orf72, 4 GRN, 4 VCP and 2 TBK1), with the exception of three MAPT mutations (MAPT P301 L, MAPT P364S and MAPT IVS 10+16C>T) in bvFTD.

[0299] Neuropathological diagnoses of nongenetic cases included 22 with TDP-43 (16 ALS-TDP, 6 FTLD-TDP) and 4 with tau pathology (3 PSP-type, 1 GGT-type). All genetic and neuropathologically confirmed cases with TDP-43 pathology were combined into a ‘TDP-43 pathology’ group (n = 50) and all with tau pathology into the ‘tau pathology’ group (n = 7). Cases with neither TDP-43 nor tau pathology (2 SOD1, 2 PUS and 2 CHCHD10 mutation carriers) were classified as ‘non-TDP-43 / non-tau pathology’ (n = 6).

[0300] In the TDP-43 pathology group, and in the non-TDP-43 / non-tau pathology group, sEV 3R / 4R tau ratios were ~1 and did not differ from the HC group (HC: median sEV 0.99, IQR [0.91-1 .03]; TDP-43 group: median sEV 0.95, IQR [0.92-0.97], versus HC P > 0.05; non-TDP-43 / non-tau group: median sEV 0.96, IQR [0.90-1 .03], versus HC P > 0.05) (Fig. 2k, I (mEV); Fig. 22a, b). Importantly, all bvFTD TDP-43 pathology cases were in the lower range, comparable with HC, and ALS PSP / GGT-type 4R tau pathology cases were characterized by decreased plasma EV 3R / 4R tau levels (median sEV 0.42, IQR [0.35-0.60]) compared with HC (median sEV 0.99, IQR [0.91-1 .03], P < 0.00001), with TDP-43 pathology (median sEV 0.95, IQR [0.92-0.97],

[0301] P < 0.00001) and with non-TDP43 / non-tau pathology groups (median sEV 0.96, IQR [0.90-1 .03], P < 0.00001). By contrast, EV 3R / 4R tau ratios in MAPT mutation carriers were approximately three to four times higher (median sEV 3.96, IQR [3.81-4.12]) compared with HC, TDP-43 and non-TDP-43 / non-tau control groups (P < 0.00001). Thus, EV 3R / 4R tau ratios may separate FTLD-tau pathology from FTLD-TDP and detect PSP / GGT-type tau pathology.

[0302] Plasma EVs contain TDP-43

[0303] Western blotting (Fig. 23a) and single-molecule array (SIMOA) assay analysis confirmed the presence of TDP-43 in plasma EVs (for specificity and assay performance (Fig. 23, Table 4). As illustrated in Fig. 17, the majority of plasma EV TDP-43 stems from L1 CAM-positive EVs.

[0304] Plasma EV TDP-43 is increased in ALS and bvFTD

[0305] Plasma sEV TDP-43 levels were highest in ALS (median 45.45 pg ml-1, IQR [28.88-83.21]) compared with HC (9.47 pg mF1, IQR [7.63-13.33], P < 0.00001), bvFTD (31.25 pg ml’1, IQR [14.45-41.09]) and PSP (9.09 pg ml’1, IQR [7.73-13.27], P < 0.00001) (Fig. 3a (sEV) and Fig. 24a). Plasma sEV TDP-43 distinguished ALS from HC, PSP and bvFTD with AUC values of 0.99, Cl [0.97-1.00]; 0.99, Cl [0.98-1.00]; and 0.91 , Cl [0.88-0.94] (Fig. 3b-d). Similar results were obtained for plasma mEV TDP-43 concentrations and AUC values (Fig. 24a-d). No correlation was observed with age, sex or disease duration. Of note, plasma TDP-43 levels did not differ between the diagnostic groups, highlighting the importance of EV analysis (Fig. 9).

[0306] In bvFTD, plasma EV TDP-43 levels partially overlapped with HC and PSP (low levels) and the ALS group (high levels), suggesting that high levels could indicate TDP-43 pathology in bvFTD. Plasma sEV TDP-43 distinguished bvFTD from HC, PSP and ALS (AUC: bvFTD versus HC 0.85, Cl [0.82-0.90]; versus PSP 0.93, Cl [0.86-0.89]; versus ALS 0.91 , Cl [0.0.88-0.94]) (Fig. 3d-f (sEV); Fig. 24d-f (mEV)). Of note, plasma EV TDP-43-based AUC values exceeded plasma NfL- based AUC values (plasma NfL: ALS versus HC 0.83, Cl [0.77-0.88]; versus PSP 0.62, Cl [0.56- 0.67]; versus bvFTD 0.61 , Cl [055-0.66]; bvFTD versus HC 0.73, Cl [0.71-0.75]; versus PSP 0.63, Cl [0.61-0.71]; P < 0.0001 for all comparisons) (Fig. 3b-f (sEV), Fig. 24b-f).

[0307] Plasma EV TDP-43 correlates with disease severity

[0308] Plasma EV TDP-43 levels were highly correlated with plasma NfL concentrations in ALS and bvFTD (ALS sEV: r= 0.67, P < 0.0001 ; bvFTD sEV: r = 0.42, P < 0.0001 ; Fig. 8c, d (sEV); Fig. 24g, h (mEV)). In ALS, higher plasma EV TDP-43 levels were associated with worse cognitive performance and disease severity (MMSE, Edinburgh Cognitive and Behavioral ALS Screen total score, ALS Functional Rating Scale (ALS-FRS)) (Fig. 3g, h (sEV),). In bvFTD, plasma EV TDP-43 concentrations correlated with cognitive impairment, impaired functional activities, increased symptom severity, more severe psychiatric and behavior symptoms (MMSE, MoCA, FAQ, CDR- SB, CDR plus NACC FTLD, NPI-Q, CBI-M) (Fig. 3i,j (sEV),. Plasma EV TDP-43 levels correlated with CSF EV TDP-43 in the ALS group (Fig. 25).

[0309] Plasma EV TDP-43 levels in pathology-confirmed cases

[0310] We next compared plasma EV TDP-43 levels of confirmed TDP-43, tau or non-TDP-43 / non-tau pathology cases stratified by clinical diagnosis (Fig. 3k) and independent of clinical diagnosis (Fig. 3I). In the TDP pathology cases, EV TDP-43 was increased compared with HC (median sEV: 63.95 pg ml"1, IQR [42.89-86.63], P < 0.0001), PSP / GGT-type tau (median sEV:

[0311] 2.85 pg ml"1, IQR [2.10-3.52], P < 0.00001), genetic MAPT (median sEV: 2.86 pg ml"1, IQR [2.53- 3.02], P < 0.00001) and the non-TDP-43 / non-tau pathology group (median sEV: 11 .35 pg ml-1, IQR [10.62-12.05], P < 0.00001) (Fig. 3i; see Fig. 26a, b for mEV data). In bvFTD with confirmed TDP-43 pathology, plasma EV TDP-43 levels were higher compared with bvFTD with MAPT mutations (bvFTD with TDP-43 pathology median sEV TDP-43: 36.15 pg ml-1, IQR [4.52-52.65]; bvFTD with MAPT mutations median sEV TDP-43: 2.86 pg ml"1, IQR [2.53-3.02], P < 0.0001). EV TDP-43 levels in PSP / GGT-type tau pathology were comparable with non-TDP-43 / non-tau and HC groups (P > 0.05) (Fig. 3I; Fig. 26b). Surprisingly, VCP and TBK1 mutation carriers showed low levels of EV TDP-43, although both mutations had been linked to TDP-43 pathology before4 (7,48).

[0312] Plasma EV tau ratio and TDP-43 aid the diagnosis of FTD and ALS

[0313] In bvFTD, plasma EV TDP-43 concentrations were inversely correlated with EV 3R / 4R tau ratios (sEV: r= -0.496, P < 0.0001 ; Fig. 27a, b), indicating that high TDP-43 levels are associated with low tau ratios and vice versa. A plot of plasma sEV TDP-43 concentrations versus sEV 3R / 4R tau ratios without genetically and neuropathologically confirmed cases revealed a clear separation of bvFTD cases into two subgroups (Fig. 4a). One of the two bvFTD subgroups, characterized by a low EV tau ratio and high EV TDP-43 levels, overlapped with ALS, whereas the other was characterized by high EV 3R / 4R tau ratios but low TDP-43 levels (putative FTLD-TDP and FTLD- tau groups) (Fig. 4a (subcohort 2) and Extended Data Fig. 4 (bvFTD cases only)). PSP and HC groups formed separate clusters.

[0314] We next added pathology-confirmed cases to the graph (Fig. 4b). PSP / GGT-type tau pathology cases formed a cluster characterized by low TDP-43 and 3R / 4R tau ratios. The HC group and all non-TDP-43 / non-tau cases grouped together, consistent with the absence of TDP-43 and tau pathology. TDP-43-confirmed pathology cases were found in the cluster of ALS and TDP-43 high bvFTD cases. By contrast, bvFTD cases with confirmed MAPT pathology fell into the bvFTD group with high sEV tau ratios.

[0315] We applied a mixture modeling approach to sEV 3R / 4R tau and sEV TDP-43 data to obtain cutoff values of 0.77 and 1.27 for 3R / 4R tau, and 13.87 pg ml-1and 56.18 pg ml-1for TDP-43 (Fig. 4, Fig. 28).

[0316] Low plasma sEV 3R / 4R tau ratios (<0.77) discriminated clinical PSP cases form all other individuals in subcohort 2 (sensitivity: 93.25%, Cl [88.25-96.58%]; specificity: 95.25%, Cl [92.68- 97.12%]) as well as PSP / GGT-type tau pathology cases from other pathology-confirmed cases (sensitivity: 100%, Cl [39.76-100%]; specificity: 100%, Cl [93.94-100%]). High plasma sEV 3R / 4R tau ratios (>1.27) were found in 38.55% of clinical bvFTD cases. All MAPT mutation carriers, but no other patients with confirmed pathology, fell into the high plasma sEV tau ratio category (sensitivity: 100%, Cl [29.24-100%]; specificity: 100%, Cl [94.04-100%]). Importantly, all but one of the remaining clinical bvFTD patients (61.45%) showed tau ratios below the upper cut-off (<1 .27) but elevated TDP-43 levels (>13.87 pg ml-1), suggesting that sEV measurements can distinguish two separate subgroups among bvFTD patients. TDP-43 pathology cases mapped to the TDP-43 high bvFTD (putative FTLD-TDP) and the ALS group, and were detected among all individuals with a genetically or neuropathologically proven diagnosis with a sensitivity of 88.00%, Cl [76.13-95.67%] and a specificity of 100%, Cl [75.29- 100%] using the cut-off for at least mildly increased TDP-43 levels (>13.87 pg ml-1 ) (Fig. 4b). ALS cases with symptoms overlapping with bvFTD showed elevated plasma sEV TDP-43 levels (Fig. 4c). Together, our data suggest that a combination of plasma EV TDP-43 and 3R / 4R tau may distinguish FTLD-tau from FTLD-TDP.

[0317] Sant Pau validation cohort

[0318] We validated our findings in samples from the independent Sant Pau cohort (49) (ALS (n = 65), ALS-FTD (n = 58), bvFTD (n = 50), FTD mutation carriers (n = 23), PSP (n = 41) and HC (n = 50); see Table 3 for patient demographics).

[0319] Table 3: Demographic and Clinical Characteristics of All Patients in Sant Pau cohort.

[0320]

[0321] Plasma EV tau ratios are high in bvFTD and low in PSP

[0322] Similar to our findings from DESCRIBE, tau ratios were lowest in PSP (median sEV 3R / 4R tau ratio 0.38, IQR [0.33-0.50]), compared with all other groups (median sEV HC 1.02, IQR [0.96- 1.06], PSP versus HC P < 0.00001 ; ALS 1 .02, IQR [0.92-1.11], PSP versus ALS P < 0.00001 ; ALS-FTD 0.95, IQR [0.84-1 .00], PSP versus ALS-FTD P < 0.00001 ; bvFTD 1 .34, IQR [1.17- 2.34], PSP versus bvFTD P < 0.00001) and highest in bvFTD, median sEV bvFTD versus all other diagnostic groups P < 0.00001) (Fig. 5a; Extended Data Table 3 (sEV), Fig. 29a; Extended Data Table 3 (mEV)). No correlations of EV tau ratios with age, sex and disease duration were found. Approximately half of the bvFTD samples were characterized by high EV tau ratios, indicating tau pathology, whereas the other half were in the range observed for HC, ALS and ALS-FTD. We confirmed the feasibility of using plasma EV tau ratio as a diagnostic marker for different tauopathies by ROC analysis (sEV 3R / 4R tau ratio: PSP versus HC (AUC 1 .00, Cl [0.960-1 .000]), PSP versus ALS (AUC 0.99, Cl [0.962-1 .000]), PSP versus ALS-FTD (AUC 0.98, Cl [0.960-1.000]) and PSP versus bvFTD (AUC 1.00, Cl [0.969-1.000]); bvFTD versus HC (AUC 0.95, Cl [0.905-0.985]) and bvFTD versus ALS (AUC 0.90, Cl [0.845-0.948])) (Fig. 11a-g).

[0323] Sant Pau cohort samples included 34 genetically confirmed cases, 27 with TDP-43 (GRN n = 6, C9orf72 n = 16, TARDBP n = 1 , VCP n = 1 and TBK1 n = 3) and 7 with neither TDP-43 nor tau pathology (SOD1 n = 4 and FL / S n = 3). Consistent with the absence of tau pathology, plasma EV 3R / 4R tau ratios of all genetically confirmed cases were in the range of HC, ALS and ALS-FTD (Fig. 5b, c; Fig. 35a, b) (HC: median sEV 1.02, IQR [0.96-1.06]; TDP-43 pathology group: median sEV 1.15, IQR [1.07-1.23], versus HC P > 0.9999; non-TDP-43 / non-tau group: median sEV 0.92, IQR [0.84-1.15], versus HC P > 0.9999).

[0324] Plasma EV tau ratios correlate with disease severity

[0325] Plasma EV 3R / 4R tau ratios correlated with plasma NfL and clinical measures of disease severity in bvFTD and inversely in PSP (Fig. 5d-g (sEV)).

[0326] High plasma EV TDP-43 in ALS, ALS-FTD and a subset of bvFTD As in DESCRIBE subcohort 2, plasma EV TDP-43 levels were increased in patients with ALS (median sEV TDP-43: 45.60 pg ml-1, IQR [31 .55-64.45]) compared with HC (median sEV TDP- 43: 10.41 pg ml-1, IQR [8.50-14.65], P < 0.00001), in ALS-FTD (median sEV TDP-43: 52.40 pg ml-1, IQR [39.18-73.43], P < 0.00001 compared with HC) and in bvFTD (median sEV TDP-43: 24.15 pg ml"1, IQR [11 .13-40.55], P < 0.00001 compared with HC) (Fig. 5h (sEV), Fig. 32a; Extended Data Table 3 (mEV)). PSP EV TDP-43 levels were comparable with HC (median sEV TDP-43: 10.20 pg mF1, IQR [8.30-12.35], P > 0.9999). Plasma sEV TDP-43 distinguished ALS from HC, PSP and bvFTD with AUC values of 0.94, Cl [0.892-0.981], 0.96, Cl [0.910-0.991] and 0.76, Cl [0.687-0.832], and ALS-FTD from HC, PSP and bvFTD groups (AUC 0.98, Cl [0.946-0.999], 0.99, Cl [0.955-1.000] and 0.82, Cl [0.745-0.881]) (Fig. 32a-g (sEV), ).

[0327] Genetic cases linked to TDP-43 pathology were characterized by high EV TDP-43 levels (median sEV TDP-43: 55.0 pg ml-1, IQR [35.0-66.4]), with the exception of VCP and TBK1 mutations similar to what we observed in the DESCRIBE cohort. Genetically confirmed cases, neither linked to TDP-43 nor tau, displayed low plasma EV TDP-43 levels (median sEV TDP-43: 12.7 pg ml-1, IQR [11.3-15.7]), comparable to HC and PSP (HC median sEV TDP-43: 10.41 pg ml"1, IQR [8.50-14.65]; PSP median sEV TDP-43: 10.20 pg mF1, IQR [8.30-12.35]) (Fig. 5i,j and Fig. 32a, b).

[0328] Plasma EV TDP-43 discriminated bvFTD cases from HC, PSP, ALS and ALS-FTD (AUC sEV: bvFTD versus HC 0.87, Cl [0.803-0.926]; versus PSP 0.91 , Cl [0.851-0.959]; versus ALS 0.76, Cl [0.687-0.832]; versus ALS-FTD 0.82, Cl [0.745-0.881]) (Fig. 12i). Comparable with our results from DESCRIBE, plasma EV TDP-43-based AUCs performed superior to NfL for bvFTD versus HC and PSP (plasma NfL AUCs: bvFTD versus HC 0.78, Cl [0.734-0.842]; versus PSP 0.71 , Cl [0.689-0.789]; P < 0.0001 for all AUC comparisons) (Fig. 13a,b (sEV), Fig. 36i,j). NfL measurements were not available for ALS and ALS-FTD in the Sant Pau cohort.

[0329] Plasma EV TDP-43 correlates with disease severity

[0330] Plasma EV TDP-43 levels correlated highly with plasma NfL concentrations in bvFTD (sEV: r= 0.513, P < 0.0001 ; mEV: r= 0.465, P < 0.0001) (Extended Data Fig. 2e-g (sEV); Fig. 33k (mEV)). In ALS and ALS-FTD, higher plasma EV TDP-43 levels were associated with increased disease severity (ALS-FRS, time since diagnosis, MMSE; Fig. 5k-n (sEV)).

[0331] In bvFTD, plasma EV TDP-43 concentrations correlated with cognitive impairment, increased symptom severity and more severe psychiatric symptoms (Fig. 5f,g (sEV), Fig. 26p,r (mEV)).

[0332] Determination of cut-off levels

[0333] Plasma EV TDP-43 concentrations in bvFTD were inversely correlated to EV 3R / 4R tau ratios (sEV: r= -0.714, P < 0.0001 ; mEV: r = -0.617, P < 0.0001 ; Fig. 33a, b). A plot of plasma sEV TDP- 43 concentrations versus sEV 3R / 4R tau ratios without genetic cases showed a similar distribution of the diagnostic groups as observed for DESCRIBE subcohort 2 and a separation of putative bvFTD TDP and tau subgroups (Fig. 6a). The TDP-43 high bvFTD subgroup overlapped with the ALS group (Fig. 6a), cases with confirmed TDP-43 pathology (Fig. 6b) and the ALS-FTD group (Fig. 6c). Cases with confirmed non-tau / non-TDP-43 pathology overlapped with the HC group (Fig. 6b). Cut-offs were defined by mixture modeling (Fig. 34), excluding genetically confirmed cases for subsequent testing of cut-offs (sEV 3R / 4R tau ratio: 0.78 and 1 .28; sEV TDP-43: 17.85 pg ml-1and 57.34 pg ml-1; Fig. 6d-f, black lines). Cut-offs were very close to those in DESCRIBE subcohort 2. sEV 3R / 4R tau ratio: 0.77 and 1 .28; sEV TDP-43 cut-offs: 13.87 pg ml-1and 56.18 pg ml-1.

[0334] The Sant Pau TDP-43 cut-off (>17.85 pg ml-1) detected confirmed TDP-43 pathology cases among all individuals with a genetically proven diagnosis with a sensitivity of 88.89%, Cl [70.84- 97.65%] and a specificity of 85.71 %, Cl [42.13-99.64%].

[0335] Low plasma sEV 3R / 4R tau ratios (<0.78, Sant Pau cohort cut-off) discriminated PSP cases form all other diagnoses (sensitivity: 100%, Cl [91.40-100%]; specificity: 94.00%, Cl [90.30-96.60%]). Similar results were obtained when applying the DESCRIBE cohort cut-off to Sant Pau data (sensitivity: 100%, Cl [91.40-100%]; specificity: 94.94%, Cl [91.77-97.50%]).

[0336] Fifty-eight percent of sporadic bvFTD patients in the Sant Pau cohort showed high plasma sEV 3R / 4R tau ratios (>1.28), indicative of tau pathology. Of those with tau ratios below this cut-off (42%), all but one showed EV TDP-43 levels above the TDP cut-off, further supporting that sEV tau ratio and TDP-43 measurements can distinguish two separate bvFTD subgroups.

[0337] The Sant Pau EV TDP-43 cut-off identified patients with sporadic ALS and ALS-FTD with high sensitivity and specificity versus HC and PSP (ALS sensitivity: 86.15%, Cl [75.34-93.47%]; specificity: 100%, Cl [96.03-100%]; ALS-FTD sensitivity: 96.55%, Cl [88.90-99.58%]; specificity: 100%, Cl [96.03-100%]). Applying the DESCRIBE subcohort 2 cut-off values to Sant Pau resulted in a sensitivity of 89.23% (Cl [79.06-95.56%]) and a specificity of 90.11% (Cl [82. OS- 95.38%]) for ALS, and a sensitivity of 100% (Cl [93.84-100%]) and specificity of 90.11% (Cl [82.05-95.38%]) for ALS-FTD. Together, these data indicate that cut-offs are nearly interchangeable between the two cohorts.

[0338] Gaussian Mixture Modelling

[0339] Mixture modeling has been successfully used in research on Alzheimer’s disease to derive cutoffs for amyloid pathology in a setting where a gold standard neuropathological outcome has been unavailable (98). Cut-offs were derived in a sample excluding neuropathologically or genetically confirmed cases which was subsequently used for validating cut-offs. In line with visual inspection (Fig.28), bootstrapping suggested that the distributions of sEV 3R / 4R Tau ratios and sEV TDP-43 were best approximated by three normal distributions since it showed a significantly better fit to the data compared to a single Gaussian distribution (plasma sEV 3R / 4R tau ratio: p=0.001 ; sEV TDP-43: p=0.01) or two Gaussians (plasma sEV 3R / 4R tau ratio: p=0.001 ; sEV TDP-43: p=0.01) but was not further improved by modeling four Gaussian distributions (plasma sEV 3R / 4R tau ratio: p=0.06; sEV 2 TDP-43: p=0.2). Cut-offs were derived based on the intersection of the middle Gaussian distribution 3 with the two more extreme distributions.

[0340] Differences in group sizes (DESCRIBE cohort)

[0341] Group sizes in DESCRIBE subcohorts 1 and 2 were imbalanced which could have impacted the precision of the AUC estimates. We compared AUC results and 95% Cl intervals between DESCRIBE subcohorts and the Sant Pau cohort which has more balanced diagnostic group sample sizes. Even based on the lower bounds of the 95% Cl intervals, plasma EV Tau ratio and plasma E TDP-43 levels showed a good discriminative performance. Furthermore, in the Sant Pau cohort, we obtained AUCs and Cis comparable to DESCRIBE subcohort 2. In addition, we calculated precision recall curves and area under the precision recall curve (AUPRC) for all cohorts, since AUPRC reflect imbalanced group sizes. AUPRC values were above 0.8 for plasma sEV Tau ratios and TDP-43 levels in both DESCRIBE subcohorts, further supporting the very good diagnostic performance of both markers.

[0342] Discussion

[0343] Our study in a large cohort of 704 patients, including 37 genetically and 31 pathologically confirmed samples as well as in an independent validation cohort of 287 patients with 34 genetically confirmed cases, shows that plasma EVs inform about tau and TDP-43 pathology in bvFTD, and can additionally discriminate patients with ALS and PSP from healthy and neurodegenerative disease controls with high diagnostic accuracy (AUC > 0.91 ).

[0344] High plasma EV 3R / 4R tau ratios in bvFTD were characterized by low EV TDP-43 levels and both markers separated bvFTD into two distinct groups, which can be discriminated based on cut-off values derived from mixture modeling. Plasma EV 3R / 4R tau ratios in confirmed cases with TDP- 43 pathology displayed low 3R / 4R tau ratios, comparable with values in the HC group, but high TDP-43 levels. By contrast, MAPT mutation carriers showed high EV 3R / 4R tau ratios and mapped to the bvFTD tau subgroup. Clinically diagnosed PSP, including neuropathologically proven cases of PSP-type tauopathy, segregated into a third group, characterized by a decreased EV 3R / 4R tau ratio and EV TDP-43 levels in the range of HC.

[0345] It is unclear why the EV 3R / 4R tau ratio is low in PSP but high in bvFTD cases with FTLD-tau. 4R tau predominance may explain low 3R / 4R tau ratios in PSP; however, all three MAPT mutation carriers in DESCRIBE showed high 3R / 4R tau ratios, despite being associated with 4R tau pathology. It is possible that different ‘strains’, posttranslational modifications or regional and cellular distribution of pathology may result in differential sorting of 3R and 4R tau isoforms to EVs in different tauopathies (50).

[0346] Plasma EV TDP-43 levels distinguished ALS from all other groups with high diagnostic accuracy (AUC > 0.91 versus HC, PSP, bvFTD in DESCRIBE; AUC > 0.94 versus HC, PSP; and AUC > 0.76 versus bvFTD in the Sant Pau cohort). Cases with confirmed TDP-43 pathology were characterized by high EV TDP-43 levels, whereas ALS cases with mutations that are not linked to TDP-43 pathology displayed low EV TDP-43 concentrations, comparable with HC.

[0347] In PSP and bvFTD, plasma EV tau ratios correlated with NfL, clinical, cognitive and behavior scales reflecting disease pathology, similar to plasma EV TDP-43 in ALS and bvFTD, including trial-relevant scales such as ALS-FRS-revised and CDR-SB. Plasma EV 3R / 4R tau and TDP-43 thus allow to mirror disease progression and could, be used as a progression and surrogate marker for clinical studies.

[0348] EVs can pass the blood-brain barrier (55) but it is not known to what extent plasma EV TDP-43 or tau stem from the CNS because both are expressed in peripheral tissue (27,56,57). The correlation of CSF with plasma EV TDP-43 in ALS supports the notion that plasma EV TDP-43 may reflect CNS pathology. Plasma EV tau and TDP-43 are almost exclusively found in L1 CAM- positive EVs, which could further supports a brain origin (30).

[0349] Strengths of this study are the large numbers of patient samples, 991 in total, and the independent validation in another cohort, containing altogether 97 genetically and / or neuropathologically confirmed samples. To the knowledge of the inventors this is the first study, demonstrating a blood-based, and therefore low invasive and easily accessible, fluid biomarker, which allows to distinguish FTLD-TDP from FTLD-tau, and to detect ALS and PSP. Cut-off values determined by Gaussian mixture modeling were remarkably transferable between the different cohorts, particularly tau ratio cut-offs. In summary, with EV 3R / 4R tau and EV TDP-43 we describe the first marker that specifically detects underlying molecular pathology in patients with ALS, FTD and FTD spectrum disorders, whereas previously suggested biomarkers reflect downstream effects such as neurodegeneration (NfL) (61 ,62) or inflammation (glial fibrillary acidic protein) (63,64).

[0350] REFERENCES

[0351] 1. Abramzon, Y. A., Fratta, P., Traynor, B. J. & Chia, R. The overlapping genetics of amyotrophic lateral sclerosis and frontotemporal dementia. Front. Neurosci. 14, 42 (2020).

[0352] 2. Chare, L. et al. New criteria for frontotemporal dementia syndromes: clinical and pathological diagnostic implications. J. Neurol. Neurosurg. Psychiatry 85, 865-870 (2014).

[0353] 3. Mann, D. M. A. & Snowden, J. S. Frontotemporal lobar degeneration: pathogenesis, pathology and pathways to phenotype. Brain Pathol. 27, 723-736 (2017).

[0354] 4. Mandelkow, E. & Mandelkow, E. M. Microtubules and microtubule-associated proteins. Curr. Opin. Cell Biol. 7, 72-81 (1995).

[0355] 5. Mackenzie, I. R. & Neumann, M. Molecular neuropathology of frontotemporal dementia: insights into disease mechanisms from postmortem studies. J. Neurochem. 138, 54-70 (2016).

[0356] 6. Richards, D., Morren, J. A. & Pioro, E. P. Time to diagnosis and factors affecting diagnostic delay in amyotrophic lateral sclerosis. J. Neurol. Sci. 417, 117054 (2020).

[0357] 7. Mamarabadi, M., Razjouyan, H. & Golbe, L. I. Is the latency from progressive supranuclear palsy onset to diagnosis improving? Mov. Disord. Clin. Pract. 5, 603-606 (2018).

[0358] 8. Tsoukra, P. et al. The diagnostic challenge of young-onset dementia syndromes and primary psychiatric diseases: results from a retrospective 20-year cross-sectional study. J. Neuropsychiatry Clin. Neurosci. 34, 44-52 (2022).

[0359] 9. Cousins, K. A. Q. et al. Distinguishing frontotemporal lobar degeneration tau from TDP-43 using plasma biomarkers. JAMA Neurol. 79, 1155-1164 (2022).

[0360] 10. Suarez-Calvet, M. et al. Plasma phosphorylated TDP-43 levels are elevated in patients with frontotemporal dementia carrying a C9orf72 repeat expansion or a GRN mutation. J. Neurol. Neurosurg. Psychiatry 85, 684-691 (2014).

[0361] 11. Ren, Y. et al. TDP-43 and phosphorylated TDP-43 levels in paired plasma and CSF samples in amyotrophic lateral sclerosis. Front. Neurol. 12, 663637 (2021 ).

[0362] 12. Katisko, K. et al. Serum total TDP-43 levels are decreased in frontotemporal dementia patients with C9orf72 repeat expansion or concomitant motoneuron disease phenotype. Alzheimers Res. Ther. 14, 151 (2022).

[0363] 13. Scialo, C. et al. TDP-43 real-time quaking induced conversion reaction optimization and detection of seeding activity in CSF of amyotrophic lateral sclerosis and frontotemporal dementia patients. Brain Commun. 2, fcaa142 (2020).

[0364] 14. Beyer, L. et al. TDP-43 as structure-based biomarker in amyotrophic lateral sclerosis. Ann. Clin. Transl. Neurol. 8, 271-277 (2021 ).

[0365] 15. Hu, W. T. et al. Reduced CSF p-Tau181 to Tau ratio is a biomarker for FTLD-TDP. Neurology 81 , 1945-1952 (2013).

[0366] 16. Irwin, K.E. et al. A fluid biomarker reveals loss of TDP-43 splicing repression in presymptomatic ALS- FTD. Nat. Med. 30, 382-393 (2024).

[0367] 17. Luk, C. et al. Development and assessment of sensitive immuno-PCR assays for the quantification of cerebrospinal fluid three- and four-repeat tau isoforms in tauopathies. J. Neurochem. 123, 396-405 (2012).

[0368] 18. Meredith, J. E. Jr et al. Characterization of novel CSF Tau and ptau biomarkers for Alzheimer’s disease. PLoS ONE 8, e76523 (2013).

[0369] 19. Horie, K. et al. CSF tau microtubule-binding region identifies pathological changes in primary tauopathies. Nat. Med. 28, 2547-2554 (2022). 20. van Niel, G., D’Angelo, G. & Raposo, G. Shedding light on the cell biology of extracellular vesicles. Nat. Rev. Mol. Cell Biol. 19, 213-228 (2018).

[0370] 21. Perez, M., Avila, J. & Hernandez, F. Propagation of tau via extracellular vesicles. Front. Neurosci. 13, 698 (2019).

[0371] 22. Leroux, E. et al. Extracellular vesicles: major actors of heterogeneity in tau spreading among human tauopathies. Mol. Ther. 30, 782-797 (2022).

[0372] 23. Wang, Y. et al. The release and trans-synaptic transmission of Tau via exosomes. Mol. Neurodegener. 12, 5 (2017).

[0373] 24. Asai, H. et al. Depletion of microglia and inhibition of exosome synthesis halt tau propagation. Nat. Neurosci. 18, 1584-1593 (2015).

[0374] 25. Iguchi, Y. et al. Exosome secretion is a key pathway for clearance of pathological TDP-43. Brain 139, 3187-3201 (2016).

[0375] 26. Stuendl, A. et al. Alpha-synuclein in plasma-derived extracellular vesicles is a potential biomarker of Parkinson’s disease. Mov. Disord. 36, 2508-2518 (2021 ).

[0376] 27. Lionnet, A. et al. Characterisation of tau in the human and rodent enteric nervous system under physiological conditions and in tauopathy. Acta Neuropathol. Commun. 6, 65 (2018).

[0377] 28. Mukaetova-Ladinska, E. B. et al. Platelet Tau protein as a potential peripheral biomarker in Alzheimer’s disease: an explorative study. Curr. Alzheimer Res. 15, 800-808 (2018).

[0378] 29. Kvetnoy, I. M. et al. Tau-protein expression in human blood lymphocytes: a promising marker and suitable sample for life-time diagnosis of Alzheimer’s disease. Neuro. Endocrinol. Lett. 21 , 313-318 (2000).

[0379] 30. Norman, M. et al. L1CAM is not associated with extracellular vesicles in human cerebrospinal fluid or plasma. Nat. Methods 18, 631-634 (2021 ).

[0380] 31. Boyarko, B. & Hook, V. Human tau isoforms and proteolysis for production of toxic tau fragments in neurodegeneration. Front. Neurosci. 15, 702788 (2021 ).

[0381] 32. Neumann, M. et al. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130-133 (2006).

[0382] 33. Folstein, M. F., Folstein, S. E. & McHugh, P. R. ‘Mini-Mental State’. A practical method for grading the cognitive state of patients for the clinician. J. Psychiatr. Res. 12, 189-198 (1975).

[0383] 34. Nasreddine, Z. S. et al. The Montreal Cognitive Assessment, MoCA: a brief screening tool for mild cognitive impairment. J. Am. Geriatr. Soc. 53, 695-699 (2005).

[0384] 35. Golbe, L. I. & Ohman-Strickland, P. A. A clinical rating scale for progressive supranuclear palsy. Brain 130, 1552-1565 (2007).

[0385] 36. Piot, I. et al. The Progressive Supranuclear Palsy Clinical Deficits Scale. Mov. Disord. 35, 650-661 (2020).

[0386] 37. Schwab R. S. & England, A. Projection technique for evaluating surgery in Parkinson’s disease, in Third Symposium on Parkinson’s Disease (eds Billingham, F. H. & Donaldson, M. C.) 152-157 (Churchill, 1969).

[0387] 38. Guy, W. in ECDEU Assessment Manual for Psychopharmacology — Revised. DHEW Publ No ADM 76- 338. (U.S. Dept, of Health, Education, and Welfare, Public Health Service, Alcohol, Drug Abuse, and Mental Health Administration, National Institute of Mental Health, Psychopharmacology Research Branch, Division of Extramural Research Programs, 1976).

[0388] 39. Goetz, C. G. et al. Movement Disorder Society-sponsored revision of the Unified Parkinson’s Disease Rating Scale (MDS-UPDRS): process, format, and clinimetric testing plan. Mov. Disord. 22, 41-47 (2007).

[0389] 40. Starkstein, S. E. et al. Reliability, validity, and clinical correlates of apathy in Parkinson’s disease. J. Neuropsychiatry Clin. Neurosci. 4, 134-139 (1992).

[0390] 41. Schrag, A. et al. Measuring quality of life in PSP: the PSP-QoL. Neurology 67, 39-44 (2006). 42. Pfeffer, R. I., Kurosaki, T. T., Harrah, C. H. Jr., Chance, J. M. & Filos, S. Measurement of functional activities in older adults in the community. J. Gerontol. 37, 323-329 (1982).

[0391] 43. Hughes, C. P., Berg, L, Danziger, W. L, Coben, L. A. & Martin, R. L. A new clinical scale for the staging of dementia. Br. J. Psychiatry 140, 566-572 (1982).

[0392] 44. Knopman, D. S., Weintraub, S. & Pankratz, V. S. Language and behavior domains enhance the value of the Clinical Dementia Rating Scale. Alzheimers Dement. 7, 293-299 (2011 ).

[0393] 45. Cummings, J. L. et al. The Neuropsychiatric Inventory: comprehensive assessment of psychopathology in dementia. Neurology 44, 2308-2314 (1994).

[0394] 46. Wear, H. J. et al. The Cambridge Behavioural Inventory revised. Dement. Neuropsychol. 2, 102-107 (2008).

[0395] 47. Neumann, M. et al. TDP-43 in the ubiquitin pathology of frontotemporal dementia with VCP gene mutations. J. Neuropathol. Exp. Neurol. 66, 152-157 (2007).

[0396] 48. Gijselinck, I. et al. Loss of TBK1 is a frequent cause of frontotemporal dementia in a Belgian cohort. Neurology 85, 2116-2125 (2015).

[0397] 49. Alcolea, D. et al. The Sant Pau Initiative on Neurodegeneration (SPIN) cohort: a data set for biomarker discovery and validation in neurodegenerative disorders. Alzheimers Dement. (N Y) 5, 597-609 (2019).

[0398] 50. Vaquer-Alicea, J., Diamond, M. I. & Joachimiak, L. A. Tau strains shape disease. Acta Neuropathol. 142, 57-71 (2021 ).

[0399] 51. Ritz, D. et al. Endolysosomal sorting of ubiquitylated caveolin-1 is regulated by VCP and UBXD1 and impaired by VCP disease mutations. Nat. Cell Biol. 13, 1116-1123 (2011 ).

[0400] 52. Zhang, Y. et al. Cerebellar Kv3.3 potassium channels activate TANK-binding kinase 1 to regulate trafficking of the cell survival protein Hax-1. Nat. Commun. 12, 1731 (2021 ).

[0401] 53. Schwickart, M., Vainshtein, I., Lee, R., Schneider, A. & Liang, M. Interference in immunoassays to support therapeutic antibody development in preclinical and clinical studies. Bioanalysis 6, 1939-1951 (2014).

[0402] 54. O’Brien, K., Ughetto, S., Mahjoum, S., Nair, A. V. & Breakefield, X. O. Uptake, functionality, and re- release of extracellular vesicle-encapsulated cargo. Cell Rep. 39, 110651 (2022).

[0403] 55. Ramos-Zaldivar, H. M. et al. Extracellular vesicles through the blood-brain barrier: a review. Fluids Barriers CNS 19, 60 (2022).

[0404] 56. Riva, N. et al. Phosphorylated TDP-43 aggregates in peripheral motor nerves of patients with amyotrophic lateral sclerosis. Brain 145, 276-284 (2022).

[0405] 57. Wood, J. D. Enteric nervous system: neuropathic gastrointestinal motility. Dig. Dis. Sci. 61 , 1803-1816 (2016).

[0406] 58. James, B. D. et al. TDP-43 stage, mixed pathologies, and clinical Alzheimer’s-type dementia. Brain 139, 2983-2993 (2016).

[0407] 59. Nelson, P. T. et al. Frequency of LATE neuropathologic change across the spectrum of Alzheimer’s disease neuropathology: combined data from 13 community-based or population-based autopsy cohorts. Acta Neuropathol. 144, 27-44 (2022).

[0408] 60. Nelson, P. T. et al. Limbic-predominant age-related TDP-43 encephalopathy (LATE): consensus working group report. Brain 142, 1503-1527 (2019).

[0409] 61 . Rohrer, J. D. et al. Serum neurofilament light chain protein is a measure of disease intensity in frontotemporal dementia. Neurology 87, 1329-1336 (2016).

[0410] 62. Gendron, T. F. et al. Comprehensive cross-sectional and longitudinal analyses of plasma neurofilament light across FTD spectrum disorders. Cell Rep. Med. 3, 100607 (2022). 63. Katisko, K. et al. GFAP as a biomarker in frontotemporal dementia and primary psychiatric disorders: diagnostic and prognostic performance. J. Neurol. Neurosurg. Psychiatry 92, 1305-1312 (2021 ).

[0411] 64. Zhu, N. et al. Plasma glial fibrillary acidic protein and neurofilament light chain for the diagnostic and prognostic evaluation of frontotemporal dementia. Transl. Neurodegener. 10, 50 (2021 ).

[0412] 65. Jack, C. R. Jr et al. NIA-AA research framework: toward a biological definition of Alzheimer’s disease. Alzheimers Dement. 14, 535-562 (2018).

[0413] 66. Ludolph, A. et al. A revision of the El Escorial criteria - 2015. Amyotroph. Lateral Scler. Frontotemporal Degener. 16, 291-292 (2015).

[0414] 67. Cedarbaum, J. M. et al. The ALSFRS-R: a revised ALS functional rating scale that incorporates assessments of respiratory function. BDNF ALS Study Group (Phase III). J. Neurol. Sci. 169, 13-21 (1999).

[0415] 68. Abrahams, S., Newton, J., Niven, E., Foley, J. & Bak, T. H. Screening for cognition and behaviour changes in ALS. Amyotroph. Lateral Scler. Frontotemporal Degener. 15, 9-14 (2014).

[0416] 69. Strong, M. J. et al. Amyotrophic lateral sclerosis-frontotemporal spectrum disorder (ALS-FTSD): revised diagnostic criteria. Amyotroph. Lateral Scler. Frontotemporal Degener. 18, 153-174 (2017).

[0417] 70. Rascovsky, K. et al. Sensitivity of revised diagnostic criteria for the behavioural variant of frontotemporal dementia. Brain 134, 2456-2477 (2011 ).

[0418] 71. Lemos, R., Duro, D., Simoes, M. R. & Santana, I. The free and cued selective reminding test distinguishes frontotemporal dementia from Alzheimer’s disease. Arch. Clin. Neuropsychol. 29, 670-679 (2014).

[0419] 72. Welsh, K. A. et al. The Consortium to Establish a Registry for Alzheimer’s Disease (CERAD). Part V. A normative study of the neuropsychological battery. Neurology 44, 609-614 (1994).

[0420] 73. Bertoux, M. et al. Social cognition and emotional assessment differentiates frontotemporal dementia from depression. J. Neurol. Neurosurg. Psychiatry 83, 411-416 (2012).

[0421] 74. Scogin, F., Rohen, N. & Bailey, E. in Handbook of Psychological Assessment in Primary Care Settings (ed. Maruish M. E.) 491-508 (Erlbaum, 2000).

[0422] 75. Gorno-Tempini, M. L. et al. Classification of primary progressive aphasia and its variants. Neurology 76, 1006-1014 (2011 ).

[0423] 76. Bozeat, S., Lambon Ralph, M. A., Patterson, K., Garrard, P. & Hodges, J. R. Non-verbal semantic impairment in semantic dementia. Neuropsychologia 38, 1207-1215 (2000).

[0424] 77. Billette, O. V., Sajjadi, S. A., Patterson, K. & Nestor, P. J. SECT and MAST: new tests to assess grammatical abilities in primary progressive aphasia. Aphasiology 29, 1135-1151 (2015).

[0425] 78. Huber, W., Poeck, K., Weniger, D. & Willmes, K. Der Aachener Aphasie Test (AAT) (Hogrefe, 1983).

[0426] 79. Ziegler, W., Aichert, I., Staiger, A. & Schimeczek, M. HWL-kompakt. https: / / neurophonetik.de / sprechapraxie-wortlisten (2019).

[0427] 80. Hodges, J. R., Martinos, M., Woollams, A. M., Patterson, K. & Adlam, A. L. Repeat and point: differentiating semantic dementia from progressive non-fluent aphasia. Cortex 44, 1265-1270 (2008).

[0428] 81. Respondek, G. & Hoglinger, G. U. DescribePSP and ProPSP: German multicenter networks for standardized prospective collection of clinical data, imaging data, and biomaterials of patients with progressive supranuclear palsy. Front. Neurol. 12, 644064 (2021 ).

[0429] 82. Litvan, I. et al. Clinical research criteria for the diagnosis of progressive supranuclear palsy (Steele- Richardson-Olszewski syndrome): report of the NINDS-SPSP international workshop. Neurology 47, 1-9 (1996).

[0430] 83. Hoglinger, G. U. et al. Clinical diagnosis of progressive supranuclear palsy: The movement disorder society criteria. Mov. Disord. 32, 853-864 (2017). 84. Neumann, M. et al. Phosphorylation of S409 / 410 of TDP-43 is a consistent feature in all sporadic and familial forms of TDP-43 proteinopathies. Acta Neuropathol. 117, 137-149 (2009).

[0431] 85. Montine, T. J. et al. National Institute on Aging-Alzheimer’s Association guidelines for the neuropathologic assessment of Alzheimer’s disease: a practical approach. Acta Neuropathol. 123, 1-11 (2012).

[0432] 86. Attems, J. et al. Neuropathological consensus criteria for the evaluation of Lewy pathology in postmortem brains: a multi-centre study. Acta Neuropathol. 141 , 159-172 (2021 ).

[0433] 87. Mackenzie, I. R. et al. A harmonized classification system for FTLD-TDP pathology. Acta Neuropathol. 122, 111-113 (2011 ).

[0434] 88. Brooks, B. R., Miller, R. G., Swash, M., Munsat, T. L. & World Federation of Neurology Research Group on Motor Neuron Diseases El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph. Lateral Scler. Other Motor Neuron Disord. 1 , 293-299 (2000).

[0435] 89. Campos, T. S. et al. Spanish adaptation of the revised Amyotrophic Lateral Sclerosis Functional Rating Scale (ALSFRS-R). Amyotroph. Lateral Scler. 11 , 475-477 (2010).

[0436] 90. Eren, E. et al. Neuronal-derived EV biomarkers track cognitive decline in Alzheimer’s disease cells. Cells 11 , 436 (2022).

[0437] 91. Oender, D. et al. Evolution of clinical outcome measures and biomarkers in sporadic adult-onset degenerative ataxia. Mov. Disord. 38, 654-664 (2023).

[0438] 92. Hanley, J. A. & McNeil, B. J. A method of comparing the areas under receiver operating characteristic curves derived from the same cases. Radiology 148, 839-843 (1983).

[0439] 93. Boyd, K. et al. (eds) in ECML PKDD 2013, Part III, LNAI 8190, 451-466 (Springer, 2013).

[0440] 94. Barer, Y. et al. Epidemiology of progressive supranuclear Palsy: Real world data from the second largest health plan in Israel. Brain. Sci. 12, 1126 (2022).

[0441] 95. Brown, C. A., Lally, C., Kupelian, V. & Flanders, W. D. Estimated Prevalence and Incidence of Amyotrophic Lateral Sclerosis and SOD1 and C9orf72 genetic variants. Neuroepidemiology 55, 342-353 (2021 ).

[0442] 96. Onyike, C. U. & Diehl-Schmid, J. The epidemiology of frontotemporal dementia. Int Rev. Psychiatry 25, 130-137 (2013).

[0443] 97. Barthelemy, N. R., Horie, K., Sato, C. & Bateman, R. J. Blood plasma phosphorylated-tau isoforms track CNS change in Alzheimer's disease. J Exp Med 217 (2020).

[0444] 98. Bertens, D., Tijms, B. M., Scheltens, P., Teunissen, C. E. & Visser, P. J. Unbiased estimates of cerebrospinal fluid beta-amyloid 1-42 cutoffs in a large memory clinic population. Alzheimers Res Ther 9, 8 (2017).

[0445] 99. Stuendl, A. et al. alpha-Synuclein in Plasma-Derived Extracellular Vesicles Is a Potential Biomarker of Parkinson's Disease. Mov Disord 36, 2508-2518 (2021 ).

[0446] 100. Kawaguchi, T. et al. Changes to the TDP-43 and FUS Interactomes Induced by DNADamage. J Proteome Res 19, 360-370 (2020).

[0447] 101. Barthelemy, N. R. et al. Site-Specific Cerebrospinal Fluid Tau Hyperphosphorylationin Response to Alzheimer's Disease Brain Pathology: Not All Tau Phospho-Sites areHyperphosphorylated. J Alzheimers Dis 85, 415-429 (2022).

[0448] 102. Sato, C. et al. Tau Kinetics in Neurons and the Human Central Nervous System. Neuron 97, 1284-1298 e1287 (2018).

[0449] 103. Friedhoff, P., Schneider, A., Mandelkow, E. M. & Mandelkow, E. Rapid assembly of Alzheimer-like paired helical filaments from microtubule-associated protein tau monitored by fluorescence in solution. Biochemistry 37, 10223-10230 (1998). 104. Andreasson, U. et al. A Practical Guide to Immunoassay Method Validation. Front Neurol 6, 179 (2015).

[0450] 105. Cummings, J. L. et al. The Neuropsychiatric Inventory: comprehensive assessment of psychopathology in dementia. Neurology 44, 2308-2314 (1994).

[0451] 106. 10 Pfeffer, R. I., Kurosaki, T. T., Harrah, C. H., Jr., Chance, J. M. & Filos, S. Measurement of functional activities in older adults in the community. J Gerontol 37, 323-329 (1982).

[0452] 107. Golbe, L. I. The Medical Advisory Board of the Society for Progressive Supranuclear Palsy. A clinical rating scale and staging system for progressive supranuclear palsy. Neurology 48:A326. (1997).

[0453] 108. Goetz, C. G. et al. Movement Disorder Society-sponsored revision of the Unified Parkinson's Disease Rating Scale (MDS-UPDRS): Process, format, and clinimetric testing plan. Mov Disord 22, 41-47 (2007).

[0454] 109. Starkstein, S. E. et al. Reliability, validity, and clinical correlates of apathy in Parkinson's disease. J Neuropsychiatry Clin Neurosci 4, 134-139 (1992).

[0455] 110. Schrag, A. et al. Measuring quality of life in PSP: the PSP-QoL. Neurology 67, 39-44 (2006).

[0456] 111. Folstein, M. F., Folstein, S. E. & McHugh, P. R. "Mini-mental state". A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res 12, 189-198 (1975).

[0457] 112. Nasreddine, Z. S. et al. The Montreal Cognitive Assessment, MoCA: a brief screening tool for mild cognitive impairment. J Am Geriatr Soc 53, 695-699 (2005).

[0458] 113. Golbe, L. I. & Ohman-Strickland, P. A. A clinical rating scale for progressive supranuclear palsy. Brain 130, 1552-1565 (2007).

[0459] 114. Piot, I. et al. The Progressive Supranuclear Palsy Clinical Deficits Scale. Mov Disord 35, 650-661 (2020).

[0460] 115. Schwab RS, E. A. Projection technique for evaluating surgery in Parkinson's disease. . In: Billingham FH, Donaldson MC, editors. Third Symposium on Parkinson's Disease Edinburgh: Churchill Livingstone, 152-157 (1969).

[0461] 116. Guy, W. The clinical global impression scale. In: ECDEU Assessment Manual for Psychopharmacology - Revised (DHEW Publ No ADM 76-338). (1976).

[0462] 117. Hughes, C. P., Berg, L, Danziger, W. L, Coben, L. A. & Martin, R. L. A new clinical scale for the staging of dementia. Br J Psychiatry 140, 566-572 (1982).

[0463] 118. Knopman, D. S., Weintraub, S. & Pankratz, V. S. Language and behavior domains enhance the value of the clinical dementia rating scale. Alzheimers Dement 7, 293-299 (2011 ).

[0464] 119. Wear, H. J. et al. The Cambridge Behavioural Inventory revised. Dement Neuropsychol 2, 102-107 (2008).

Claims

CLAIMS1 . A method for diagnosis, disease monitoring and / or therapy guidance in a patient suspected of having a neurodegenerative disease of the Frontotemporal Dementia- Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), comprising a. providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, c. wherein the level of the one or more biomarkers is indicative of whether the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy.

2. The method according to claim 1 , wherein the one or more FTD-ALS-spectrum biomarkers is a protein that can form a pathological protein aggregate in neurons of subjects with a neurodegenerative disease of FTD-ALS-spectrum.

3. The method according to claim 1 or 2, wherein the one or more FTD-ALS-spectrum biomarkers is a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TAR DNA-binding protein 43 (TDP-43).

4. The method according to any one of the preceding claims, wherein the neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau- proteinopathy is progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), non-fluent variant primary progressive aphasia (nfvPPA) comprising a Tau proteinopathy and / or behavioral variant FTD comprising a Tau proteinopathy (bvFTD), and the neurodegenerative disease of the FTD-ALS-spectrum associated with a TPD-43- proteinopathy is amyotrophic lateral sclerosis (ALS), FTD-ALS, bvFTD comprising a TPD- 43 proteinopathy, semantic variant primary progressive aphasia (svPPA), non-fluent variant primary progressive aphasia (nfvPPA) comprising a TPD-43 proteinopathy, TDP- 43 co-pathology in Alzheimer’s disease and / or FTD with motor neuron disease (FTD- MND).

5. The method according to any one of the preceding claims, wherein a. a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample lower than a 3R / 4R- Tau-ratio in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has PSP or CBD, and b. a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample higher than a 3R / 4R-Tau-ratio in in extracellular vesicles in a control sample of a healthyindividual, indicates that said patient has bvFTD associated with a Tau- proteinopathy.

6. The method according to any one of the preceding claims, wherein a level of TDP-43 in the extracellular vesicles in said sample higher than a level of TDP-43 in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has ALS and / or bvFTD associated with a TPD-43-proteinopathy.

7. The method according to any one of the preceding claims, wherein a. a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample higher than a 3R / 4R-Tau-ratio in in extracellular vesicles in a control sample of a healthy individual, and b. a level of TDP-43 in the extracellular vesicles in said sample equal toTPD-43 in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has bvFTD associated with a Tau-proteinopathy.

8. The method according to any one of the preceding claims, wherein a. a 3R / 4R-Tau-ratio in said extracellular vesicles in said sample in essence equal to or not diverging significantly from a 3R / 4R-Tau-ratio in extracellular vesicles in a control sample of a healthy individual, and b. a level of TDP-43 in said extracellular vesicles in said sample higher than a level of TPD-43 in in extracellular vesicles in a control sample of a healthy individual, indicates that said patient has ALS and / or bvFTD associated with a TPD-43- proteinopathy.

9. The method according to any one of the preceding claims, wherein a. a 3R / 4R-Tau-ratio in the extracellular vesicles of said sample equal or below a reference value of 0.77±10%, indicates that said patient has PSP, b. a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample above a reference value of 1 ,27±10%, indicates that said patient has bvFTD associated with a Tau- proteinopathy. c. a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample of 0.77±10% to 1.27±10%, and a level of TDP-43 in the extracellular vesicles in said sample equal or higher than a cut off value of 13.87 pg / mL±20% indicates that said patient has ALS and / or bvFTD associated with a TDP-43-proteinopathy, d. said patient is diagnosed with bvFTD, and a 3R / 4R-Tau-ratio of 0.77±10% to 1 .27±10% and a level of TDP-43 equal or higher than cut off value of 13.87 pg / mL±10% in the extracellular vesicles in said sample indicates that said patient has bvFTD associated with a TDP-43-proteinopathy, and a 3R / 4R-Tau-ratio in the extracellular vesicles in said sample above a reference value of 1 ,27±10%, indicates that said patient has bvFTD associated with a Tau-proteinopathy, and / ore. a level of TDP-43 in the extracellular vesicles in said sample above a reference value of 56.18±10% pg / mL, indicates that said patient has essentially pure motor ALS.

10. The method according to any one of the preceding claims, wherein the sample is a blood sample, preferably a plasma sample.

11. The method according to any one of the preceding claims, wherein the extracellular vesicles are small extracellular vesicles (sEVs) and / or medium extracellular vesicles (mEVs).

12. The method according to any one of the preceding claims, wherein the extracellular vesicles (EVs) are neuron derived EVs.

13. The method according to any one of the preceding claims, wherein the extracellular vesicles (EVs) are L1 cell adhesion molecule (L1 CAM) positive (L1CAM+-EVs) extracellular vesicles.

14. The method according to any one of the preceding claims, wherein the level of the one or more biomarkers is indicative of disease progression and / or disease severity of said neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau- proteinopathy or associated with a TPD-43-proteinopathy15. The method according to any one of the preceding claims, comprising additionally treating the patient with a therapeutically effective agent for treating a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)- proteinopathy.

16. A kit for carrying out the method of any one of the preceding claims, comprising: a. reagents for isolating and optionally concentrating extracellular vesicles from a sample obtained from a patient, b. detection reagents for determining the level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, wherein the one or more biomarkers are a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TDP-43, c. reference data comprising a reference level for diagnosis of whether the patient has a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau-proteinopathy or associated with a TPD-43-proteinopathy, or for disease monitoring and / or therapy guidance in a patient diagnosed with a neurodegenerative disease of the FTD-ALS-spectrum associated with a Tau- proteinopathy or associated with a TPD-43-proteinopathy, d. wherein said reference data is stored on a computer readable medium and / or employed in in the form of computer executable code configured for comparing the determined levels of the one or more biomarkers to said reference level.

17. A method for treating a neurodegenerative disease of the Frontotemporal Dementia- Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), the method comprising: a. providing a sample obtained from said patient, wherein said sample comprises extracellular vesicles, b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, c. wherein the level of the one or more biomarkers indicates that the patient has (and / or allows to distinguish between) a neurodegenerative disease of the FTD- ALS-spectrum comprising a Tau-proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)- proteinopathy, and d. treating said patient with a therapeutically effective agent for treating a neurodegenerative disease of the FTD-ALS-spectrum comprising a Tau- proteinopathy or a neurodegenerative disease of the FTD-ALS-spectrum comprising a TAR DNA-binding protein 43 (TPD-43)-proteinopathy.

18. A method for determining a level of one or more FTD-ALS-spectrum biomarkers in extracellular vesicles of a sample from a patient suspected of or having a neurodegenerative disease of the Frontotemporal Dementia-Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum), the method comprising: a. providing a sample from said patient, wherein said sample comprises extracellular vesicles, and b. determining a level of one or more FTD-ALS-spectrum biomarkers in the extracellular vesicles of said sample, wherein the one or more FTD-ALS-spectrum biomarkers is a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TAR DNA-binding protein 43 (TDP-43).

19. A sample from a patient (or a sample derived from a patient sample), wherein said patient is suspected of or having a neurodegenerative disease of the Frontotemporal Dementia- Amyotrophic Lateral Sclerosis-spectrum (FTD-ALS-spectrum, the sample comprising: a. extracellular vesicles obtained from a blood sample of the patient, or the contents of said extracellular vesicles, and b. one or more binding agents that specifically bind a target FTD-ALS-spectrum biomarker, wherein said binding agents are in complex with said target biomarker, in the extracellular vesicles, or in the sample comprising the contents of said extracellular vesicles, wherein the FTD-ALS-spectrum biomarker is a ratio of the level of 3R-Tau and 4R-Tau (3R / 4R-Tau-ratio) and / or a level of TAR DNA-binding protein 43 (TDP-43).

20. The sample according to claim 19, whereina. a 3R / 4R-Tau-ratio is above 1.27±10, or b. a 3R / 4R-Tau-ratio is from 0.77±10% to 1.27±10%, and a level of TDP-43 is equal or higher than 13.87 pg / mL±20%, c. said patient is diagnosed with bvFTD, and a 3R / 4R-Tau-ratio is from 0.77±10% to 1.27±10%, and a level of TDP-43 is equal or higher than 13.87 pg / mL±10%, and / or d. a level of TDP-43 is above 56.18±10% pg / mL.

Images